Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jun 1.
Published in final edited form as: Biochim Biophys Acta Mol Basis Dis. 2021 Feb 19;1867(6):166103. doi: 10.1016/j.bbadis.2021.166103

KAT8, lysine acetyltransferase 8, is required for adipocyte differentiation in vitro.

Jasmine A Burrell 2, Jacqueline M Stephens 1,2
PMCID: PMC8026702  NIHMSID: NIHMS1677943  PMID: 33617987

Abstract

KAT8 is a lysine acetyltransferase (KAT) that plays a role in a variety of cellular functions ranging from DNA damage repair to apoptosis. The role of KAT8 in adipocyte development and function has not been studied. Notably, a large genome-wide association study identified KAT8 as part of a novel locus that significantly contributed to body mass index and other metabolic phenotypes. Hence, we examined the expression and regulation of KAT8 during adipocyte development. KAT8 mRNA and protein levels were examined over a time course of adipocyte development, and KAT8 was found to be present in both the cytosol and nucleus of 3T3-L1 adipocytes. Although KAT8 expression was not highly regulated by adipogenesis, its expression was required for the adipogenesis of 3T3-L1 cells. Loss of KAT8 expression in preadipocytes inhibited their ability to differentiate as judged by both lipid accumulation and adipocyte marker gene expression. However, if KAT8 was knocked down after clonal expansion, its absence did not inhibit adipocyte differentiation. Also, loss of KAT8 in adipocytes did not impact lipid accumulation or the expression of adiponectin or other fat markers. Although our data demonstrate that KAT8 is required for adipocyte differentiation, further studies are necessary to determine the functions and regulation of KAT8 in adipose tissue.

Keywords: adipocyte, adipogenesis, KAT8, epigenetic

Introduction

Histone acetyltransferases (HATs) are enzymes that transfer acetyl groups from acetyl CoA to specific lysine residues on target proteins that are often histones. Histone acetylation modulates chromatin structure and gene expression and is primarily controlled by HATs and reversed by histone deacetylases (HDACs). HATs acetylate other proteins besides histones and are now more commonly referred to as lysine acetyltransferases, or KATs. Of the family of KATs, KAT8 has been reported to play a role in many cellular functions. KAT8 was initially described as males-absent-on-the-first (MOF) in Drosophila melanogaster, because it is a male-specific protein that exhibits lethality when mutated in males [1]. In Drosophila, KAT8 contributes to two regulatory complexes, male-specific lethal (MSL) and non-specific lethal (NSL), that both contribute to transcriptional activation [2,3]. KAT8 is present in mammalian species in which the MSL complex is conserved [2]. KAT8, also known as MYST1, is a member of the MYST (MOZ, YBF2/SAS2, and TIP 60 protein 1) family of histone acetyltransferases that are characterized by their roles in post-translational modifications of histone and chromatin remodeling in eukaryotes [4,5]. KAT8 and other MYST proteins have a conserved MYST domain that consists of an acetyl CoA-binding motif, as well as a CCHC-type zinc finger that confers substrate recognition [5]. KAT8 also has a N-terminal chromodomain (CHD) which plays a role in RNA binding [6,7], a HAT domain, and a chromobarrel domain (CBD) at the C-terminal which modulates HAT activity [1,2]. KAT8 has a variety of substrates and can modulate many biological processes, including cell cycle regulation, embryonic development and tumorigenesis [8–16].

The most thoroughly characterized target of KAT8 in mammalian cells is Histone 4 Lysine 16 (H4K16), where it participates in protein complexes that are involved in transcriptional regulation [8]. KAT8 can also acetylate H4K5 and H4K8 [8]. Disruption of KAT8 expression and/or function can result in irregularities in cell cycle, cell proliferation, gene transcription, DNA damage repair, and early embryonic development, or promotion of tumorigenesis in a variety of cell types [8,9,16]. Histones are well-known targets for KAT8 activity, but KAT8 acetylates other proteins. Acetylation of LSD1 (lysine-specific histone demethylase 1) by KAT8 is associated with reduced tumorigenesis [10], while KAT8-mediated acetylation of the tumor suppressor p53 promotes cellular apoptosis in response to DNA damage [11–13]. KAT8 can also acetylate DBC1 (deleted in breast cancer 1) and reduce its binding affinity for the histone deacetylase, sirtuin 1 (SIRT1) to increase SIRT1 activity [14].

