Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Mar 1.
Published in final edited form as: Placenta. 2021 Feb 13;106:40–48. doi: 10.1016/j.placenta.2021.02.005

Molecular Mechanisms Regulating Lysophosphatidylcholine Acyltransferase 1 (LPCAT1) in Human Pregnancy

Neeraja Purandare 1, Paige Minchella 1, Mallika Somayajulu 1, Katherine J Kramer 2, Jordan Zhou 1, Nellena Adekoya 3, Robert A Welch 4, Lawrence I Grossman 1, Siddhesh Aras 1, Maurice-Andre Recanati 3
PMCID: PMC8026739  NIHMSID: NIHMS1673890  PMID: 33618181

Abstract

Introduction:

Lysophosphatidylcholine Acyltransferase 1 (LPCAT1) is necessary for surfactant production of in fetal lungs. Mechanisms responsible for its regulation during gestation remain to be elucidated. Our goal is to evaluate molecular mechanisms regulating LPCAT1 expression during gestation and after glucocorticoid administration.

Methods:

Placentas throughout gestation were assayed for LPCAT1 protein levels. A placental cell line, HTR-8/SVneo (HTR), was used as a model to test the effects of placental oxygen tension found during pregnancy as well as the effects of dexamethasone used therapeutically in the clinic.

Results:

LPCAT1 protein levels are maximal in late third trimester placental samples and are expressed strongly on the basal plate. LPCAT1 was maximally upregulated at 4% O2 (P<0.01), corresponding to oxygen tension found in placenta at term. Mitochondrial nuclear retrograde regulator 1 (MNRR1), a bi-organellar (mitochondria and nucleus) regulator, transcriptionally activates LPCAT1. Antenatal corticosteroids (ACS) upregulate LPCAT1, at least in part, by an MNRR1-dependent pathway. HTR cells treated with 25 nM dexamethasone for 24 h exhibited a 2-fold increase in LPCAT1 levels compared to controls. In MNRR1 knockout cells, the response to ACS is significantly blunted.

Discussion:

LPCAT1 appears to be induced by MNRR1. Hypoxia and corticosteroids increase LPCAT1 expression through an MNRR1 dependent pathway. LPCAT1 protein levels can be measured in maternal plasma and rise throughout gestation and in response to ACS.

Keywords: Lysophosphatidylcholine Acyltransferase 1, LPCAT1, lung maturation, steroids, hypoxia, pregnancy

INTRODUCTON

Neonatal respiratory distress syndrome (RDS), formerly known as hyaline membrane disease, generally affects preterm newborns. Worldwide, over 15 million babies are premature annually [1] and these numbers have been increasing year to year [2]. RDS is primarily caused by deficiency of pulmonary surfactant in immature lungs and is a major cause of morbidity and mortality in preterm infants. Pulmonary surfactant, which is developmentally regulated, is produced by alveolar type II pneumocytes and reduces the alveolar surface tension in order to maintain the alveolar patency necessary for gas exchange [3]. Surfactant is a biochemical complex principally made up of phospholipids (90%) and four surfactant specific proteins (10%).

Antenatal corticosteroids (ACS), including betamethasone or dexamethasone, are partially effective in preventing RDS and neonatal mortality and have become the mainstay of prophylactic treatment before preterm birth [4-6]. ACS, among their many effects, accelerate maturation of type II pneumocytes and increase surfactant production [7]. Pulmonary surfactant appears later in pregnancy and, in anticipation of an imminent preterm delivery, ACS have been shown to increase its production and decrease the incidence and severity of RDS [8, 9]. The mechanisms through which steroids activate surfactant production have, to date, been poorly understood.

Our group previously demonstrated a linear correlation between the lamellar body count (LBC), a common clinical marker for fetal lung maturity [10-12], and lysophosphatidylcholine acyltransferase 1 (LPCAT1) mRNA in both amniotic fluid and maternal plasma [13, 14]. It is known that LPCAT1 synthesizes phosphatidylcholine (PC) and phosphatidylglycerol (PG), [15] the two predominant phospholipids found in pulmonary surfactant by mediating the conversion of 1-acyl-sn-glycero-3-phosphocholine (LPC) into PC [16]. However, to date, the mechanisms by which LPCAT1 is regulated remain unclear and the cells responsible for its expression are yet to be determined.

Using human placental samples and cell culture models, we describe a novel mechanism by which LPCAT1 expression is regulated during gestation and show its distribution within the placenta. Additionally, we interrogate the regulatory effects of ACS on LPCAT1 expression and elucidate a potential mechanism of action for the protection of neonates against RDS.

