Skip to main content
NCBI home page
Brain Pathology logoLink to Brain Pathology
. 2011 Aug 16;22(1):26–31. doi: 10.1111/j.1750-3639.2011.00506.x

Detection of 2‐Hydroxyglutarate in Formalin‐Fixed Paraffin‐Embedded Glioma Specimens by Gas Chromatography/Mass Spectrometry

Felix Sahm 1,2, David Capper 1,2, Stefan Pusch 2, Jörg Balss 2, Arend Koch 3, Claus‐Dieter Langhans 4, Jürgen G Okun 4,†, Andreas von Deimling 1,2,†,✉
PMCID: PMC8028858  PMID: 21631627

Abstract

Mutations in the isocitrate dehydrogenase (IDH) 1 and 2 genes occur frequently in diffuse astrocytoma and oligodendroglioma. The consecutive amino acid substitutions in the mutant proteins result in a gain of the function to catalyze the reduction of alpha‐ketoglutarate to 2‐hydroxyglutarate (2HG). So far, all investigated IDH mutations share this gain of function. We here describe a method to detect 2HG levels in archival formalin‐fixed paraffin‐embedded tumor specimens by stable isotope dilution using gas chromatography followed by mass spectrometry (GC/MS). While 2HG levels are notably decreased during the routine embedding process, preserved amounts are still sufficient to indicate a mutation. Detection of 2HG in archival specimens could make routinely processed tissue accessible for research on 2HG accumulation and may allow studies on correlation with clinical data.

Keywords: 2‐hydroxyglutarate, FFPE, GC/MS, glioma, IDH1, IDH2, stable isotope dilution

INTRODUCTION

Various studies have shown that mutations in the isocitrate dehydrogenase 1 (IDH1) gene, encoding a nicotinamide adenine dinucleotide phosphate (NADP)‐dependent enzyme, occur frequently in astrocytic and oligodendroglial tumors of World Health Organization (WHO) grades II and III and in secondary glioblastoma 1, 13, 18, 23, 25. In a previously published series of 1010 gliomas, 71% of the tumors carried an IDH1 mutation. Of these, 93% were characterized by a base‐pair exchange of guanine to adenine (G395A), leading to the substitution of the amino acid arginine by histidine (R132H) (10). Comprehensive analyses demonstrated that IDH1 mutations are rare in other tumors except acute myeloid leukemia 2, 14, 21. In gliomas, IDH1 mutations are associated with better prognosis and may serve as an important clinical marker (24).

Biochemical studies revealed that mutant IDH1R132H protein gains the function to catalyze the reduction of α‐ketoglutarate to D‐2‐hydroxyglutarate (2HG) in a nicotinamide adenine dinucleotide phosphate (NADPH)‐consuming manner. Mutation of IDH1 results in an up to 100‐fold increase of 2HG in glial tumors (8). Recently, several further mutations in IDH1 leading to different amino acid substitutions at codon 132 as well as mutations at codon 100 have been identified (19). Additionally, mutations in IDH2, affecting codon 140 and 172, have been found (8). While detection of mutant IDH1R132H protein is possible by immunohistochemistry using a mutation‐specific antibody (6), rare mutations can only be investigated by sequencing or other sequence‐based assays 9, 12, 16. Interestingly, all mutations are localizing to the isocitrate binding sites of the respective enzymes. IDH1 and IDH2 proteins exhibit an extraordinary high level of homology in the amino acid sequence at these binding sites. In line with this observation, all discovered mutations in either IDH1 or IDH2 have been shown to result in an increase of 2HG (22). Thus, increased 2HG levels may serve as a surrogate marker for various types of IDH1 and IDH2 mutations. As most surgical specimen undergo formalin fixation and paraffin embedding, a method for detection of 2HG in those specimens would make archived tissue accessible for diagnostics and research.