The incidence of obesity and related metabolic diseases, such as Type 2 Diabetes Mellitus, continues to rise around the world and represents one of the greatest public health challenges of our time. Obesity is characterized by the expansion of adipose tissue via hyperplasia and hypertrophy of adipocytes. Adipose tissue plays a key role in metabolic health, and disruption of adipocyte development or fat cell functions is associated with poor metabolic outcomes [17–19]. In addition to the roles of KAT8 described above, there is evidence that KAT8 can be influenced by or interact with proteins important in adipocyte development and function. It was reported that KAT8 expression is modulated by signal transducer and activator of transcription 5B (STAT5B) during adipogenesis [20]. Also, in HEK293T cells KAT8 has been shown to acetylate fatty acid synthase (FASN) and promote its degradation via ubiquitylation [15]. FASN is the principal enzyme of de novo lipogenesis and is critical for adipocyte development and function. Most importantly, a genome-wide associated study (GWAS) meta-analysis identified KAT8 as 1 of 97 body mass index (BMI)-associated loci that account for variations in BMI [21]. These studies prompted us to examine the role of KAT8 in adipogenesis.

Our novel studies reveal that KAT8 is expressed in adipocytes and plays a role in adipocyte development in vitro. The use of small interfering RNA (siRNA) to knock down KAT8 expression in preadipocytes and adipocytes revealed that KAT8 expression is required for the adipogenesis of 3T3-L1 cells but does not affect lipid accumulation or adipocyte marker levels in mature adipocytes. If KAT8 is knocked down after the clonal expansion phase of adipogenesis, it does not affect adipogenesis. In contrast with what has been observed in other cell types [15], loss of KAT8 expression in adipocytes did not affect FASN levels.

Materials and Methods

Cell culture:

Murine 3T3-L1 preadipocytes were grown in Dulbecco’s Modified Eagle’s Media (DMEM) (Sigma-Aldrich, St. Louis, MO) with 10% bovine calf serum. Two days after confluence, preadipocytes were induced to differentiate using a standard protocol and induction cocktail composed of 3-isobutyl-methylxanthine, dexamethasone, insulin (MDI), and 10% characterized fetal bovine serum (FBS) in DMEM. HyClone calf and fetal bovine sera were purchased from Thermo Scientific (Waltham, MA) or GE Healthcare Life Sciences (Marlborough, MA). The medium was changed every 48 –72 hours during growth and differentiation.

Whole-cell extract preparation:

Cell monolayers were rinsed once with phosphate-buffered saline (PBS) and then scraped into non-denaturing immunoprecipitation (IP) buffer containing 10mM Tris (pH 7.4), 150mM NaCl, 1mM EGTA, 1mM EDTA, 1% Triton X-100, 0.5% IGEPAL CA-630, protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 μM pepstatin, 50 trypsin inhibitory milliunits of aprotinin, 10 μM leupeptin, 1 mM 1,10-phenanthroline), and phosphatase inhibitors (0.2mM sodium vanadate and 100 μM sodium fluoride). The whole-cell extracts were stored at −80°C before being thawed and passed through a 20-gauge needle seven times, then clarified via centrifugation at 13,000 × g for 10 min at 4°C.

Small interfering RNA (siRNA)-mediated knockdown during differentiation:

3T3-L1 preadipocytes, approximately 70% confluent in 10-cm plates, were trypsinized and re-plated in 6-well plates at a density of 5.8 × 105 cells/cm2 in antibiotic-free 10% bovine calf serum/DMEM. Using the protocol from Dharmacon, preadipocytes were transfected with 33 nM siRNA (Dharmacon, Lafayette, CO; Non-targeting siRNA Cat #: D-001810-10-50, siRNA targeting KAT8 Cat #: L-048962-01-0010) and the DharmaFECT Duo transfection reagent (Dharmacon, Lafayette, CO, Cat #: T-2010-03) in OptiMEM reduced serum medium (Thermo Fisher, Waltham, MA; Cat #: 31985088). Non-targeting siRNA was used as negative control. Cells were treated with the siRNA cocktail during initial plating and grown to confluence. Two days after confluence, cells were induced to differentiate with the MDI-induction cocktail, as described above, and transfected again with the siRNA cocktail. After 48 hours, the cells were treated with ¼ normal dose of insulin and transfected once again with the siRNA cocktail. Cells were fed every 48 hours with antibiotic-free media throughout the entire knockdown process. Seven days after the induction of differentiation, the cell monolayers were harvested for protein in IP buffer, and for RNA in buffer provided in the RNeasy mini kit (Qiagen, Hilden, Germany) to assess knockdown efficiency. Three biological and technical replicates were analyzed for each data set.

Small interfering RNA (siRNA)-mediated knockdown in mature adipocytes:

Fully differentiated 3T3-L1 adipocytes were trypsinized and re-plated in 6-well plates at a density of 5.8 × 105 cells/cm2 in antibiotic-free 10% fetal bovine serum/DMEM. Using the protocol from Dharmacon, preadipocytes were transfected with 50 nM siRNA (Dharmacon, Lafayette, CO; Non-targeting siRNA Cat #: D-001810-10-50, siRNA targeting KAT8 Cat #: L-048962-01-0010) and the DharmaFECT Duo transfection reagent (Dharmacon, Lafayette, CO, Cat #: T-2010-03) in OptiMEM reduced serum medium (Thermo Fisher, Waltham, MA; Cat #: 31985088). Non-targeting siRNA was used as negative control. Cells were treated with the siRNA cocktail during initial plating. The cell monolayers were harvested 48 hours later for protein in IP buffer, and for RNA in buffer provided in the RNeasy mini kit (Qiagen, Hilden, Germany) to assess knockdown efficiency. Three biological and technical replicates were analyzed for each data set.