MATERIALS AND METHODS

Human subjects

With prior IRB approval (Wayne State University IRB #041314MP2F, #041717MP2F and Detroit Medical Center CRO#19284), placental tissue was collected after spontaneous vaginal delivery of a live neonate or after first trimester miscarriage between December 2018 and July 2019, upon signed written informed consent. Patients deemed to be in imminent risk of preterm delivery were treated with betamethasone 12 mg intramuscularly every 24 h for 2 consecutive days. Maternal blood samples were collected in EDTA tubes.

Human Placenta Specimens

Tissue used in this study was from placentas submitted by the obstetrician for pathologic examination following delivery. The placentas were examined grossly, and the sections submitted for microscopic examination were formalin fixed, processed routinely, and paraffin embedded. A perinatal pathologist examined hematoxylin and eosin stained slides to confirm full-thickness and absence of pathology prior to providing slides to us (data not shown). Sections from unremarkable term placentas that included both fetal surface and basal plate were selected for additional study.

Human Blood Specimens

Protein isolation from serum was performed as described [17] with modifications. Blood was centrifuged at 2000 rpm for 5 min to pellet cells. The supernatant was collected, mixed with fresh 10% TCA (trichloroacetic acid) solution in a 4:1 ratio, and incubated for 1 h at 4°C. After centrifugation at 14,000 rpm for 30 min at 4°C, the pellet collected, washed twice with acetone and centrifuged for 10 min in a similar fashion. The pellet was air dried, resuspended in lysis buffer and centrifuged again. The supernatant was used for quantitation and immunoblotting.

Immunofluorescence

Paraffin imbedded slides were treated with xylene followed by a decreasing gradient of ethanol and washed with water prior to antigen retrieval. Antigen retrieval was performed by heating the slides in a 10 mM citrate buffer pH 6 with 0.1% Tween at 90°C for 15 min and left at room temperature for 30 min. After antigen retrieval, slides were incubated with rabbit anti-LPCAT1 (Proteintech) diluted 1:100 for 18h at 4°C and rinsed 3X with phosphate buffered saline (PBS). Next, they were incubated with an anti-rabbit IgG antibody conjugated to Alexa 596 (Jackson ImmunoResearch) for 3 h and rinsed 3X with PBS. Finally, the cells were stained with DAPI 1: 10,000 in methanol, rinsed with PBS and coverslips mounted with Aquamount. Frozen sections obtained from placentas from different trimesters were also stained as mentioned above.

For visualizing LPCAT1 at the fetal-maternal interface, frozen sections were thawed in PBS prior to fixation with 4% paraformaldehyde (PFA). Antigen retrieval was performed by heating the slides in a 10 mM citrate buffer solution at 90°C, pH 6 for 30 min. After antigen retrieval, slides were permeabilized using 0.2% Triton X-100 for 15 min at room temperature prior to being blocked with 5% bovine serum albumin (BSA) (Sigma) + 0.1% Tween in PBS for 1 h at room temperature. Primary antibodies specific for Cytokeratin-7 (Sigma), diluted 1:100, and LPCAT1 (1:100) as well as DAPI were stained at 4°C overnight in in blocking solution. The following day, slides were washed and probed with fluorescently labeled secondary antibodies for 1 h at room temperature. Sections were imaged on a Leica TCS S5P microscope and images were processed in Photoshop.

Cell culture

HTR-8/SVneo cells as well as HEK293 cells were purchased from the American Type Culture Collection (ATCC). The HTR-8/SVneo cells were grown in RPMI 1640 with 10% fetal bovine serum and 1% penicillin-streptomycin and the HEK293 WT and MNRR1-KO [18] were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum and 1% penicillin-streptomycin.

Effector and Reporter plasmids

MNRR1-3xFlag expression plasmid has been described previously [19, 20]. The LPCAT1 promoter Gaussia luciferase in the LvPG02 expression plasmid was purchased from GeneCopoeia, Rockville, MD. All expression plasmids were purified using the EndoFree plasmid purification kit (Qiagen, Valencia, CA).

Transfection

TransFast transfection reagent (Promega, Madison, WI, USA) was used to transfect plasmids. Cells were plated a day prior to transfection. TransFast reagent was mixed with the indicated concentrations (μg) of DNA at a ratio of 2:1 in complete medium. Following incubation at room temperature for 15 min, the mixture was overlaid onto the cells. Media containing TransFast was replaced with fresh medium 12 h post-transfection. Unless indicated otherwise, all transfection assays were analyzed 48 h post-transfection.