MATERIALS AND METHODS

Tissue preparation and gas chromatography/mass spectrometry (GC/MS)

Forty‐seven formalin‐fixed paraffin‐embedded (FFPE) tissue specimen, including five meningiomas, five cases of reactive gliosis, 18 IDH wild‐type gliomas and 19 gliomas with different IDH mutations (Table 1) were obtained from the archives of the Department of Neuropathology Heidelberg and the Department of Neuropatholoy, Charité University Hospital, Berlin. Specimen had been archived for 6 months to 17 years. Samples were analyzed in an anonymous manner as approved by the local ethics committees at the participating institutions. All FFPE samples underwent standard fixation in 10% formalin (Roth, Karlsruhe, Germany), automated dehydration in ethanol and xylene (Shandon Excelsior ES, ThermoScientific, Houston, TX, USA) and finally, embedding in paraffin (Shandon Histocenter 3, ThermoScientific; Histo‐Comp, Vogel, Giessen, Germany). IDH mutation status was determined either by immunohistochemistry or sequencing. Tissue samples were composed of solid tumor, cases with >10% necrosis were excluded. A 30‐µm section of 1‐cm2 tissue or an equivalent amount was cut from the paraffin block directly into an Eppendorf tube (Eppendorf, Hamburg, Germany). Deparaffinization was performed by adding 1 mL xylene (Roth) and centrifugation for 5 minutes at 13 000 rpm. The xylene supernatant was replaced by fresh xylene and the procedure was repeated twice. Then, the deparaffinized pellet was dried in the open tube under a fume hood for 3 h. A total of 1050 µL deionized water (Braun, Melsungen, Germany) was added to each tube. All samples were homogenized by sonification (Branson Cell Disruptor B15, Danbury, CT, USA) until all solid fragments dissolved in the suspension.

Table 1.

Results of 2HG/GA analyses by GC/MS of FFPE tissue in IDH wild‐type tissues and tumors with different IDH1 and IDH2 mutations. Abbreviations: 2HG/GA = 2‐hydroxyglutarate glutaric acid; GC/MS = gas chromatography/mass spectrometry; FFPE = formalin‐fixed paraffin‐embedded; IDH = isocitrate dehydrogenase; WHO = World Health Organization; GBM = glioblastoma multiforme WHO grade IV; sGBM = secondary glioblastoma multiforme WHO grade IV; AIII = anaplastic astrocytoma WHO grade III; AII = astrocytoma WHO grade II; OIII = anaplastic oligodendroglioma WHO grade III; OII = oligodendroglioma WHO grade II; OAIII = anaplastic oligoastrocytoma WHO grade III; OAII = oligoastrocytoma WHO grade II; PML = progressive multifocal leukoencephalopathy; WT = wild type.

Diagnosis FFPE sample storage (years) Glutaric acid (nmol/mL) 2‐OH‐glutaric acid (nmol/mL) IDH status 2HG/GA
Reactive gliosis 14 1.71 0.72 wt 0.42
Vasculitis 2 0.07 0.10 wt 1.48
GBM 2 0.10 0.17 wt 1.69
PML 2 0.22 0.38 wt 1.75
GBM 2 0.06 0.11 wt 1.86
AII 14 0.09 0.18 wt 1.947
GBM 2 0.08 0.16 wt 2.12
AII 7 0.12 0.27 wt 2.27
AII 4 0.08 0.21 wt 2.76
GBM 0 0.09 0.26 wt 2.83
Meningioma 1 0.0 0.29 wt 3.25
Meningioma 1 0.09 0.29 wt 3.29
GBM 0 0.06 0.21 wt 3.32
Reactive gliosis 4 0.10 0.35 wt 3.49
GBM 2 0.17 0.61 wt 3.54
Meningioma 1 0.07 0.25 wt 3.57
Encephalitis 2 0.09 0.33 wt 3.85
AIII 3 0.06 0.26 wt 4.33
Meningioma 1 0.08 0.36 wt 4.51
GBM 3 0.19 0.85 wt 4.61
Meningioma 1 0.07 0.35 wt 4.92
AIII 4 0.08 0.38 wt 5.03
AII 17 0.13 0.66 wt 5.23
GBM 1 0.07 0.37 wt 5.29
GBM 1 0.09 0.51 wt 5.67
OIII 2 0.22 1.25 IDH1R132H 5.69
AIII 2 0.06 0.35 IDH1R132C 5.92
AIII 5 0.06 0.41 IDH1R132H 6.82
AIII 3 0.04 0.31 wt 7.75
AIII 5 0.04 0.40 wt 1.00
OIII 3 0.05 0.53 IDH1R132H 10.60
AIII 3 0.05 0.60 IDH1R132S 12.56
OIII 2 0.07 0.89 IDH1R132H 12.71
GBM 1 0.04 0.52 wt 13.00
OIII 3 0.04 0.63 IDH1R132H 15.75
OA III 2 0.07 1.18 IDH1R132H 15.89
AIII 2 0.07 1.49 IDH1R132H 20.34
OA II 10 0.06 1.41 IDH1R132H 23.42
AIII 2 0.04 1.20 IDH1R132H 30.00
O II 2 0.06 3.61 IDH1R132H 59.15
OA II 9 0.08 9.39 IDH1R132H 115.94
sGBM 5 0.11 24.23 IDH1R132H 214.38
OAIII 6 0.11 30.06 IDH1R132C 263.72
sGBM 3 0.09 29.25 IDH1R132H 314.46
OII 7 0.07 22.90 IDH1R132S 318.04
OAIII 11 0.07 41.86 IDH2R172M 615.57
OIII 7 0.07 151.66 IDH1R132L 2 198.01
Open in a new tab