Gel electrophoresis and immunoblotting:

Protein content of cell extracts was quantified via BCA assay. Samples were separated on 7.5%, 12%, or 15% sodium dodecyl sulfate (SDS) polyacrylamide (PA) gels (acrylamide; National Diagnostics, Atlanta, GA; Cat #: EC-890) and transferred to nitrocellulose membranes (BioRad, Hercules, CA; Cat #: 162-0115) in 25 mM Tris, 192 mM glycine, and 20% methanol. After the transfer, membrane strips were blocked in 4% non-fat milk for 1 hour at room temperature and washed with tris-buffered saline + 0.1% Tween-20 (TBS-T) before incubating with primary antibodies in TBS-T + 1% bovine serum albumin (BSA) overnight at 4°C. Strips were washed with TBS-T and then incubated with either anti-mouse or anti-rabbit horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA) for 1h. Strips were washed with TBS-T and visualized with enhanced chemiluminescence (Pierce/Thermo Scientific, Waltham, MA).

Antibodies:

Transferrin (ab82411; rabbit polyclonal) and the MitoProfile Total OXPHOS Rodent WB antibody mixture (ab110413; rabbit polyclonal) antibodies were purchased from Abcam (Cambridge, MA). Anti-PPARγ (E-8; sc-7273; mouse monoclonal) antibody was purchased from Santa Cruz Biotechnology (Dallas, TX). Anti-adiponectin (PA1-054; rabbit polyclonal) antibody was purchased from Thermo Scientific (Waltham, MA). Anti-DBC1 (5693S; rabbit polyclonal), anti-FASN (3180S; C20G5; rabbit monoclonal), anti-ERK1/2 (4695S; 137F5; rabbit monoclonal), and anti-MYST1 (4682S; D5T3R; rabbit monoclonal) antibodies were purchased from Cell Signaling Technology (Danvers, MA).

RNA analysis:

Total RNA from adipocyte monolayers was purified using the RNeasy mini kit (Qiagen, Hilden, Germany). Purified RNA was used for reverse transcription (RT) to generate cDNA according to the Applied Biosystems protocol (Applied Biosystems, Foster City, CA; Cat #: 4368813). cDNA was quantified using the real-time quantitative PCR (qPCR) method in a total volume of 10 μL (2 μL cDNA and 8 μL reaction master mix) using an Applied Biosystems 7900HT System with SDS 2.4 software, Takara SYBR premix (Takara Bio USA Inc., Madison, WI, USA), and primers from IDT (Integrated DNA Technologies, Skokie, IL, USA). Thermal cycling conditions were as follows 2 min at 50 °C; 10 min at 95 °C; 40 cycles of 15 s at 95 °C and 1 min at 60°C; final dissociation stage of 15 s at 95 °C, 15 s at 60 °C, and 15 s at 95 °C. Non-POU domain containing octamer binding protein (NoNo) was used as a reference gene. The following mouse genes were examined by RT-qPCR: Adiponectin (Adpn), Fatty Acid Binding Protein 4 (aP2), Fatty Acid Synthase (Fasn), Glucose Transporter 4 (Glut4), and Lysine Acetyltransferase 8 (KAT8). Primer sequences are shown in Table 1.

Table 1.

qPCR Primer Sequences.

Gene Primer 1, 5’-3’ Primer 2, 5’-3’
Non-POU domain containing octamer binding protein (Nono) CATCATCAGCATCACCACCA TCTTCAGGTCAATAGTCAAGCC
Adiponectin (Adpn) TGTCTGTACGATTGTCAGTGG GCAGGATTAAGAGGAACAGGAG
Fatty acid binding protein 4 (aP2) CCCTCCTGTGCTGCAGCCTTTC GTGGCAAAGCCCACTCCCACTT
Fatty Acid Synthase (Fasn) GGCATCATTGGGCACTCCTT ACCAACAGCTGCCATGGATC
Glucose Transporter 4 (Glut4) GAGAATACAGCTAGGACCAGTG TCTTATTGCAGCGCCTGAG
Lysine Acetyltransferase 8 (Kat8) CGAGTACTGCCTCAAATACATGA GCCATCCACTTCATACACAGA
Open in a new tab

Lipid Staining:

Seven days after the induction of differentiation, cells were fixed and stained with Oil Red O (ORO; Sigma-Aldrich, St. Louis, MO, USA) as described previously [19].