Immunoblotting

Immunoblotting was performed as described previously [19, 20]. In short, cells/tissues were resuspended in lysis buffer [21] and incubated on ice for 30 min after sonication. Lysates were centrifuged at 14000 rpm for 30 min and the supernatant was used for protein quantitation and immunoblotting.

Real-time Polymerase Chain Reaction

Real-time PCR analysis was performed as described previously [21, 22]. Total cellular RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions. Complementary DNA (cDNA) was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (NeB, Ipswich, MA, USA). Transcript levels were measured by real time PCR using SYBR-green on an ABI7500 system. Real-time analysis was performed by the ΔΔCt method [23]. The primer sequences used were as follows (F, forward; R, reverse). LPCAT1 (F- GTCAGACCAGGATTCTCGCAGG, R-GAAGGTAATTAGGCAGGTCCTGTTTGTACAA), GAPDH- (F- GAGTCAACGGATTTGGTCGT, R- TTGATTTTGGAGGGATCTCG)

Luciferase reporter assays

Luciferase levels were measured using the Secrete-Pair Gaussia luciferase assay kit (GeneCopoeia) per the manufacturer’s instructions. Luciferase levels have been depicted relative to the control set at 100.

RNA Sequencing

RNA sequencing was performed as described previously [24]. Total RNA from MNRR1-WT (WT), MNRR1-KO (R1-KO), and MNRR1-KO expressing a transcriptionally active version of MNRR1 (R1-KO+TA-R1) was isolated. Samples with a RIN ≥8 were used for further processing. Indexed (barcoded) libraries were generated using the Illumina TruSeq Stranded Total RNA Library preparation kit. Sequencing of the libraries was performed on the lllumina’s HiSeq 2500 next-generation sequencer. The sequencing read data was converted to a text-based FastQ format for analysis using Base Space Sequence Hub (Illumina, San Diego, CA).

Hypoxia experiments

Cells were incubated for the indicated times under 20% oxygen or 4% oxygen in an incubator at 37°C and infused with CO2 and N2. The gas flow was controlled with a proOX110 gas controller (BioSpherix, Redfield, NY) to achieve 4% oxygen and 5% CO2.

Reagents

The anti-MNRR1 and anti-LPCAT1 antibodies were purchased from Proteintech Group Inc. (Chicago, IL). All the housekeeping protein antibodies were purchased from Cell Signaling Technology (Danvers, MA).

Statistical analysis

Statistical analyses were performed using MSTAT version 6.1.1 (N. Drinkwater, University of Wisconsin, Madison, WI). Two-sided Wilcoxon rank sum tests were used to calculate statistical significance.

RESULTS

1). LPCAT expression rises late in pregnancy

Our group previously demonstrated that, towards the end of pregnancy, LPCAT1 mRNA increases in both amniotic fluid [13] and in maternal plasma [14]. LPCAT1 mRNA levels correlated linearly with lamellar body count, a marker for fetal lung maturity, and was undetectable in non-pregnant controls [13]. We therefore hypothesized that the placenta was the source of LPCAT1. To this end, we tested the mRNA levels of LPCAT1 in early and late stage placental tissues using RT-qPCR. LPCAT1 transcript levels were significantly higher in term placental tissue compared to the early gestation (Figure 1A). As a next step, we tested for LPCAT1 protein expression in first, second, and third trimester placentas as well as late-term samples (data not shown). LPCAT1 levels are highest in third trimester placentas, in support of the transcript levels as well as our previous work [14] (Figure 1B). Additionally, immunofluorescence microscopy of placental tissue also showed higher LPCAT1 expression in third trimester placentas (Figure 1C).

Figure 1: LPCAT 1 levels are maximal in late third trimester placental samples.

Figure 1:

Open in a new tab

A: LPCAT1 transcript levels are higher in the third, as compared to first, trimester placentas as measured using real-time PCR. GAPDH was used as a housekeeping gene (error bars depict standard deviation, *indicates p<0.05). B: Equal amounts of protein samples from placental tissue were separated on an SDS-PAGE gel and probed for LPCAT1 levels. Actin was probed as loading control. The bar graph represents relative LPCAT1/Actin levels. This western is representative of the samples in the three trimesters (n=3). C: DAPI and LPCAT1 Immunostaining near the maternal-fetal interface portion of the placenta showing increased LPCAT1 expression in the late third trimester.