To investigate the changes of 2HG content in a tissue sample during formalin fixation and paraffin embedding, we analyzed the 2HG content of three IDH1R132H mutant and one wild‐type glioma in different steps of the embedding process: of each tumor, a fragment separated from the fresh sample, a second fragment after 6 h of formalin fixation, a third fragment after 6 h of ethanol dehydration and the remaining entirely processed and paraffin‐embedded fragment were analyzed separately.

For determination of glutaric acid (GA) and 2HG, 1000 µL of the suspension were used for liquid–liquid extraction. Briefly, 5 µL each of 1 mmol/L stable isotope‐labeled d4‐GA (Cambridge Isotope Laboratories, Inc., Andover, MA, USA) and d4‐3‐hydroxyglutaric acid (Dr. Herman ten Brink, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, the Netherlands) were added as internal standards. Samples were acidified with 300 µL of 5 M HCl and after addition of solid sodium chloride extracted twice with 5 mL ethyl acetate each time. The combined ethyl acetate fractions were dried over sodium sulfate and then dried down at 40°C under a stream of nitrogen. Samples were then derivatized with N‐methyl‐N‐(trimethylsilyl)heptafluorobutyramide (MSHFBA, Macherey‐Nagel, Düren, Germany) for 1 h at 60°C.

For GC/MS analysis, the quadrupole mass spectrometer MSD 5972A (Agilent, Santa Rosa, CA, USA) was run in the selective ion‐monitoring mode with electron impact ionization. Gas chromatographic separation was achieved on a capillary column (DB‐5MS, 30 m × 0.25 mm; film thickness: 0.25; J&W Scientific, Folsom, CA, USA) using helium as a carrier gas. A volume of 1 µL of the derivatized sample was injected in splitless mode. GC temperature parameters were 60°C for 1 minute, ramp 50°C/minute to 150 °C, ramp 4°C/minute to 259°C, and hold for 2 minute at 300°C. Injector temperature was set to 280°C and interface temperature to 290°C.

Fragment ions for quantification were m/z 261 (GA), m/z 265 (d4‐GA), m/z 203 (2‐hydroxyglutaric acid) and m/z 262 (d4‐3‐hydroxyglutaric acid). A dwell time of 50 ms was used.

Results were normalized by calculating the 2HG/GA ratio.

Immunohistochemistry, polymerase chain reaction (PCR) amplification and direct sequencing

For immunohistochemistry, we used the previously described antibody against mutant IDH1R132H protein (clone H09, Dianova, Hamburg, Germany) 4, 5, 6. Sections were incubated with clone H09 on a Ventana BenchMark XT® immunostainer (Ventana Medical Systems, Tucson, AZ, USA). For visualization, ultraView Universal DAB Detection Kit (Ventana Medical Systems) was used.