Statistical analysis:

Statistical analyses were performed using GraphPad Prism software (version 8; La Jolla, CA, USA). Differences between groups were calculated using two-way ANOVA and Tukey’s test post-hoc analysis. Results are shown as mean ± standard error of the mean (SEM). Results were considered statistically significant when p < 0.05.

Results

We examined the expression of KAT8 mRNA and protein over a time course of adipocyte development using the 3T3-L1 model system. As shown in Figure 1A, KAT8 protein levels were highest in preadipocytes (time 0) but did not significantly change over the period of adipocyte development. We also observed an increase in histone 4 (H4) expression as well as an increase in H4K16 acetylation. SIRT1 levels also increased during differentiation. As expected, adiponectin and PPARγ levels were substantially increased during adipogenesis, and ERK levels were unchanged. These changes in protein levels are quantitated in Figure 1B. Similarly, there were no significant changes in Kat8 gene expression during adipogenesis despite the time-dependent increase in aP2, adiponectin, and fatty acid synthase mRNA levels (Figure 1C). In mature adipocytes, subcellular fractionation demonstrated that although KAT8 primarily localizes in the nucleus, it is also present in the cytosol, but not in the mitochondria (Figure 2). DBC1 was utilized as a positive control for nuclear protein and ERK1/2 was utilized as a positive control for cytosolic protein. COX1 was used as positive control for mitochondrial protein.

Figure 1. KAT8 expression over a time course of adipogenesis in 3T3-L1 cells.

Figure 1.

Open in a new tab

3T3-L1 preadipocytes were induced to differentiate using the 3-isobutyl-methylxanthine, dexamethasone, insulin (MDI) cocktail, and whole-cell extracts were harvested at the indicated time points to assess KAT8 protein expression over a time course of adipocyte differentiation. (A) Whole-cell extracts (50 μg of protein per lane) were subjected to Western blot analysis. Adiponectin was utilized as a positive control for adipogenesis. (B) Relative protein expression of KAT8, AcH4K16, and H4 were quantified and normalized to ERK 1/2 expression. (C) RNA was isolated, purified, and subjected to RT-qPCR to measure gene expression of Kat8, adipogenic markers (adiponectin [Adpn], fatty acid synthase [Fas], and fatty acid binding protein [Ap2] (n = 3 wells per treatment). Target gene expression was normalized to the reference gene, Nono.

Figure 2. KAT8 is expressed in the nucleus and cytosol of 3T3-L1 adipocytes, but not in mitochondria.

Figure 2.

Open in a new tab

Monolayers of fully differentiated 3T3-L1 cells were collected and subjected to subcellular fractionation that was optimized to separate cytosolic (cyto), nuclear (nuc), and mitochondrial (mito) fractions. Fractionated samples (40 μg of protein per lane) were subjected to Western blot analysis. This experiment was independently performed on three different batches of adipocytes with identical results.

To assess the requirement of KAT8 for adipogenesis, we performed siRNA-mediated knockdowns of KAT8 in 3T3-L1 preadipocytes prior to induction of adipogenesis and assessed adipocyte differentiation 7 days post-induction. Effective knockdown of the Kat8 gene was confirmed by qPCR (Figure 3C). The induction of three adipogenic mRNAs, adiponectin (Adpn), aP2/FABP4, and fatty acid synthase was also inhibited with KAT8 knockdown (Figure 3C). The loss of KAT8 protein was confirmed by western blot analysis and was associated with reduced expression of adiponectin and PPARγ (Figure 3A and B), the primary regulator of adipogenesis. ERK levels were examined as a loading control. Loss of KAT8 during adipogenesis was also associated with an inhibition of lipid accumulation as judged by Oil Red O staining of neutral lipids (Figure 3D). Although Fasn mRNA expression is markedly decreased, non-targeting siRNA did not attenuate adipocyte marker protein expression or lipid accumulations (Figures 3A–D).

Figure 3. Knockdown of Kat8 gene expression with siRNA inhibits adipogenesis of 3T3-L1 cells.

Figure 3.

Open in a new tab

3T3-L1 preadipocytes were transfected with non-targeting (NT) siRNA or KAT8 siRNA upon plating and every 48 hours following induction of differentiation with MDI cocktail until end point assessments. Protein and gene expression assessments as well as Oil Red O staining were conducted on the cells at 7 days post MDI. (A) Whole-cell extracts were isolated and 40 μg of protein per lane was analyzed by Western blot analysis (n= 2–3 pooled replicates/well/treatment). Adiponectin and PPARγ were utilized as differentiated adipocyte markers. (B) Relative protein expression of KAT8, ADPN, and PPARγ were quantified and normalized to ERK 1/2 expression. (C) RNA was isolated, purified, and subjected to RT-qPCR to show gene expression of Kat8 and adipogenic markers (adiponectin [Adpn], fatty acid synthase [Fas], and fatty acid binding protein 4 [Ap2]). Data were analyzed by two-way ANOVA. *P < 0.05 and ****P < 0.0001 vs. NT control (n= 3 wells per treatment). (D) Cells were fixed and stained with Oil Red O to examine lipid accumulation.