The placenta, an organ of fetal origin, is essentially composed of a chorionic plate on the fetal side, chorionic villi, and a basal plate that interfaces with the uterine wall [25] (Figure 2A). We analyzed LPCAT1 expression in the placenta using immunohistochemistry of full-thickness third trimester placental tissue (Figure 2B). This data confirms that LPCAT1 is expressed in the placenta and, in addition, suggests that LPCAT1 is predominantly expressed on the basal plate. As a next step, we examined this fetal-maternal interface more closely using the trophoblast marker cytokeratin 7[26], and confirmed maximal LPCAT1 expression at the decidua (Figure 2C). To verify this finding, we separated the fetal, villous, and maternal regions of the placenta under a dissecting microscope based on their physical characteristics and performed immunoblotting analysis (Figure 2D). To the best of our knowledge, we could not identify any absolutely specific western blotting antibodies to help distinguish these three regions. Results corroborated differential expression of LPCAT1 with maximal expression closer to the maternal-fetal interface, which suggested that LPCAT1 was produced mostly by trophoblasts, prompting the choice of a trophoblastic cell line (HTR) for in vitro study of LPCAT1 expression. Taken together, these observations suggest that LPCAT1 is transcriptionally induced in placental tissue in the late third trimester. In addition, placental trophoblasts are major cell types that induce LPCAT1.

Figure 2: LPCAT 1 levels are maximal on maternal side of the placenta.

Figure 2:

Open in a new tab

A: Schematic illustration depicting maternal, middle (villi) and fetal sides of the placenta [25]. B: Full-thickness immunostaining of third trimester placenta showing increased expression of LPCAT1 at the fetal-maternal interface (right). C: Closeup of fetal maternal border immunostaining DAPI (blue), cytokeratin 7 (green), LPCAT1 (red) confirming highest LPCAT1 expression at the decidua. Scale bar represents 100 μm. D: Western blot for fetal, middle (villi) and maternal fractions showing that LPCAT1 protein levels are highest on maternal side. Equal amounts of placental lysates from fetal, middle (villi) and maternal regions of placentas were separated on an SDS-PAGE gel and probed for LPCAT1 protein levels. GAPDH was probed as loading control. Error bars represent standard deviation, n=4 samples (* indicates p<0.05).

2). LPCAT expression is hypoxia responsive and maximal at 4% O2

One of the key differences in placenta across gestation is the variability in the oxygen tension. Studies in the past have identified specific oxygen tensions in placental tissues during the first, second, and the third trimesters. Shortly after fertilization in the oviduct, the human embryo travels to the uterus where oxygen tension is lower, around 2% [27]. This hypoxic environment (pO2<20 mm Hg) favors proliferation of placental trophoblasts that subsequently invade the uterine wall and establish an interface between maternal blood and the embryo [28]. Oxygen tension then increases to about (40-80 mmHg, ~ 8%) in the second trimester as intervillous circulation is instituted at about 10-12 weeks gestation [29, 30]. Placental oxygen tension remains stable at around 8% throughout the second and most of the third trimester, before decreasing to about 30 mm Hg, or about 4% oxygen tension after 37 weeks gestation [31, 32]. (Figure 3A). To test if oxygen tension is responsible for the differential LPCAT1 levels in the placenta, we used a cell culture model. HTR-8/SV-neo (HTR), a placental trophoblast cell line, was incubated at 2%, 8% and 4% O2 (as detailed in Materials and Methods) corresponding to the oxygen tensions in placenta during first, second, and late third trimester of pregnancy. Extracellular LPCAT1 protein levels were highest at 4% O2 (Figure 3B, significant when comparing 2% and 4 % O2, P<0.05) and were also maximally upregulated at 4% O2 intracellularly (Figure 3C).

Figure 3: LPCAT1 is maximally upregulated at 4% O2.

Figure 3:

Open in a new tab

A: Oxygen tension varies during pregnancy. In late third trimester, oxygen tension is about 4%. B: Extracellular LPCAT1 protein levels are upregulated at 4% O2. Equal volumes of cell supernatants from cells grown at 20%, 2%, 8% and 4% O2 were separated on an SDS-PAGE gel and probed for LPCAT1 protein levels. GAPDH was probed as loading control. Protein levels from 20% O2 were used as control (horizontal dashed line) and the other three conditions for oxygen tension were plotted on a graph. Error bars represent average of samples in quadruplicate for 2% O2 and 4 % O2, and duplicate for 8% O2 (* indicates p<0.05). C: LPCAT1 protein levels are maximally upregulated at 4% O2. Equal amounts of whole cell lysates were separated on an SDS-PAGE gel and probed for LPCAT1 protein levels. GAPDH was probed as loading control.