Primer design was based on accession number NM_005896 and NM_002168: IDH1_100f TGATGAGAAGAGGGTTGAGGA, IDH1_100r ATCCCCATAAGCATGACGAC, IDH1_132f ACCAAATGGCACCATACGA, IDH1_132r TTCATACCTTGCTTAATGGGTGT, IDH2f_140 GCTGCAGTGGGACCACTATT, IDH2r_140 AATGGTGATGGGCTTGGTC, IDH2f_172 AGCCCATCATCTGCAAAAAC and IDH2r_172 CTAGGCGAGGAGCTCCAGT. PCR was performed applying 20 ng of DNA and 2× PCR Master Mix (Promega, Madison, WI, USA) in a total volume of 15 µL. Two microliters of the amplification product were submitted to sequencing using the BigDye® Terminator v3.1 Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Twenty‐five cycles were performed employing 12 ng of the respective sense primer with denaturation at 95°C for 30 s, annealing at 56°C for 15 s and extension at 60°C for 240 s. Sequences were determined using the semiautomated sequencer (ABI® 3100 Genetic Analyzer, Applied Biosystems) and the Sequence Pilot version 3.1™ (JSI‐Medisys, Kippenheim, Germany) software.

Statistical analysis

Data were analyzed using SPSS Statistics 17.0 (SPSS Inc., Chicago, IL, USA). Values of P < 0.03 were considered significant.

RESULTS

We analyzed 47 FFPE samples for 2HG and GA. To standardize the 2HG values, we used the 2HG/GA ratio as GA concentrations showed no significant differences between IDH mutant and wild‐type tumors (wild type: mean 0.15 nmol/mL, mutant: mean 0.08 nmol/mL, Student's t‐test comparing GA values in mutant with wild‐type tissues P = 0.24). A total of 28 tissue samples with wild‐type IDH status, including five meningiomas, five cases of reactive gliosis and 18 IDH wild type gliomas harbored 2HG/GA ratios between 0.42 and 13.00 with a mean ratio of 4.06. The 19 gliomas with different IDH mutations yielded ratios between 5.69 and 2198.01 with a mean ratio of 224.16 (Table 1 and Figure 1). The rare mutation variants IDH1R132L, IDH1R132S and IDH2R172M yielded extremely high ratios: IDH1R132S up to 315.04, IDH2R172M 615.57 and IDH1R132L 2 198.01. The mean ratio of IDH1R132H mutant tumors was 74.32. The median of wild‐type tumors was 3.52 while the median of mutant tumors was 23.42. Student's t‐test comparing the 2HG/GA ratios in the group of wild‐type tissue to the most common mutations (IDH1R132H and IDH1R132C) yielded a significance value of P = 0.02. Storage time of mutant tumors did not correlate with 2HG/GA ratio (P = 0.95).

Figure 1.

Figure 1

Open in a new tab

2‐hydroxyglutarate/glutaric acid (2HG/GA) ratio of all mutant tumors compared with wild‐type tumors (log. scale).

Wild‐type tumors identified to have elevated 2HG/GA ratios were sequenced for other known mutational hot spots of IDH1 and IDH2 in gliomas without detecting any other mutation.

Assessment of 2HG changes yielded that the 2HG/GA ratio after processing dropped during the embedding process. Yet, considerable differences between wild‐type and mutant tumors sustain the whole procedure (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Changes in 2‐hydroxyglutarate/glutaric acid (2HG/GA) levels of fresh tissue during fixation, dehydration and after paraffin embedding. White bars patient 1: wild‐type; black bars (patients 2–4): IDH1R132H mutated tumors. Patient 1 glioblastoma multiforme World Health Organization (WHO) grade IV; patient 2 anaplastic astrocytoma WHO grade III; patient 3 oligoastrocytoma WHO grade II; patient 4 anaplastic astrocytoma WHO grade III.