Many genes that influence adipogenesis do so by regulating early events in adipogenesis during the process of mitotic clonal expansion. Hence, we examined the ability of KAT8 to inhibit adipogenesis by knocking it down after the initiation of adipogenesis. The knockdown of KAT8 prior to the induction of adipogenesis completely inhibited adipogenesis as assessed by lipid accumulation with Oil Red O staining (Figure 3D and 4C). However, if KAT8 was knocked down 1–2 days after the induction of adipogenesis, it did not influence the ability of cells to differentiate (Figures 4A–4C). A loss of KAT8 prior to adipogenesis resulted in decreased histone 4 (H4) expression, but this was not observed if KAT8 was knocked down after the induction of adipogenesis. As shown in Figure 4A, a loss of KAT8 was associated with decreased H4K16 acetylation when added prior to the induction of adipogenesis (pre-clonal expansion). KAT8 has many substrates in addition to H4K16, so we cannot conclude the ability of KAT8 to inhibit adipogenesis in early events of adipogenesis is mediated by H4K16.

Figure 4. The effects of KAT8 knockdown before and after mitotic clonal expansion in 3T3-L1 cells.

Figure 4.

Open in a new tab

Fully differentiated 3T3-L1 cells were transfected with nontargeting (NT) siRNA or KAT8 siRNA either 48 hours before MDI (pre-clonal expansion) or 48 hours after MDI (post-clonal expansion) before collection of whole cell extracts. Protein expression assessment and Oil Red O staining were conducted. (A) Whole-cell extracts were isolated and analyzed by Western blot analysis (n= 3 replicates pooled/treatment). ERK 1/2 was utilized as a loading control. (B) Relative protein expression of KAT8, AcH4K16, and H4 were quantified and normalized to ERK 1/2 expression. (C) Cells were fixed and stained with Oil Red O to examine lipid accumulation. This is one of three representative experiment performed on independent batches of cells.

We also performed siRNA-mediated knockdowns of KAT8 in mature adipocytes to evaluate potential effects on lipid accumulation and expression of adipogenic markers. Unlike the loss of KAT8 in preadipocytes, a significant loss of Kat8 expression in mature 3T3-L1 adipocytes was not associated with decreased expression of various adipogenic marker mRNAs, including adiponectin, aP2, Glut4, and Fasn (Figure 5C). Although KAT8 protein expression was significantly reduced, there were no differences in protein expression of adiponectin or FASN in the KAT8 siRNA-transfected condition as compared to non-targeting siRNA in adipocytes (Figure 5A–B). Of note, the siRNA treatments were associated with decreased expression of adiponectin and FASN and with an increase in transferrin expression, but these effects were not due to the loss of KAT8 (Figure 5A). In addition, loss of KAT8 in mature adipocytes had no effect on neutral lipid accumulation, as judged by Oil-Red O staining (Figure 5D).

Figure 5. Knockdown of Kat8 gene expression with siRNA in matured 3T3-L1 cells.

Figure 5.

Open in a new tab

Fully differentiated 3T3-L1 cells were transfected with nontargeting (NT) siRNA or KAT8 siRNA for 48 hours before collection of whole cell extracts. Protein and gene expression assessments as well as Oil Red O staining were conducted. A) Whole-cell extracts and media were isolated and 150 μg of protein per lane was analyzed by Western blot analysis (n= 3 replicates/treatment). Adiponectin, transferrin, and fatty acid synthase were utilized as differentiated adipocyte marker. (B) Relative protein expression of KAT8, ADPN, TFN, and FAS were quantified and normalized to ERK 1/2 expression. (C) RNA was isolated, purified, and subjected to RT-qPCR to show gene expression of Kat8 and adipogenic markers (adiponectin [Adpn], fatty acid binding protein 4 [Ap2], glucose transporter 4 [Glut4], and fatty acid synthase [Fas]). Data were analyzed by two-way ANOVA. *P < 0.05 and ****P < 0.0001 vs. NT control (n= 3 wells per treatment). (D) Cells were fixed and stained with Oil Red O to examine lipid accumulation.