3). Transcription factor MNRR1 regulates LPCAT1 expression

Although hypoxia research typically focuses on hypoxia inducible factor (HIF), which is maximally stabilized at oxygen tension of <1% [33], LPCAT1 protein levels in cells are maximal at 4% O2, similar to that observed in third trimester placenta. We have previously shown MNRR1, a mitochondrial-nuclear bi-organellar regulator, to be maximally induced at 4% oxygen [19]. Our group demonstrated that, in the nucleus, MNRR1 acts as a transcription factor that is maximally transcriptionally stimulated by 4% experimental hypoxia [20]. This feature suggested that MNRR1 is one of the mechanisms through which specific levels of oxygen tension caused an upregulation of LPCAT1 expression. We then tested if LPCAT1 was a transcriptional target of MNRR1. RNA-sequencing analysis comparing a) Wild type and knockout MNRR1 showed a significant reduction in LPCAT1 transcripts, and b) A knock-in of the transcriptionally active version of MNRR1 in the knockout cells rescued the defect (Figure 4A). As a next step, we examined the 1484-bp promoter for LPCAT1 and confirmed the presence of a conserved MNRR1 binding site across species (Figure 4B) suggesting an MNRR1 dependent regulation. To confirm the results suggested by the RNA-seq experiment, HTR cells were transfected with either empty vector or an expression plasmid for wild type MNRR1. Cells overexpressing MNRR1 had significantly higher LPCAT1 levels, indicating MNRR1 to be one of the transcriptional activators for LPCAT1 (Figure 4C).

Figure 4: Mitochondrial Nuclear Retrograde Regulator 1 (MNRR1) transcriptionally activates LPCAT1.

Figure 4:

Open in a new tab

A: RNA-sequencing showing that LPCAT1 transcript levels are significantly reduced in MNRR1 knockout cells (KO) relative to wild type controls (WT). This reduction is rescued by knocking-in the transcriptionally active mutant of MNRR1. B: MNRR1 binding site conservation in human, mouse and rat LPCAT1 promoter. The human promoter sequence was obtained from Genomatix (Munich, Germany) and the UCSC Genome Browser. The mouse and rat LPCAT1 sequences were obtained from Ensembl (useast.ensembl.org). Conserved core sequence in all three species are highlighted in green. C: Cells transfected with MNRR1 overexpressing construct had significantly higher LPCAT1 protein levels when compared to controls that were transfected with an empty vector (EV).

4). Antenatal steroids upregulate LPCAT1 expression in an MNRR1 dependent manner

Antenatal glucocorticoids, such as dexamethasone and betamethasone, have been used clinically for decades to hasten fetal lung maturity and decrease the incidence and severity of respiratory distress syndrome [34, 35]. Our experiments show that, in maternal plasma, LPCAT1 levels increase 24 h after completion of steroid administration (Figure 5A) in women admitted in preterm labor and treated with ACS.

Figure 5: Antenatal corticosteroids (ACS) upregulate LPCAT1 expression through an MNRRI-dependent pathway.

Figure 5:

Open in a new tab

A: Above, ACS increase circulating maternal plasma levels of LPCAT1 protein 24 h after administration in patients at imminent risk of preterm delivery. Ponceau Red staining of the membrane was performed as a loading control. Below, quantification of LPCAT1 levels from 4 independent patient samples (* indicates p<0.05). B: LPCAT1 protein levels are increased with ACS administration in a time-dependent fashion. MNRR1 increased in a proportional manner as well. Equal number of HTR cells were plated and treated with Vehicle (Veh) or 25 nM Dexamethasone (Dex) for 24 or 48 h. Cell lysates were separated on an SDS-PAGE gels and probed for LPCAT1 and MNRR1 levels. GaPDH was probed as loading control. C: MNRR1-KO (R1-KO) cells were treated with vehicle or 25 nM dexamethasone. When compared to wild-type (WT) controls, knockout cells exhibited a blunted response to steroid treatment, suggesting that ACS partially acts through an MNRR1 pathway. D: HTR cells with a luciferase reporter harboring the LPCAT1 promoter were treated with Vehicle (Veh) or 25 nM dexamethasone (Dex). Error bars represent standard deviation of an average from 4 independent experiments (* indicates p<0.05).