DISCUSSION

Accumulation of 2HG has been discovered in fresh samples of IDH1 mutant tumors by Dang et al (7). In our series of 47 FFPE samples, we have shown that this mutation‐dependent increase in 2HG is still detectable after routine tissue processing (Table 1, Figure 1). 2HG is elevated in all variants of IDH1 and IDH2 mutations of our set, indicating that 2HG can serve as a surrogate marker for various IDH mutations.

However, the difference of 2HG values in the majority of wild‐type tumors compared with tumors carrying IDH mutations is less than described in fresh specimens. Dang et al identified a sevenfold up to 100‐fold increase of 2HG in mutant compared with wild‐type tumors (7). The major loss of 2HG occurred during formalin fixation and dehydration in ethanol as shown by our analysis of the embedding procedure: mutant tumors retained 4% to 29% of their 2HG content (normalized to GA) after formalin fixation and ethanol dehydration while the wild‐type sample retained 38% during these steps of the fixation and embedding procedure. The paraffin‐embedded samples of this analysis yielded ratios as seen in the remaining series (Table 1, Figure 2). Applying a method‐intrinsic factor such as GA for standardization partly compensates processing induced alterations as GA is subject to the same fixation and embedding procedure. Therefore, we chose standardization by using the 2HG/GA ratio as GA can be measured in the same GC/MS sample as 2HG without consuming another fragment of the respective tissue. This approach also balances sample‐to‐sample variability, which is caused by the heterogeneity of the tissues: we observed that apparently equal volumes of FFPE tissues (same section depth and surface area) result in very differently sized pellets after deparaffinization, probably because of different cell density. Further, determination of weight or of total protein content can be avoided, both factors that are differently affected by tissue embedding. Despite the aforementioned loss of 2HG content, the resulting values are still sufficient to discriminate between IDH mutant and wild‐type tumors in the vast majority of cases (Figure 1): while ratios below five indicated clearly wild‐type status and ratios above 15 were only found in mutant tumors, values in the range of five to 15 should be considered as indefinite.

Of note, tumors carrying the very rare mutations IDH1R132L and IDH2R172M exhibited extremely high 2HG/GA levels (Table 1). Further research may address the biochemical characteristics of the mutant protein variants concerning 2HG formation and may investigate the effect of different 2HG levels for cell biology in mutant tumors.

Three wild‐type gliomas showed discretely elevated levels, while all reactive glial tissues, meningiomas and other gliomas had levels in a range between 0.42 and 5.67 2HG/GA. Beyond IDH mutations, other mechanisms for increased 2HG are known: deficiency of 2HG dehydrogenase (2HGDH) also results in 2HG accumulation as seen in 2‐hydroxyglugtarate aciduria, an inherited metabolic disorder in children. Defects in L‐2HGDH have been shown to be associated with an increased risk for brain tumors 17, 20. However, D‐2HGDH deficiency resulting in an increase of the same metabolite as in IDH mutant tumors (D‐2HG) causes seizures and encephalopathy but has not been linked to tumors so far. Recently, mutations in IDH2 have been described in patients with so called “idiopathic” hydroxyglutaric aciduria, providing an explanation for this disorder in patients with 2HG accumulation but without D‐2HGDH deficiency (15). As 2HG degradation defects account for aciduria cases with lower 2HG levels compared with patients with IDH2 mutations, it is attractive to speculate that a similar mechanism may play a role in glioma with mildly elevated 2HG. However, in a screen of brain tumors for alterations in L‐2HGDH or D‐2HGDH, Brehmer et al did not identify somatic mutations (3). Meanwhile, several mutations in IDH1 apart from the mutational hot spots in glioma have been found in other tumors (11). Capability of the respective mutant proteins to form 2HG has not been analyzed so far. Our method may be useful to screen FFPE tumor tissue for increased 2HG levels to identify specimen where further investigation of 2HG metabolism beyond sequencing of mutational hot spots in IDH1 and IDH2 should be considered. In fact, we expect the presented method rather to complement the established techniques in research on IDH mutations and 2HG‐dependent disease mechanisms rather than replacing immunohistochemistry or sequencing for known mutations. On a daily diagnostic basis, immunohistochemistry for IDH1R132H protein is the most efficient approach to detect the most frequent mutation in glioma. Sequencing of the mutational hotspots in IDH1 and IDH2 or GC/MS for 2HG is obviously more complex and costly. In our experience, the latter two techniques are performed in a similar amount of time and to comparable costs. Of course, exact numbers vary depending on throughput and accessibility of equipment.