Discussion

KAT8 is expressed in preadipocyte and adipocytes, but neither KAT8 mRNA nor protein levels are highly regulated during adipogenesis (Figure 1). Another study has indicated that KAT8 expression is increased during adipocyte differentiation in the 3T3-L1 model system [20]. However, our gene and protein expression data from experiments repeated several times on at least a dozen batches of cells do not support this observation. Of note, KAT8 expression is regulated during differentiation of other cell types, including oocytes and glioblastomas [22,23]. In addition, KAT8 has also been shown to be required in the maintenance of embryonic stem cell self-renewal and pluripotency [24], and siRNA-mediated loss of KAT8 impairs formation and proliferation of porcine blastocysts [25]. In vitro, adipogenesis is dependent on a process referred to as mitotic clonal expansion [26], where cells undergo one to two rounds of proliferation prior to differentiation and a permanent exit from the cell cycle. Our results indicate that KAT8 regulates early adipogenic events such as clonal expansion, since knockdown after these early events does not result in an inhibition of adipogenesis (Figure 6). Genes that play a critical role in regulating body weight and fat mass, such as FTO, modulate adipogenesis by regulating these early events in adipocyte development [27]. Future studies will be needed to determine if KAT8 is a crucial modulator of adipogenesis in vivo.

Figure 6.

Figure 6.

Open in a new tab

A visual representation of the effects of KAT8 knockdown on adipogenesis before and after mitotic clonal expansion.

In adipocytes, we observed that KAT8 is present in the cytosol, but KAT8 protein levels are enriched in the adipocyte nucleus (Figure 2). KAT8 subcellular localization varies between cell types. In HeLa cells, KAT8 is found in the mitochondria where it binds mitochondrial DNA and regulates mitochondrial gene expression associated with respiration [28]. Notably, in HeLa cells lacking KAT8, a mitochondrial wild-type KAT8, but not a catalytic mutant, can restore respiratory and transcriptional defects induced by loss of KAT8 [28]. Further support for a role of KAT8 in mitochondrial respiration comes from studies in failing human and murine hearts, where KAT8 expression is decreased [29]. Future studies will be needed to determine how the nuclear and mitochondrial pools of KAT8 contribute to regulation of transcription and energy metabolism in complex tissues, including adipose tissue.

Use of siRNA knockdowns revealed that KAT8 expression is required for adipogenesis in the 3T3-L1 model system (Figure 3). The only other study of KAT8 in adipocytes indicated that KAT8 was increased during adipogenesis, and that the KAT8 promoter was bound by STAT5B [20]. In that study, loss of KAT8 led to increased expression of adipocyte marker genes and the study’s authors concluded that KAT8 and STAT5B were negative regulators of adipogenesis. However, STAT5 proteins are well-known positive regulators of adipocyte development in vitro and in vivo [30,31]. Hence, these observations are in conflict with the data from our rigorous studies and with what is known about STAT5’s role in adipogenesis. To our knowledge, there are no published studies on loss of KAT8 in adipocytes in vitro or in vivo. Our data reveal that loss of KAT8 in mature adipocytes is not accompanied by decreased expression of adipocyte markers such as adiponectin, fatty acid synthase, or GLUT4 (Figure 5A –C). Moreover, a 48-hour knockdown of KAT8 produced no changes in neutral lipid accumulation in adipocytes (Figure 5D). These data suggest that KAT8 has different functions in preadipocytes and adipocytes, which is not a surprise given the diverse functions of KAT8 in a variety of cell types. In terms of diverse functions of KAT8, a recent study has shown that the active site of KAT8 may have other substrates besides lysine [32], further complicating understanding the cell specific functions of this epigenetic modifier.

Since KAT8 has cell-specific functions, it will be important to determine the function of this acetyltransferase during adipogenesis as well as in mature adipocytes. Our observations on KAT8 are novel and, except for the study cited above, there are no other data on KAT8 in adipocytes. However, a European meta-analysis of GWAS data has identified KAT8 in a locus associated with variability in body mass index [21]. In addition, a whole genome analysis of 597 healthy people from all areas of China showed that an altered allele in KAT8 significantly correlated with waist circumference in northern Han males [33].

Of other possible relevance is a study in HEK293 cells showing that KAT8 can regulate fatty acid synthase (FASN) expression via acetylation [15]. Since FASN is essential for lipogenesis, we predicted that FASN might be a substrate of KAT8 in mature adipocytes. However, loss of KAT8 in mature fat cells did not affect FASN expression (Figure 5A) or half-life (data not shown). Overall, our data demonstrate that KAT8 is required for early events of in vitro adipogenesis, but not for lipid accumulation after clonal expansion or for lipid accumulation and expression of adipocyte markers in mature fat cells. These data suggest that KAT8 has different functions in preadipocytes and adipocytes. In adipocytes, KAT8 is largely present in the nucleus, suggesting it is likely involved in transcriptional regulation. Given its role in adipogenesis and its expression in adipocyte nuclei, it is likely that KAT8 contributes to fat cell function.

Highlights:

  • These novel observations show that KAT8 expression is required for the early events of adipogenesis.

  • Inhibition of KAT8 before clonal expansion blocks adipogenesis.

  • Loss of KAT8 in mature adipocyte does not affect lipid accumulation

Acknowledgement:

We would like to thank Anik Boudreau for technical assistance.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflicts of Interest: The authors report no conflicts of interest.