To confirm that steroids promote LPCAT1 upregulation in placenta, we treated HTR cells with dexamethasone at a concentration of 25 nM, equivalent to doses used clinically to hasten fetal lung maturity. LPCAT1 levels rose significantly over a 48-h period in a time dependent manner. Since LPCAT1 is regulated at least in part through an MNRR1-dependent pathway, we assessed MNRR1 levels in the steroid- versus vehicle-treated HTR cells (Figure 5B). These results suggest that steroids increased LPCAT1 levels via activating MNRR1. To test this hypothesis, we determined LPCAT1 protein levels in cells harboring wild-type levels of MNRR1 and cells with a knockout of MNRR1 [19] in the presence or absence of dexamethasone. As shown in Figure 5C, the induction of LPCAT1 in dexamethasone treated wild-type cells was blunted in the MNRR1-knockout cells. This suggests that steroids at least in part increase LPCAT1 levels through an MNRR1-dependent pathway.

To test if steroids acted at the transcriptional level in the activation of LPCAT1, we performed a reporter luciferase assay. Steroid administration increased LPCAT1-promoter activity in HTR cells (Figure 5D, p< 0.05).

DISCUSSION

LPCAT1 is a protein essential to the formation of pulmonary surfactant and air breathing in mammals. As we have previously shown [14], its presence in maternal plasma is directly correlated with fetal lung maturity markers. We sought here to determine the molecular mechanisms by which the machinery responsible for fetal lung maturity is activated during the third trimester. In normal, healthy pregnancies, the degree of hypoxia varies in each trimester. We show that 4% hypoxia, which is found in the third trimester, activates LPCAT1 maximally and that an MNRR1-dependent pathway mediates this upregulation. Secondly, we have uncovered an important mechanism through which antenatal steroids promote increased LPCAT1 production, and subsequently hasten fetal lung, maturity in preterm fetuses (Figure 6).

Figure 6: Molecular mechanisms regulating LPCAT1 expression.

Figure 6:

Open in a new tab

LPCAT1 can be upregulated by 4% O2 and antenatal corticosteroids via an MNRR1 dependent pathway. LPCAT1 is the rate-determining enzyme for conversion of 1-acyl-sn-glycero-3-phosphocholine (LPC) to phosphatidylcholine (PC), which is the major component of surfactant, necessary for fetal lung maturity to prevent respiratory distress syndrome.

These findings advance the field of perinatology and enhance our level of understanding of the molecular mechanisms underlying our clinical interventions. This study opens the door to multiple clinical and research avenues. As a diagnostic tool, maternal LPCAT1 levels may be used to guide clinical decisions, particularly in the setting of the late preterm gestation, between 34 to 36 weeks and 6 days, when the use of steroids may adversely affect maternal or fetal health. A LPCAT1 assay would also be particularly useful in the management of patients where rescue steroids are contemplated or if a baby will require NICU support after birth. Using LPCAT1 as an investigational tool and a surrogate marker for lung maturity would allow investigators to ascertain how obstetrical diseases, such as preeclampsia or gestational diabetes, affect lung maturation in real time. Understanding the molecular mechanisms regulating LPCAT1 may also allow for the discovery of therapeutics that specifically activate surfactant production without the fetal and maternal drawbacks involved with multiple courses of steroids [36].

Key findings in the current study appear to strengthen our understanding of the impact of steroids on LPCAT1 levels. Measuring circulating LPCAT1 in maternal plasma may help to determine the impact of ACS and be used to identify the nonresponding fetus [37]. MNRR1 is a key pathway upregulating LPCAT1 and further work may be needed to identify other pathways that promote LPCAT1 synthesis. The mechanisms by which LPCAT1 enters into the maternal circulation remains unknown. Use of LPCAT1 in perinatal research may help measure the impact of clinical syndromes on fetal lung maturity and may move determination of timing of delivery with maternal and fetal morbidities (e.g., diabetes, hypertension, growth restriction) from expert consensus to utilizing LPCAT1 threshold levels.

Multiple research approaches demonstrate that LPCAT1 is upregulated by ACS and low oxygen tension through an MNRR1 pathway. LPCAT1 in maternal plasma increases after therapeutic administration of ACS. Further study of LPCAT1 during pregnancy may contribute towards our understanding of factors promoting fetal lung maturity.

Highlights.

  • LPCAT1 levels are highest in basal plate trophoblast in third trimester placentas.

  • LPCAT1 is hypoxia responsive and maximally upregulated at 4% oxygen level.

  • Mitochondrial nuclear retrograde regulator 1 (MNRR1) regulates LPCAT1.

  • Corticosteroids upregulate LPCAT1 in part through the MNRR1 pathway.

  • LPCAT1 levels in maternal plasma increase after corticosteroids.

Acknowledgements

The authors thank Dr. Linda Hazlett and Denise Bessert for assistance with immunofluorescence studies of the placenta as well as Drs. Faisal Qureshi and Suzanne Jacques of the Department of Pathology at the Detroit Medical Center for their interpretations of placental specimens.

Ethical Approval: This study was approved by the institutional review board at Wayne State University (IRB #041314MP2F, #041717MP2F and DMC-CRO#19284) and involved the collection of maternal blood and placental specimens at the Detroit Medical Center. All placental specimens were collected before June 2018. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.

Funding: This work was supported by the National Institute of Health Women’s Reproductive Health Research Career Development Award (K12HD001254-17) awarded to Wayne State University. Dr. Recanati is a WRHR Scholar.

Footnotes

Declaration of Interests: None of the authors report any conflicts of interest.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Organization, W.H. Preterm Birth Fact Sheet. 2018; Available from: https://www.who.int/news-room/fact-sheets/detail/preterm-birth. [Google Scholar]
  • 2.Blencowe H, et al. , National, regional, and worldwide estimates of preterm birth rates in the year 2010 with time trends since 1990 for selected countries: a systematic analysis and implications. Lancet, 2012. 379(9832): p. 2162–72. [DOI] [PubMed] [Google Scholar]
  • 3.Reuter S, Moser C, and Baack M, Respiratory distress in the newborn. Pediatr Rev, 2014. 35(10): p. 417–28; quiz 429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Roberts D, et al. , Antenatal corticosteroids for accelerating fetal lung maturation for women at risk of preterm birth. Cochrane Database Syst Rev, 2017. 3: p. CD004454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liggins GC and Howie RN, A controlled trial of antepartum glucocorticoid treatment for prevention of the respiratory distress syndrome in premature infants. Pediatrics, 1972. 50(4): p. 515–25. [PubMed] [Google Scholar]
  • 6.Crowley P, Chalmers I, and Keirse MJ, The effects of corticosteroid administration before preterm delivery: an overview of the evidence from controlled trials. Br J Obstet Gynaecol, 1990. 97(1): p. 11–25. [DOI] [PubMed] [Google Scholar]
  • 7.Vyas J and Kotecha S, Effects of antenatal and postnatal corticosteroids on the preterm lung. Arch Dis Child Fetal Neonatal Ed, 1997. 77(2): p. F147–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Malloy MH and Freeman DH, Respiratory distress syndrome mortality in the United States, 1987 to 1995. J Perinatol, 2000. 20(7): p. 414–20. [DOI] [PubMed] [Google Scholar]
  • 9.Papageorgiou AN, et al. , Incidence of respiratory distress syndrome following antenatal betamethasone: role of sex, type of delivery, and prolonged rupture of membranes. Pediatrics, 1981. 67(5): p. 614–7. [PubMed] [Google Scholar]
  • 10.Dalence CR, et al. , Amniotic fluid lamellar body count: a rapid and reliable fetal lung maturity test. Obstet Gynecol, 1995. 86(2): p. 235–9. [DOI] [PubMed] [Google Scholar]
  • 11.Ghidini A, et al. , Role of lamellar body count for the prediction of neonatal respiratory distress syndrome in non-diabetic pregnant women. Arch Gynecol Obstet, 2005. 271(4): p. 325–8. [DOI] [PubMed] [Google Scholar]
  • 12.Stimac T, et al. , Lamellar body count as a diagnostic test in predicting neonatal respiratory distress syndrome. Croat Med J, 2012. 53(3): p. 234–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Welch RA, Shaw MK, and Welch KC, Amniotic fluid LPCAT1 mRNA correlates with the lamellar body count. J Perinat Med, 2016. 44(5): p. 531–2. [DOI] [PubMed] [Google Scholar]
  • 14.Welch RA, et al. , Maternal plasma LPCAT1 mRNA correlates with lamellar body count. J Perinat Med, 2018. 46(4): p. 429–431. [DOI] [PubMed] [Google Scholar]
  • 15.Harayama T, Shindou H, and Shimizu T, Biosynthesis of phosphatidylcholine by human lysophosphatidylcholine acyltransferase 1. J Lipid Res, 2009. 50(9): p. 1824–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ahn WG, et al. , Alteration of Lysophosphatidylcholine-Related Metabolic Parameters in the Plasma of Mice with Experimental Sepsis. Inflammation, 2017. 40(2): p. 537–545. [DOI] [PubMed] [Google Scholar]