As IDH1 mutations are associated with better prognosis (24), further interest arises on possible implications of different 2HG levels on the disease course. Given that most FFPE samples are linked to clinical data, the presented method also allows to retrospectively compare 2HG levels and to investigate possible correlations with postoperative clinical behavior.

Grant support

This work was supported by the Bundesministerium für Bildung und Forschung (BMBF—01ES0730 and 01GS0883).

ACKNOWLEDGMENTS

We wish to thank Patrik Feyh for skilful technical assistance. Under a licensing agreement between DIANOVA GmbH, Hamburg, Germany, and the German Cancer Research Center, Dr. Capper and Dr. von Deimling are entitled to a share of royalties received by the German Cancer Research Center on the sales of H09 antibody. The terms of this arrangement are being managed by the German Cancer Research Center in accordance with its conflict of interest policies.

REFERENCES

  • 1. Balss J, Meyer J, Mueller W, Korshunov A, Hartmann C, von Deimling A (2008) Analysis of the IDH1 codon 132 mutation in brain tumors. Acta Neuropathol 116:597–602. [DOI] [PubMed] [Google Scholar]
  • 2. Bleeker FE, Lamba S, Leenstra S, Troost D, Hulsebos T, Vandertop WP et al (2009) IDH1 mutations at residue p.R132 (IDH1(R132)) occur frequently in high‐grade gliomas but not in other solid tumors. Hum Mutat 30:7–11. [DOI] [PubMed] [Google Scholar]
  • 3. Brehmer S, Pusch S, Schmieder K, Von Deimling A, Hartmann C (2010) Mutational analysis of D2HGDH and L2HGDH in brain tumours without IDH1 or IDH2 mutations. Neuropathol Appl Neurobiol 37:330–332. [DOI] [PubMed] [Google Scholar]
  • 4. Capper D, Zentgraf H, Balss J, Hartmann C, von Deimling A (2009) Monoclonal antibody specific for IDH1 R132H mutation. Acta Neuropathol 118:599–601. [DOI] [PubMed] [Google Scholar]
  • 5. Capper D, Sahm F, Hartmann C, Meyermann R, von Deimling A, Schittenhelm J (2010) Application of mutant IDH1 antibody to differentiate diffuse glioma from nonneoplastic central nervous system lesions and therapy‐induced changes. Am J Surg Pathol 34:1199–1204. [DOI] [PubMed] [Google Scholar]
  • 6. Capper D, Weissert S, Balss J, Habel A, Meyer J, Jager D et al (2010) Characterization of R132H mutation‐specific IDH1 antibody binding in brain tumors. Brain Pathol 20:245–254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Dang L, White DW, Gross S, Bennett BD, Bittinger MA, Driggers EM et al (2009) Cancer‐associated IDH1 mutations produce 2‐hydroxyglutarate. Nature 462:739–744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Dang L, Jin S, Su SM (2010) IDH mutations in glioma and acute myeloid leukemia. Trends Mol Med 16:387–397. [DOI] [PubMed] [Google Scholar]
  • 9. Felsberg J, Wolter M, Seul H, Friedensdorf B, Goppert M, Sabel MC, Reifenberger G (2010) Rapid and sensitive assessment of the IDH1 and IDH2 mutation status in cerebral gliomas based on DNA pyrosequencing. Acta Neuropathol 119:501–507. [DOI] [PubMed] [Google Scholar]
  • 10. Hartmann C, Meyer J, Balss J, Capper D, Mueller W, Christians A et al (2009) Type and frequency of IDH1 and IDH2 mutations are related to astrocytic and oligodendroglial differentiation and age: a study of 1,010 diffuse gliomas. Acta Neuropathol 118:469–474. [DOI] [PubMed] [Google Scholar]
  • 11. Hemerly JP, Bastos AU, Cerutti JM (2010) Identification of several novel non‐p.R132 IDH1 variants in thyroid carcinomas. Eur J Endocrinol 163:747–755. [DOI] [PubMed] [Google Scholar]
  • 12. Horbinski C, Kelly L, Nikiforov YE, Durso MB, Nikiforova MN (2010) Detection of IDH1 and IDH2 mutations by fluorescence melting curve analysis as a diagnostic tool for brain biopsies. J Mol Diagn 12:487–492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ichimura K, Pearson DM, Kocialkowski S, Backlund LM, Chan R, Jones DT, Collins VP (2009) IDH1 mutations are present in the majority of common adult gliomas but rare in primary glioblastomas. Neuro Oncol 11:341–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Kang MR, Kim MS, Oh JE, Kim YR, Song SY, Seo SI et al (2009) Mutational analysis of IDH1 codon 132 in glioblastomas and other common cancers. Int J Cancer 125:353–355. [DOI] [PubMed] [Google Scholar]
  • 15. Kranendijk M, Struys EA, van Schaftingen E, Gibson KM, Kanhai WA, van der Knaap MS et al (2010) IDH2 mutations in patients with D‐2‐hydroxyglutaric aciduria. Science 330:336. [DOI] [PubMed] [Google Scholar]
  • 16. Meyer J, Pusch S, Balss J, Capper D, Mueller W, Christians A et al (2010) PCR‐ and restriction endonuclease‐based detection of IDH1 mutations. Brain Pathol 20:298–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Moroni I, Bugiani M, D'Incerti L, Maccagnano C, Rimoldi M, Bissola L et al (2004) L‐2‐hydroxyglutaric aciduria and brain malignant tumors: a predisposing condition? Neurology 62:1882–1884. [DOI] [PubMed] [Google Scholar]
  • 18. Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P et al (2008) An integrated genomic analysis of human glioblastoma multiforme. Science 321:1807–1812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Pusch S, Sahm F, Meyer J, Mittelbronn M, Hartmann C, Von Deimling A (2010) Glioma IDH1 mutation patterns off the beaten track. Neuropathol Appl Neurobiol (in press). [DOI] [PubMed] [Google Scholar]
  • 20. Rzem R, Veiga‐da‐Cunha M, Noel G, Goffette S, Nassogne MC, Tabarki B et al (2004) A gene encoding a putative FAD‐dependent L‐2‐hydroxyglutarate dehydrogenase is mutated in L‐2‐hydroxyglutaric aciduria. Proc Natl Acad Sci U S A 101:16849–16854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Sahm F, Capper D, Meyer J, Hartmann C, Herpel E, Andrulis M et al (2010) Immunohistochemical analysis of 1844 human epithelial and hematopoietic tumors and sarcomas for IDH1R132H mutation. Histopathology (in press). [DOI] [PubMed] [Google Scholar]
  • 22. Ward PS, Patel J, Wise DR, Abdel‐Wahab O, Bennett BD, Coller HA et al (2010) The common feature of leukemia‐associated IDH1 and IDH2 mutations is a neomorphic enzyme activity converting alpha‐ketoglutarate to 2‐hydroxyglutarate. Cancer Cell 17:225–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Watanabe T, Nobusawa S, Kleihues P, Ohgaki H (2009) IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas. Am J Pathol 174:1149–1153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Wick W, Hartmann C, Engel C, Stoffels M, Felsberg J, Stockhammer F et al (2009) NOA‐04 randomized phase III trial of sequential radiochemotherapy of anaplastic glioma with procarbazine, lomustine, and vincristine or temozolomide. J Clin Oncol 27:5874–5880. [DOI] [PubMed] [Google Scholar]
  • 25. Yan H, Parsons DW, Jin G, McLendon R, Rasheed BA, Yuan W et al (2009) IDH1 and IDH2 mutations in gliomas. N Engl J Med 360:765–773. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Brain Pathology are provided here courtesy of Wiley

RESOURCES