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Neither Jasmine Burrell or Jacquelin Stephens have competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  • 1.Schunter S; Villa R; Flynn V; Heidelberger JB; Classen A-K; Beli P; Becker PB Ubiquitylation of the acetyltransferase MOF in Drosophila melanogaster. PLoS One 2017, 12, 1–20, doi: 10.1371/journal.pone.0177408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Keller CI; Akhtar A The MSL complex: juggling RNA–protein interactions for dosage compensation and beyond. Curr. Opin. Genet. Dev 2015, 31, 1–11, doi: 10.1016/J.GDE.2015.03.007. [DOI] [PubMed] [Google Scholar]
  • 3.Larschan E; Soruco MML; Lee O-K; Peng S; Bishop E; Chery J; Goebel K; Feng J; Park PJ; Kuroda MI Identification of chromatin-associated regulators of MSL complex targeting in drosophila dosage compensation. PLoS Genet 2012, 8, 1–11, doi: 10.1371/journal.pgen.1002830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Rea S; Xouri G; Akhtar A Males absent on the first (MOF): from flies to humans. Oncogene 2007, 26, 5385–5394, doi: 10.1038/sj.onc.1210607. [DOI] [PubMed] [Google Scholar]
  • 5.Avvakum J The MYST family of histone acetyltransferases and their intimate links to cancer. Oncogene 2007, 26, 5395–5407, doi: 10.1038/sj.onc.1210608. [DOI] [PubMed] [Google Scholar]
  • 6.Becker PB; Akhtar A; Zink D Chromodomains are protein–RNA interaction modules. Nature 2000, 407, 405–409, doi: 10.1038/35030169. [DOI] [PubMed] [Google Scholar]
  • 7.Lafon A; Chang CS; Scott EM; Jacobson SJ; Pillus L MYST opportunities for growth control: yeast genes illuminate human cancer gene functions. Oncogene 2007, 26, 5373–5384, doi: 10.1038/sj.onc.1210606. [DOI] [PubMed] [Google Scholar]
  • 8.Su J; Wang F; Cai Y; Jin J The functional analysis of histone acetyltransferase MOF in tumorigenesis. Int. J. Mol. Sci 2016, 17, 1–18, doi: 10.3390/ijms17010099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Taipale M; Rea S; Richter K; Vilar A; Lichter P; Imhof A; Akhtar A hMOF histone acetyltransferase is required for histone H4 lysine 16 acetylation in mammalian cells. Mol. Cell. Biol 2005, 25, 6798–6810, doi: 10.1128/MCB.25.15.6798-6810.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Luo H; Shenoy AK; Li X; Jin Y; Jin L; Cai Q; Tang M; Liu Y; Chen H; Reisman D; et al. MOF acetylates the histone demethylase LSD1 to suppress epithelial-to-mesenchymal transition. Cell Rep 2016, 15, 2665–2678, doi: 10.1016/j.celrep.2016.05.050. [DOI] [PubMed] [Google Scholar]
  • 11.Mellert HS; McMahon SB hMOF, a KAT(8) with Many Lives. Mol. Cell 2009, 36, 174–175, doi: 10.1016/J.MOLCEL.2009.10.005. [DOI] [PubMed] [Google Scholar]
  • 12.Sykes SM; Mellert HS; Holbert MA; Li K; Marmorstein R; Lane WS; McMahon SB Acetylation of the p53 DNA-binding domain regulates apoptosis induction. Mol. Cell 2006, 24, 841–851, doi: 10.1016/j.molcel.2006.11.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tyteca S; Legube G; Trouche D To die or not to die: a HAT trick. Mol. Cell 2006, 24, 807–8, doi: 10.1016/j.molcel.2006.12.005. [DOI] [PubMed] [Google Scholar]
  • 14.Zheng H; Yang L; Peng L; Izumi V; Koomen J; Seto E; Chen J hMOF acetylation of DBC1/CCAR2 prevents binding and inhibition of SirT1. Mol. Cell. Biol 2013, 33, 4960–4970, doi: 10.1128/MCB.00874-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lin H-P; Cheng Z-L; He R-Y; Song L; Tian M-X; Zhou L-S; Groh BS; Liu W-R; Ji M-B; Ding C; et al. Destabilization of fatty acid synthase by acetylation inhibits de novo lipogenesis and tumor cell growth. Cancer Res 2016, 76, 6924–6936, doi: 10.1158/0008-5472.CAN-16-1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gupta A; Guerin-Peyrou TG; Sharma GG; Park C; Agarwal M; Ganju RK; Pandita S; Choi K; Sukumar S; Pandita RK; et al. The mammalian ortholog of Drosophila MOF that acetylates histone H4 lysine 16 is essential for embryogenesis and oncogenesis. Mol. Cell. Biol 2008, 28, 397–409, doi: 10.1128/MCB.01045-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rosen ED; Spiegelman BM What we talk about when we talk about fat. Cell 2014, 156, 20–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Goossens GH The Metabolic Phenotype in Obesity: Fat Mass, Body Fat Distribution, and Adipose Tissue Function. Obes. Facts 2017, 10, 207–215, doi: 10.1159/000471488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goossens GH The role of adipose tissue dysfunction in the pathogenesis of obesity-related insulin resistance. Physiol. Behav 2008, 94, 206–218, doi: 10.1016/j.physbeh.2007.10.010. [DOI] [PubMed] [Google Scholar]