  • 17.Beretov J, et al. , A standardized and reproducible urine preparation protocol for cancer biomarkers discovery. Biomark Cancer, 2014. 6: p. 21–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Aras S, et al. , Mitochondrial Nuclear Retrograde Regulator 1 (MNRR1) rescues the cellular phenotype of MELAS by inducing homeostatic mechanisms. Proc Natl Acad Sci U S A, 2020. 117(50): p. 32056–32065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Aras S, et al. , MNRR1 (formerly CHCHD2) is a bi-organellar regulator of mitochondrial metabolism. Mitochondrion, 2015. 20: p. 43–51. [DOI] [PubMed] [Google Scholar]
  • 20.Aras S, et al. , Abl2 kinasephosphorylates Bi-organellar regulator MNRR1 in mitochondria, stimulating respiration. Biochim Biophys Acta Mol Cell Res, 2017. 1864(2): p. 440–448. [DOI] [PubMed] [Google Scholar]
  • 21.Aras S, et al. , Oxygen-dependent expression of cytochrome c oxidase subunit 4-2 gene expression is mediated by transcription factors RBPJ, CXXC5 and CHCHD2. Nucleic Acids Res, 2013. 41(4): p. 2255–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Purandare N, et al. , The cellular stress proteins CHCHD10 and MNRR1 (CHCHD2): Partners in mitochondrial and nuclear function and dysfunction. J Biol Chem, 2018. 293(17): p. 6517–6529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Livak KJ and Schmittgen TD, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402–8. [DOI] [PubMed] [Google Scholar]
  • 24.Aras S, et al. , Mitochondrial autoimmunity and MNRR1 in breast carcinogenesis. BMC Cancer, 2019. 19(1): p. 411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.PC, O.W.N., Netter’s Essential Histology. 2020, Philadelphia, PA: Elsevier. [Google Scholar]
  • 26.Muhlhauser J, et al. , Differentiation of human trophoblast populations involves alterations in cytokeratin patterns. J Histochem Cytochem, 1995. 43(6): p. 579–89. [DOI] [PubMed] [Google Scholar]
  • 27.Morin SJ, Reduction in oxygen tension to 2% in extended culture: a more physiologic system may mean more blastocysts available for transfer. Fertil Steril, 2018. 109(6): p. 1002–1003. [DOI] [PubMed] [Google Scholar]
  • 28.Tuuli MG, Longtine MS, and Nelson DM, Review: Oxygen and trophoblast biology--a source of controversy. Placenta, 2011. 32 Suppl 2: p. S109–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jauniaux E, et al. , In-vivo measurement of intrauterine gases and acid-base values early in human pregnancy. Hum Reprod, 1999. 14(11): p. 2901–4. [DOI] [PubMed] [Google Scholar]
  • 30.Rodesch F, et al. , Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol, 1992. 80(2): p. 283–5. [PubMed] [Google Scholar]
  • 31.Rooth G, Sjostedt S, and Caligara F, Hydrogen concentration, carbon dioxide tension and acid base balance in blood of human umbilical cord and intervillous space of placenta. Arch Dis Child, 1961. 36: p. 278–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schaaps JP, et al. , Shunting the intervillous space: new concepts in human uteroplacental vascularization. Am J Obstet Gynecol, 2005. 192(1): p. 323–32. [DOI] [PubMed] [Google Scholar]
  • 33.Wang GL and Semenza GL, General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc Natl Acad Sci U S A, 1993. 90(9): p. 4304–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Effect of antenatal dexamethasone administration on the prevention of respiratory distress syndrome. Am J Obstet Gynecol, 1981. 141(3): p. 276–87. [PubMed] [Google Scholar]
  • 35.Schellenberg JC and Liggins GC, New approaches to hormonal acceleration of fetal lung maturation. J Perinat Med, 1987. 15(5): p. 447–52. [DOI] [PubMed] [Google Scholar]
  • 36.Lee C, et al. , Antenatal PPARgamma Agonist Pioglitazone Stimulates Fetal Lung Maturation Equally in Males and Females. Am J Physiol Lung Cell Mol Physiol, 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Takahashi T, et al. , Variability in the efficacy of a standardized antenatal steroid treatment was independent of maternal or fetal plasma drug levels: evidence from a sheep model of pregnancy. Am J Obstet Gynecol, 2020. [DOI] [PubMed] [Google Scholar]

RESOURCES