  • 20.Gao P; Zhang Y; Liu Y; Chen J; Zong C; Yu C; Cui S; Gao W; Qin D; Sun W; et al. Signal transducer and activator of transcription 5B (STAT5B) modulates adipocyte differentiation via MOF. Cell. Signal 2015, 27, 2434–2443, doi: 10.1016/J.CELLSIG.2015.09.010. [DOI] [PubMed] [Google Scholar]
  • 21.Locke AE; Kahali B; Berndt SI; Justice AE; Pers TH; Day FR; Powell C; Vedantam S; Buchkovich ML; Yang J; et al. Genetic studies of body mass index yield new insights for obesity biology. Nature 2015, 518, 1–48, doi: 10.1038/NATURE14177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yin S; Jiang X; Jiang H; Gao Q; Wang F; Fan S; Khan T; Jabeen N; Khan M; Ali A; et al. Histone acetyltransferase KAT8 is essential for mouse oocyte development by regulating reactive oxygen species levels. Development 2017, 144, 2165–2174, doi: 10.1242/dev.149518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dong Z; Zou J; Li J; Pang Y; Liu Y; Deng C; Chen F; Cui H MYST1/KAT8 contributes to tumor progression by activating EGFR signaling in glioblastoma cells. Cancer Med 2019, 8, 7793–7808, doi: 10.1002/cam4.2639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li X; Li L; Pandey R; Byun JS; Gardner K; Qin Z; Dou Y The histone acetyltransferase MOF is a key regulator of the embryonic stem cell core transcriptional network. Cell Stem Cell 2012, 11, 163–178, doi: 10.1016/j.stem.2012.04.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cao Z; Wu R; Gao D; Xu T; Luo L; Li Y; Han J; Zhang Y Maternal histone acetyltransferase KAT8 is required for porcine preimplantation embryo development. Oncotarget 2017, 8, 90250–90261, doi: 10.18632/oncotarget.21657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tang QQ; Otto TC; Daniel Lane M Mitotic clonal expansion: A synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. U. S. A 2003, 100, 44–49, doi: 10.1073/pnas.0137044100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Merkestein M; Laber S; McMurray F; Andrew D; Sachse G; Sanderson J; Li M; Usher S; Sellayah D; Ashcroft FM; et al. FTO influences adipogenesis by regulating mitotic clonal expansion. Nat. Commun 2015, 6, 1–9, doi: 10.1038/ncomms7792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chatterjee A; Seyfferth J; Lucci J; Gilsbach R; Preissl S; Böttinger L; Mårtensson CU; Panhale A; Stehle T; Kretz O; et al. MOF Acetyl Transferase Regulates Transcription and Respiration in Mitochondria. Cell 2016, doi: 10.1016/j.cell.2016.09.052. [DOI] [PubMed] [Google Scholar]
  • 29.Qiao W; Zhang W; Gai Y; Zhao L; Fan J The histone acetyltransferase MOF overexpression blunts cardiac hypertrophy by targeting ROS in mice. Biochem. Biophys. Res. Commun 2014, doi: 10.1016/j.bbrc.2014.04.112. [DOI] [PubMed] [Google Scholar]
  • 30.Floyd ZE; Stephens JM STAT5A promotes adipogenesis in nonprecursor cells and associates with the glucocorticoid receptor during adipocyte differentiation. Diabetes 2003, 52, 308–314, doi: 10.2337/diabetes.52.2.308. [DOI] [PubMed] [Google Scholar]
  • 31.de Sá PM; Richard AJ; Hang H; Stephens JM Transcriptional regulation of adipogenesis. In Comprehensive Physiology; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2017; Vol. 7, pp. 635–674. [DOI] [PubMed] [Google Scholar]
  • 32.Proietti G; Wang Y; Punzo C; Mecinović J Substrate Scope for Human Histone Lysine Acetyltransferase KAT8. Int. J. Mol. Sci 2021, 22, 846, doi: 10.3390/ijms22020846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Du Z; Ma L; Qu H; Chen W; Zhang B; Lu X; Zhai W; Sheng X; Sun Y; Li W; et al. Whole Genome Analyses of Chinese Population and De Novo Assembly of A Northern Han Genome. Genomics, Proteomics Bioinforma 2019, 17, 229–247, doi: 10.1016/j.gpb.2019.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES