Skip to main content
Brain Pathology logoLink to Brain Pathology
. 2015 May 7;26(1):31–42. doi: 10.1111/bpa.12256

Heat Shock Protein 47 Promotes Glioma Angiogenesis

Zhe Bao Wu 1,†,✉, Lin Cai 3,†, Shao Jian Lin 3, Zhi Gen Leng 3, Yu Hang Guo 3, Wen Lei Yang 1, Yi Wei Chu 2, Shao‐Hua Yang 4, Wei Guo Zhao 1,✉
PMCID: PMC8029092  PMID: 25758142

Abstract

Heat shock protein 47 (HSP47) is a collagen‐binding protein, which has been recently found to express in glioma vessels. However, the expression profile of HSP47 in glioma patients and the underlying mechanisms of HSP47 on glioma angiogenesis are not fully explored. In the current study, we found that expression of HSP47 in glioma vessels was correlated with the grades of gliomas. HSP47 knockdown by siRNAs significantly decreased cell viability in vitro and tumor volume in vivo; moreover, it reduced the microvessel density (MVD) by CD31 immunohistochemistry in vivo. HSP47 knockdown significantly inhibited tube formation, invasion and proliferation of human umbilical vein endothelial cells (HUVECs). Furthermore, conditional medium derived from HSP47 knockdown cells significantly inhibited HUVECs tube formation and migration, while it increased chemosensitivity of HUVECs cells to Avastin. Silencing of HSP47 decreased VEGF expression in glioma cells consistently, and reduced glioma vasculature. Furthermore, HSP47 promoted glioma angiogenesis through HIF1α‐VEGFR2 signaling. The present study demonstrates that HSP47 promotes glioma angiogenesis and highlights the importance of HSP47 as an attractive therapeutic target of GBM.

Keywords: angiogenesis, glioblastoma, glioma, heat shock protein 47, VEGFR2

Introduction

Glioblastoma (GBM) is the most common and most aggressive malignant brain tumor with the median survival rate of 14.6 months after conventional treatment modalities 28. GBMs are highly invasive with extensive angiogenesis that are rather resistant to radiotherapy and chemotherapy 1, 4, 16. Despite the development of modern diagnostic modalities, surgical procedures and adjuvant radio‐ and chemotherapies, the prognosis of GBM has remained largely unchanged over the last several decades. Research into novel target is desperately needed for the treatment of GBM.

HSP47, also known as SERPINH1 and colligin 2, was originally discovered as a cell surface collagen‐binding protein, and was later identified to be an endoplasmic reticulum resident protein with collagen‐binding properties 27. HSP47 expression is highly tissue and cell specific and restricted to collagen‐producing cells, while not in cells in which collagen synthesis is not observed 6. HSP47 recognizes the triple‐helix form of procollagen in vitro and in vivo and is essential for the maturation of various types of procollagens 23, 27.

Extensive collagens depositions are a hallmark of many diseases. Consistently, increase of HSP47 expression has been observed in many diseases involved in collagens depositions, such as rheumatoid arthritis, atherosclerosis and renal fibrosis 27. HSP47 has been mapped to human chromosome 11q13.5, a known “hot spot” in a number of human cancers 27. Interestingly, alternation of HSP47 expression has been identified in several cancers including sarcoma 14 and pancreatic carcinoma 10. It has been indicated that HSP47 may play an important role in tumor metastasis 15 and be associated with survival in invasive ductal carcinoma 21. In addition, silencing of HSP47 expression has been shown to significantly inhibit cell proliferation, migration and invasion in cervical squamous cell carcinoma 35. Expression of HSP47 has been found in human glioma, but not normal brain vasculature 17, 18, 19, suggesting that HSP47 might be involved in glioma angiogenesis. Our recent study further suggested that HSP47 is overexpressed in GBM and might be considered as a novel glioma‐associated antigen 33. However, the role of HSP47 in glioma angiogenesis and the underlying mechanism has not yet been elucidated. In the current study, we investigated the expression profiles of HSP47 on glioma vessels and the role of HSP47 on glioma angiogenesis. Furthermore, we explored the underlying mechanisms of HSP47 on glioma angiogenesis.

Materials and Methods

GBM tissues collection

All specimens were collected from glioma or traumatic brain injury patients, who underwent surgery between 2008 and 2012 at the Department of Neurosurgery, Ruijin Hospital of Jiaotong University and First Affiliated Hospital of Wenzhou Medical University. All patients had no history of radiotherapy or chemotherapy before surgeries. Non‐neoplastic brain specimens were obtained from adjacent brain tissues of contusion and laceration in traumatic brain injury patients. The study protocol was approved by the local, independent ethics committee at those two hospitals. For immunohistochemistry, 74 glioma (pilocytic astrocytoma, n = 12; astrocytoma grade II, n = 10; oligodendrocytoma grade II, n = 12; anaplastic astrocytoma, n = 20; anaplastic oligodendrocytoma, n = 9; GBM, n = 20) and 9 non‐neoplastic formalin‐fixed, paraffin‐embedded (FFPE) specimens were analyzed for HSP47 expression.

Cell culture and reagents

SHG66 was established from a 47‐year‐old male with a right parietal glioblastoma (WHO grade IV) 7, 31, 32. U87, A172 and human umbilical vein endothelial cell (HUVEC) cell lines were purchased from the Cell Bank of the Shanghai Branch of Chinese Academy of Sciences. All cell lines were cultured in DMEM medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, UT, USA) and 100 U/mL penicillin/streptomycin (Gibco, Grand Island, NY, USA). All cell lines were maintained in humidified atmosphere with 5% CO2 at 37°C. Temozolomide (TMZ) was purchased from Sigma (St. Louis, MO, USA) and Avastin was purchased from Roche (Mannheim, Germany).

Cell proliferation assay

Cell proliferation was analyzed using the Cell Counting Kit‐8 (CCK‐8) according to manufacturer's protocol (Dojindo, Rockville, MD , USA). Cells (2500 per well) were plated into 96‐well plates and transfected with siRNAs, HSP47 or vector, or incubated with conditional medium from indicated cells. At the indicated time after transfection or treatment, 10 μL CCK‐8 solution was added to 90 μL of culture medium. The cells were subsequently incubated for 3 h at 37°C and the optical density was measured at 450 nm. Three independent experiments were performed.

Real‐time RT‐PCR

Total RNA was extracted from glioma specimens or from the cell lines using the Trizol reagent (Invitrogen, Grand Island, NY, USA) according to the manufacturer's instruction. The first‐strand cDNAs were synthesized using a High‐Capacity cDNA Archive Kit. Each cDNA (2 μL) was amplified in a SYBR Green Real‐time PCR Master Mix (final volume, 20 μL) using Applied Biosystems 7900 Real‐time PCR Detection System (ABI, Foster City, CA, USA). Thermal cycling conditions were as follows: 95°C for 10 minutes and the ensuing 40 cycles, 95°C for 15 s, 60°C for 60 s, and 72°C for 30 s. PCR primers used were as follows: HSP47 (forward): 5′‐CACCGCCTTTGAGTTGGACAC‐3′ and HSP47 (reverse): 5′‐GGCGCCCAATGAATAGCAG‐3′.

Western blot analysis

Cell lysates were extracted with cell lysis buffer (Beyotime, China) and the protein concentration in the lysates was quantified using an Enhanced BCA Protein Assay Kit (Beyotime, Shanghai, China). Protein samples of 30–50 μg were loaded for SDS‐PAGE and immunoblot using antibodies against HSP47, HIF1‐α, HER2, CD31 (Eptomics, Shanghai, China), actin, GAPDH (Abmart, China), PLCγ, VEGFR2, ERK1/2 and Src (CST, Shanghai, China).

Immunohistochemistry analysis

Human GBM specimens were fixed in 4% paraformaldehyde for 24 h and processed for paraffin embedding and sectioning (4 μm). For immunohistochemistry (IHC), sections were stained with HSP47‐specific antibody made against COOH‐terminal peptide of human HSP47 (Eptomics). Briefly, the tissue sections were dehydrated and subject to peroxidase blocking. HSP47 antibody was added at a dilution of 1:100 and incubated at room temperature for 30 minutes on the DAKO AutoStainer using DakoCytomation EnVision System‐HRP (DAB) detection kit (Carpinteria, CA, USA). The slides were counterstained with hematoxylin and microscopy was obtained by using Axiovert 200 microscope (Carl Zeiss, Oberkochen, Germany).

For evaluation of HSP47 immunoreactivity, 10 random high‐power fields (400×) were selected and the intensity was classified as negative (−), weak (+), medium (++) or strong (+++) for glioma vasculature. IHC were evaluated semi‐quantitatively by two senior neuropathologists blinded to the clinical parameters. The formula of IHC score is (the grade of intensity × number of samples)/ total number of samples (score criteria: − = 0, + =1, ++=2, +++=3).

Microvessel density (MVD) of CD31 immunoreactivity was determined as described previously 30. Microscopy of CD31 IHC was obtained at low magnification (×40), and six tumor areas with the highest density of distinctly highlighted microvessel (so called “hot spot”) within each section were selected for quantitation of MVD. Counts were performed on these fields in the hot spot at ×200 magnification. All brown‐stained endothelial cells or endothelial cell clusters that were clearly separate from connective tissue elements were considered microvessel.

mRNA  in situ hybridization in FFPE sections

mRNA locked nucleic acid in situ hybridization was performed and analyzed as described previously 31. The probe sequences used were as follows: HSP47 mRNA probe: 5′‐ GCAACGTGACCTGGAAGCTGGGCAGCCGACTGTACGGACCCAGCTCAGTGAGCTTCGCTGATGACTTCGTGC‐3′. Briefly, tumor section was deparaffinized and hydrated, followed by treatment with proteinase K and refixation in 4% paraformaldehyde. After washing with PBS, the section was hybridized with 10 μM digoxigenin(DIG)‐labeled HSP47 mRNA probe at 95°C for 5 minutes and then 37°C for 12 h in hybridization Oven (ThermoBrite S500‐24, StatSpin, Norwood, MA, USA). The probe was prepared by using a DIG‐3′‐end labeling kit. The section was then incubated for 1 h at 42°C in buffer containing anti‐DIG‐Ab Fab' fragment (Boehringer Mannheim, Mannheim, Germany), followed by staining with NBT and BCIP. The reaction was stopped with PBS and mounted for imaging. Images were recorded on an Olympus CX41 (Olympus, Tokyo, Japan) and analyzed by Motic Images Advanced 3.2 (Olympus, Tokyo, Japan).

Gene silencing and overexpression

A172, U87, SHG66 and HUVEC cells were transfected with small interfering (si)RNA oligonucleotides using Lipofectamine 2000. Briefly, siRNA and Lipofectamine 2000 were each incubated separately with Opti‐MEM for 5 minutes, mixed together for 20 minutes at room temperature and then the mixture was applied to the cells plated in 4 mL of medium (final concentration of siRNA, 60 nM). All siRNAs constructs were purchased from GenePharma (Shanghai, China) with the sequences as following: for HSP47, siHSP47 (human‐744): 5′‐GCAGCAAGCAGCACUACAATT‐3′; siHSP47 (human‐1186): 5′‐GAUGCAGAAGAAGGCUGUUTT‐3′; for control scrambled siRNA, siControl: 5′‐TTCTCCGAACGTGTCACGTTT‐3′.

Nucleotide sequence coding for HSP47 was cloned into pCDH‐CMV‐MCS‐EF1‐Puro vector (System Biosciences, Shanghai, China) at the BamH and EcoRI site. A172, U87 and SHG66 cells were infected with pCDH‐HSP47 or pCDH vector using Lipofectamine 2000. Briefly, plasmid and Lipofectamine 2000 were each incubated separately with Opti‐MEM for 5 minutes, mixed together for 20 minutes at room temperature and then the mixture was applied to the cells plated in 4 mL of medium (final concentration of plasmid, 1 μg/mL).

Transwell migration assay

Matrigel solution (Becton‐Dickinson, New Jersey, USA) was prepared in serum‐free cold medium at a dilution of 1:8 and coated 24‐well transwell chambers (8‐μm pores; Corning Costar, Tewksbury, MA, USA) overnight at 37°C. Cells were seeded in the chamber with serum‐free media containing 1% BSA in triplicate at 3 × 105 cells per well. After 24 h incubation, the medium from the chamber and the transwell were removed, and the chamber was gently wiped with a cotton swab. Migrated cells were fixed in 4% polyoxymethylene for 15 minutes and then washed by PBS for twice for a total of 10 minutes. Staining was done with 0.1% crystal violet and the cell numbers on lower surface of the membrane were quantified.

Wound‐healing assay

Migration of HUVECs was measured by wound‐healing assay. The cells were treated siRNA against HSP47 or scrambled siRNA as mentioned above. At 72 h after transfection, the confluent monolayers were wounded using a sterile pipette tip and cell migration was evaluated under phase contrast microscope immediate before and at 24 h after scratching. Photographs were taken and the relative distance traveled by the cells at the acellular front was measured.

Tube formation assay

Transfected HUVECs were examined by tube formation on Matrigel. Matrigel with growth factor added was thawed on ice overnight, spread evenly over each well (100 μL/well) of 48‐well plates and polymerized for 1 h at 37°C. HUVECs (2 × 104 cells/well) were plated onto the Matrigel layer and cultured in DMEM supplemented with 10% FBS or conditional medium from HSP47 knockdown or control SHG66 cells. After 4 to 24 h of incubation at 37°C, tube formation was observes and captured with a phase contrast microscope.

Enzyme‐linked immunosorbent assay (ELISA)

VEGF expression was measured using a commercially available ELISA kit according to the manufacturer's instruction (Excell Biology, Shanghai, China). The minimal detectable VEGF concentration was 4 pg/mL with inter‐assay and intra‐assay coefficients of variation less than 10%.

Tumor formation assay

Five‐week‐old female athymic nude mice were purchased from the Shanghai Experimental Animal Center (Shanghai, China). U87 cells were transfected with siHSP47 or siControl for 24 h, trypsinized, resuspended in PBS and then subcutaneously injected into the right flank for siHSP47 or left frank for siControl with 106 cells per injection. Tumor size was measured by a vernier caliper weekly and calculated as (length × width2)/2. All procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

RT 2 profiler PCR array

RNA was converted into first‐strand cDNA using RT2 First Strand Kit according to the manufacturer's instruction (Qiagen, China). Then, cDNA was mixed with RT2 SYBR Green Mastermix and processed for RT2 Profiler PCR Array. PCR is performed and relative expression is determined using data from the real‐time cycler and the ΔΔCT method.

Statistical analysis

All statistical analyses were carried out using the SPSS 16.0 statistical software package (SPSS Inc., Chicago, IL, USA). Continuous variables were expressed as mean ± SE. Correlation between IHC staining score and the grade of gliomas was evaluated using a χ2 test. Tumor cell viability assay were tested using the independent t test. CD31‐MVD was analyzed using the independent nonparametric tests. A two‐tailed P‐value test was used with a P < 0.05 considered statistically significant.

Results

HSP47 expression in vessels was correlated with glioma grade

Our recent study demonstrated that HSP47 expression in normal brain was almost negligible but significantly increased in GBM as compared with non‐neoplastic brain tissues 33. In line with previous reports 17, 18, HSP47 was mainly expressed in glioma vessels. Here, we investigated whether HSP47 expression in vessels was correlated with glioma grade. A semi‐quantitative analysis indicated that HSP47 expression markedly increased in GBM with the score 2.5, compared with the grade 1 glioma with 0.67, grade 2 with 0.95 and grade 3 with 1.83 (Figure 1A, Table 1). Immunoreactivity from Figure 1B clearly demonstrated that HSP47 expression was increased in high‐grade glioma.

Figure 1.

figure

HSP47 expression in vessels was correlated with glioma grade. A. Semi‐quantitative analysis of HSP47 IHC demonstrated that HSP47 staining was correlated with high‐grade glioma in tumor vasculature. B. Immunohistochemistry HSP47 in non‐neoplastic brain and different grade glioma. No HSP47 immunoreactivity was observed in non‐neoplastic brain. Increase of vascular HSP47 staining was observed in high‐grade glioma. C. HSP47 mRNA was detected in both glioma cells (green arrow) and vasculatures (red arrow) using HSP47 mRNA probe.

Table 1.

IHC score of HSP47 in vasculature

Gradea Vasculature Average IHC scoreb
− + ++ +++
1 Pilocytic astrocytoma 5 6 1 0.67 0.67
2 Astrocytoma 4 2 3 1 1.1 0.95
2 Oligodendrocytoma 5 4 3 0.83
3 Astrocytoma 3 5 5 7 1.8 1.83
3 Oligodendrocytoma 4 2 3 1.89
4 GBM 3 4 13 2.50 2.50
a

Pilocytic astrocytoma = 12; astrocytoma of grade 2 = 10; oligodendrocytoma of grade 2 = 12; anaplastic astrocytoma = 20; anaplastic oligodendrocytoma = 9; GBM = 20.

b

Score criteria: − = 0, + =1, ++=2, +++=3.

We further investigated the expression of HSP47 mRNA through in situ hybridization using HSP47 mRNA probe. Results shown in Figure 1C clearly showed that HSP47 mRNA could be detected in both glioma cells and vasculatures, which indicated that HSP47 was synthesized in both glioma and vasculature cells.

HSP47 silencing suppressed glioma angiogenesis in vivo

Because of the overexpression of HSP47 in GBM vessels, we want to address the role of HSP47 in glioma angiogenesis in vivo. First, we constructed one HSP47 siRNA, which efficiently knocked down HSP47 expression (Figure 2A). As shown in Figure 2A,B, all three GBM cell lines transfected with HSP47 siRNA showed reduction of HSP47 expression evidenced by Western blot and real‐time RT‐PCR analysis. HSP47 mRNA expression significantly decreased 44.3%, 69.3% and 89.7% in SHG66, U87 and A172 cells at 24 h after siRNA transfection, respectively (Figure 2B). Consistently, all GBM cell lines showed significant reduction of cell proliferation upon HSP47 siRNA silencing compared with siControl cells (Figure 2C).

Figure 2.

figure

HSP47 silencing suppressed glioma angiogenesis in vivo. A and B. Western blots (A) and quantitative PCR (B) demonstrated the knockdown of HSP47 in SHG66, U87 and A172 cells by siRNA silencing. The cells were transfected with siControl or siHSP47 for 72 or 96 h and subjected to immunoblot and quantitative PCR of HSP47 expression. C. HSP47 knockdown via siRNA silencing inhibited SHG66 (left), U87 (middle), and A172 (right) proliferation. Cells were transfected with siControl or siHSP47 and subjected to cell proliferation assay by CCK‐8 at 24 to 96 h after transfection. D and E. HSP47 knockdown inhibited glioma proliferation in U87 xenograft. Depicted are glioma growth curve (D), representative U87 xenograft images (E) and glioma weight of HSP47 knockdown and control group (F, n = 4). *P < 0.05, **P < 0.01, ***P < 0.001. G. Depicted are representative IHC CD31 microscopic images of siControl and HSP47 siRNA glioma. H. Semi‐quantitative analysis of CD31 IHC of control and HSP47 siRNA indicated that HSP47 knockdown group has significantly lower vascular density than that of control group.

Next, we investigated the effect of HSP47 on glioma angiogenesis in vivo. Consistently, glioma growth and weight were significantly inhibited in HSP47 siRNA group when compared with siControl group (Figure 2D). The tumor volume was 648.4 ± 151.8 mm3 and 1562.6 ± 215.7 mm3 in HSP47 siRNA group and siControl group at the end of experiment, respectively (P < 0.01). Tumor weight was 2.40 ± 0.6 g and 5.8 ± 0.8 g in HSP47 siRNA group and siControl group, respectively (Figure 2E,F, P = 0.013). We analyzed the MVD by CD31 immunohistochemistry in glioma (Figure 2G). CD31‐MVD was significantly lower in HSP47 siRNA group than in siControl group (Figure 2H, P = 0.029).

Collectively, these results demonstrate that HSP47 is required for the angiogenesis and proliferation of GBM.

HSP47 silencing diminished GBM cells migration

We investigated whether HSP47 knockdown regulate glioma cell migration. HSP47 knockdown by siRNA significantly decreased migration of SHG66 cell in triplicate independent assay by 30.1%, 36.9% and 37.3%, respectively (Figure 3A). Consistently, reduction of cell migration was identified in U87 and A172 cells upon HSP47 knockdown (Supporting Information Figure S1).

Figure 3.

figure

HSP47 silencing suppressed glioma cell migration and invasion. A. Representative microscopy (left panel) and quantitative analysis (right panel) demonstrated that HSP47 knockdown suppressed SHG66 migration. The cells were transfected with siControl or siHSP47 for 72 h and subjected to cell invasion analysis by transwell assay. **P < 0.01 vs. siControl. B and C. Representative microscopic images (B) and quantitative analysis (C) demonstrated that HSP47 knockdown suppressed cell migration in SHG66, U87 and A172 cells. Cell migration was analyzed by wound‐healing assay. **P < 0.01, vs. siControl group.

Moreover, in wound‐healing assay, we found that HSP47 knockdown by siRNA diminished wound‐healing migration in three glioma cell lines, SHG66, U87 and A172 (Figure 3B). The migration was decreased by 32.1%–57.7% in SHG66 cells, 45.6%–59.0% in U87 cells, as well as 62.7%–87.2% in A172 cells (Figure 3C).

HSP47 promotes angiogenesis

The aforementioned findings prompted us to investigate the role of HSP47 in the regulation of angiogenesis. HUVECs cells were used to investigate whether HSP47 silencing affect angiogenesis. In tube formation assay, HSP47 knockdown significantly inhibited tube formation of HUVECs at 4 and 16 h after siHSP47 transfection as compared with vector control (Figure 4A). In addition, HSP47 knockdown significantly decreased HUVECs migration and invasion in wound healing and transwell assays (Figure 4B,C). Furthermore, HSP47 knockdown significant inhibited HUVECs proliferation (Figure 4D).

Figure 4.

figure

HSP47 silencing attenuated angiogenesis in HUVECs cells. A. Representative microscopy demonstrated that HSP47 knockdown via siRNA inhibited tube formation of HUVECs. B and C. Representative microscopy of wound‐healing (B) and transwell assay (C) indicated that HSP47 knockdown suppressed HUVECs invasion and migration. D. HSP47 knockdown via siRNA silencing inhibited HUVECs proliferation. HUVEC cells were transfected with siControl or siHSP47 and subjected to cell proliferation assay by CCK‐8 at 24 and 96 h after transfection. E. Conditional medium derived from HSP47 knockdown SHG66 cell attenuated HUCEC tube formation. At 4 h after incubation, tube formation was mildly inhibited by HSP47 knockdown SHG66 conditional medium as compared with the control medium. At 24 h after incubation, HSP47 knockdown conditional medium dramatically inhibited HUVECs tube formation. F. Representative microscopic image demonstrated that HSP47 knockdown conditional medium attenuated HUVECs cells migration as compared with conditional medium from control cells. G. HSP47 knockdown conditional medium significantly inhibited HUVECs cells proliferation. HUVECs cells were incubated with HSP47 knockdown conditional medium or control conditional medium for 24 and 96 h, and subjected to cell proliferation assay by CCK‐8. H. HSP47 knockdown conditional medium enhanced the inhibitory action of Avastin in HUVECs cells proliferation. HUVECs cells were incubated with the conditional medium and treated with Avastin (5 μM). Proliferation was analyzed by CCK‐8 at 24 and 96 h treatment. I and J. HSP47 knockdown attenuated and HSP47 overexpression increased VEGF expression in SHG66 cells. SHG66 cells were transfected with siHSP47, pCDH‐HSP47 (HSP47) or vector for 72 h. The VEGF expression in the conditional medium was analyzed by ELISA.

We further investigated the effect of HSP47 knockdown SHG66 cell conditional medium on angiogenesis. Conditional medium derived from HSP47 knockdown SHG66 cells significantly inhibited HUVECs tube formation as compared with conditional medium from control vector infected SHG66 cells (Figure 4E). HSP47 knockdown SHG66 cell conditional medium significantly attenuated HUVECs migration (Figure 4F) and proliferation (Figure 4G). In addition, HSP47 knockdown SHG66 cell conditional medium increased chemosensitivity of HUVECs cells to Avastin (Figure 4H).

We analyzed the role of HSP47 in VEGF expression in glioma cells. HSP47 knockdown using siRNA reduced VEGF expression of by 53.6% in SHG66 cells (Figure 4I). On the other hand, HSP47 overexpression increased the VEGF expression by 48.1% in SHG66 cells (Figure 4J).

These data indicate that HSP47 knockdown reduce VEGF expression and secretion in glioma cell, thus, inhibit glioma angiogenesis.

HSP47 knockdown attenuates angiogenesis associated gene expression

Finally, we sought to gain insights into the mechanism of HSP47‐mediated angiogenesis. RT2 Profiler™ PCR Array Human Angiogenesis (PAHS‐024Z, SABiosciences, Valencia, CA, USA) was used to investigate the gene expression profile induced by HSP47 silencing. Three GBM cell lines (SHG66, U87 and A172) transfected with HSP47 siRNA and siControl were used to analyze the expression of 96 angiogenesis associated genes. The heat map was shown in Figure 5A. Fourteen genes were significantly changed (Supporting Information Table S1) in which 13 genes were significantly down‐regulated by HSP47 silencing in A172 and SHG66 cells, including VEGFR2, ERBB2 (HER2), BAI1, CD31, PLG. The gene array result was further verified by Western blot analysis of VEGFR2 and ERBB2, indicating that these gene expressions were indeed down‐regulated after HSP47 knockdown in A172 and SHG66 cells (Figure 5B).

Figure 5.

figure

Angiogenesis gene assay. A. Heat map demonstrated the effect of HSP47 knockdown on angiogenesis associated gene expression. A total of 96 genes were analyzed. B. Representative Western blots demonstrated that knockdown HSP47 in SHG66 and A172 cells decreased ERBB2 and VEGFR2 expression. C. Representative Western blots demonstrated that knockdown HSP47 in SHG66 inhibited HIF1α, PLCγ, SRC and ERK1/2 expression. SHG66 cells were transfected with siControl or siHSP47 for 72 or 96 h and subjected to Western blot analysis of the indicated proteins. D. Representative Western blots demonstrated that HSP47 overexpression in SHG66 increased HIF1α, PLCγ, SRC and ERK1/2 expression. SHG66 cells were transfected with HSP47 or vector for 72 or 96 h and subjected to Western blot analysis of the indicated proteins.

We investigated whether HSP47 regulate angiogenesis signal pathway by Western blot analysis of PLCγ, ERK1/2, p38MAPK, Src, FAK, AKT473. In SHG66 cells, knockdown of HSP47 dramatically reduced the expression of HIF1α, PLCγ, ERK1/2 and Src (Figure 5C). On the other hand, overexpression of HSP47 increased the expression of HIF1α, PLCγ, ERK1/2 and Src (Figure 5D). Those data indicated that VEGFR2‐PLCγ‐ERK1/2 pathway was involved in the action of HSP47 in glioma angiogenesis.

Discussion

HSPs have been indicated to play roles in tumor angiogenesis because of their interaction with angiogenic factors such as VEGF, EGFR, PDGFR and HIF‐1α 25. HIF‐1α is a potent activator of angiogenesis and its activation results in activation of VEGF receptors, enhancing endothelial cell proliferation, invasion and migration 8. HSP90 has been indicated as a major activator for HIF‐1α 12 and expression of VEGF receptors 26. Inhibition of HSP90 expression reduces expression of VEGF receptors, thus, inhibits angiogenesis. In addition, perturbation of the HSP70‐HSP90 axis results in reduction of endothelial VEGFR2 expression and angiogenesis 2. Knockdown of HSP47 has shown to interfere function of vascular basal membrane 11. HSP47 knockout mice displayed abnormal basement membranes and ruptured blood vessels 20. HSP47 has been found to express in neovasculature of oral squamous cell carcinomas and gliomas 18, 22, indicating that HSP47 might play roles in cancer angiogenesis.

Consistent with the previous reports, our IHC and in situ hybridization results indicate that HSP47 is mainly expressed in glioma blood vessels 17, 18, 19. In the xenograft model, MVD denoted by CD31 was significantly lower in HSP47 siRNA group than in siControl group, indicating that HSP47 expression is essential for the glioma angiogenesis. Consistently, HSP47 knockdown significantly decreased angiogenesis action of HUVEC cells. Further mechanism study demonstrated that HSP47 regulated the expression of HIF‐1α and VEGF in glioma cells. VEGF is considered as a major driver of tumor angiogenesis, which promote blood vessel formation by endothelial precursors 24. Conditional medium derived from HSP47 knockdown glioma cells significantly inhibited HUVECs tube formation as compared with that from control vector infected cells. Furthermore, we found that expression of VEGFR‐2, including the downstream genes such as PLCγ, ERK1/2, was regulated by HSP47. These results suggest that HSP47 play a critical role in glioma angiogenesis.

HSP47 is a serpin family protein that may modulate cell migration during development. Recently, few studies reported that HSP47 expression was associated with tumor cell proliferation, migration and invasion 9, 34, 35, 36. Zhao et al reported that HSP47 enhanced glioma tumor growth and invasion through regulating by miR‐29a 36. Consistently, our current study demonstrated that knockdown of HSP47 significantly inhibited glioma cell proliferation, migration and invasion. Furthermore, HSP47 knockdown significantly decreased HUVEC cell proliferation, migration and invasion. In addition to the reduced angiogenesis, inhibition of glioma cell proliferation and migration is responsible, at least in part, for the reduction of tumor volume after silencing HSP47 in the xenograft model. These findings indicate that HSP47 plays an important role in glioma cell progression.

From a therapeutic perspective, perhaps one the most unexpected findings in this study is that conditional medium derived from HSP47 knockdown GBM cells increased the chemosensitivity of HUVECs cells to Avastin. Emerging evidence has demonstrated that overexpression of HSP associates with the resistance of cancers to chemotherapy 3, 5, 29. Both HSP27 and HSP70 have been identified to be involved in resistance of breast cancer cells to chemotherapies 3, 29. A recent study has indicated that HSP47 protects cells from Golgi stress‐induced apoptosis 13. The current study demonstrated that downregulation of HSP47 increased sensitivity to Avastin treatment. However, it is still a long way to go for HSP47 as a potential target of anti‐angiogenesis on glioma cells in clinical use.

Taken together, our current study demonstrated that HSP47 expression was associated with the glioma malignancy. Moreover, our data suggest that HSP47 expression is involved in the glioma angiogenesis through HIF1α‐VEGF‐VEGFR2 signaling. We speculated that HSP47 enhances VEGF expression in glioma endothelium, therefore, promoting glioma angiogenesis through autocrine and paracrine mechanisms (Figure 6). This study highlights the importance of HSP47 as an attractive therapeutic target of GBM.

Figure 6.

figure

Schematic illustration depicts the HSP47 promotes glioma angiogenesis.

Conflict of Interest

The authors disclose no conflict of interest.

Supporting information

Figure S1. Representative microscopy (left panel) and quantitative analysis (right panel) demonstrated that HSP47 knockdown suppressed U87 and A172 migration. The cells were transfected with siControl or siHSP47 for 72 h and subjected to cell invasion analysis by transwell assay. **P < 0.01 vs. siControl.

Table S1. Gene expression profile induced by HSP47 silencing in all 3 GBM cell lines.

Acknowledgments

This project was based upon work funded by grants from the National Natural Science Foundation of China (81271523 and 81471392 to ZBW).

References

  • 1. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB et al (2006) Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444:756–760. [DOI] [PubMed] [Google Scholar]
  • 2. Bruns AF, Yuldasheva N, Latham AM, Bao L, Pellet‐Many C, Frankel P et al (2012) A heat‐shock protein axis regulates VEGFR2 proteolysis, blood vessel development and repair. PLoS ONE 7:e48539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Fuqua SA, Oesterreich S, Hilsenbeck SG, Von Hoff DD, Eckardt J, Osborne CK (1994) Heat shock proteins and drug resistance. Breast Cancer Res Treat 32:67–71. [DOI] [PubMed] [Google Scholar]
  • 4. Hambardzumyan D, Squatrito M, Holland EC (2006) Radiation resistance and stem‐like cells in brain tumors. Cancer Cell 10:454–456. [DOI] [PubMed] [Google Scholar]
  • 5. Hermisson M, Strik H, Rieger J, Dichgans J, Meyermann R, Weller M (2000) Expression and functional activity of heat shock proteins in human glioblastoma multiforme. Neurology 54:1357–1365. [DOI] [PubMed] [Google Scholar]
  • 6. Hosokawa N, Hohenadl C, Satoh M, Kuhn K, Nagata K (1998) HSP47, a collagen‐specific molecular chaperone, delays the secretion of type III procollagen transfected in human embryonic kidney cell line 293: a possible role for HSP47 in collagen modification. J Biochem 124:654–662. [DOI] [PubMed] [Google Scholar]
  • 7. Hua W, Yao Y, Chu Y, Zhong P, Sheng X, Xiao B et al (2011) The CD133+ tumor stem‐like cell‐associated antigen may elicit highly intense immune responses against human malignant glioma. J Neurooncol 105:149–157. [DOI] [PubMed] [Google Scholar]
  • 8. Kaur B, Khwaja FW, Severson EA, Matheny SL, Brat DJ, Van Meir EG (2005) Hypoxia and the hypoxia‐inducible‐factor pathway in glioma growth and angiogenesis. Neuro‐Oncol 7:134–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Kuroda K, Tajima S (2008) Proliferation of HSP47‐positive skin fibroblasts in dermatofibroma. J Cutan Pathol 35:21–26. [DOI] [PubMed] [Google Scholar]
  • 10. Maitra A, Iacobuzio‐Donahue C, Rahman A, Sohn TA, Argani P, Meyer R et al (2002) Immunohistochemical validation of a novel epithelial and a novel stromal marker of pancreatic ductal adenocarcinoma identified by global expression microarrays: sea urchin fascin homolog and heat shock protein 47. Am J Clin Pathol 118:52–59. [DOI] [PubMed] [Google Scholar]
  • 11. Martinek N, Shahab J, Sodek J, Ringuette M (2007) Is SPARC an evolutionarily conserved collagen chaperone? J Dent Res 86:296–305. [DOI] [PubMed] [Google Scholar]
  • 12. Minet E, Mottet D, Michel G, Roland I, Raes M, Remacle J, Michiels C (1999) Hypoxia‐induced activation of HIF‐1: role of HIF‐1alpha‐Hsp90 interaction. FEBS Lett 460:251–256. [DOI] [PubMed] [Google Scholar]
  • 13. Miyata S, Mizuno T, Koyama Y, Katayama T, Tohyama M (2013) The endoplasmic reticulum‐resident chaperone heat shock protein 47 protects the Golgi apparatus from the effects of O‐glycosylation inhibition. PLoS ONE 8:e69732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Morino M, Tsuzuki T, Iijima H, Shirakami T, Kiyosuke YI, Ishikawa Y et al (1995) Marked induction of HSP47, a collagen‐binding stress protein, during solid tumor formation of ascitic Sarcoma 180 in vivo. In Vivo 9:503–508. [PubMed] [Google Scholar]
  • 15. Morino M, Tsuzuki T, Ishikawa Y, Shirakami T, Yoshimura M, Kiyosuke Y et al (1997) Specific expression of HSP47 in human tumor cell lines in vitro. In Vivo 11:17–21. [PubMed] [Google Scholar]
  • 16. Murat A, Migliavacca E, Gorlia T, Lambiv WL, Shay T, Hamou MF et al (2008) Stem cell‐related “self‐renewal” signature and high epidermal growth factor receptor expression associated with resistance to concomitant chemoradiotherapy in glioblastoma. J Clin Oncol 26:3015–3024. [DOI] [PubMed] [Google Scholar]
  • 17. Mustafa D, van der Weiden M, Zheng P, Nigg A, Luider TM, Kros JM (2010) Expression sites of colligin 2 in glioma blood vessels. Brain Pathol 20:50–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Mustafa DA, Burgers PC, Dekker LJ, Charif H, Titulaer MK, Smitt PA et al (2007) Identification of glioma neovascularization‐related proteins by using MALDI‐FTMS and nano‐LC fractionation to microdissected tumor vessels. Mol Cell Proteomics 6:1147–1157. [DOI] [PubMed] [Google Scholar]
  • 19. Mustafa DA, Sieuwerts AM, Zheng PP, Kros JM (2010) Overexpression of colligin 2 in glioma vasculature is associated with overexpression of heat shock factor 2. Gene Regul Syst Bio 4:103–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Nagai N, Hosokawa M, Itohara S, Adachi E, Matsushita T, Hosokawa N, Nagata K (2000) Embryonic lethality of molecular chaperone hsp47 knockout mice is associated with defects in collagen biosynthesis. J Cell Biol 150:1499–1506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Nese N, Kandiloglu AR, Simsek G, Lekili M, Ozdamar A, Catalkaya A, Coskun T (2010) Comparison of the desmoplastic reaction and invading ability in invasive ductal carcinoma of the breast and prostatic adenocarcinoma based on the expression of heat shock protein 47 and fascin. Anal Quant Cytol Histol 32:90–101. [PubMed] [Google Scholar]
  • 22. Nikitakis NG, Rivera H, Lopes MA, Siavash H, Reynolds MA, Ord RA, Sauk JJ (2003) Immunohistochemical expression of angiogenesis‐related markers in oral squamous cell carcinomas with multiple metastatic lymph nodes. Am J Clin Pathol 119:574–586. [DOI] [PubMed] [Google Scholar]
  • 23. Ono T, Miyazaki T, Ishida Y, Uehata M, Nagata K (2012) Direct in vitro and in vivo evidence for interaction between Hsp47 protein and collagen triple helix. J Biol Chem 287:6810–6818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Plate KH, Breier G, Weich HA, Risau W (1992) Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 359:845–848. [DOI] [PubMed] [Google Scholar]
  • 25. Rich JN, Bigner DD (2004) Development of novel targeted therapies in the treatment of malignant glioma. Nat Rev Drug Discov 3:430–446. [DOI] [PubMed] [Google Scholar]
  • 26. Sanderson S, Valenti M, Gowan S, Patterson L, Ahmad Z, Workman P, Eccles SA (2006) Benzoquinone ansamycin heat shock protein 90 inhibitors modulate multiple functions required for tumor angiogenesis. Mol Cancer Ther 5:522–532. [DOI] [PubMed] [Google Scholar]
  • 27. Sauk JJ, Nikitakis N, Siavash H (2005) Hsp47 a novel collagen binding serpin chaperone, autoantigen and therapeutic target. Front Biosci 10:107–118. [DOI] [PubMed] [Google Scholar]
  • 28. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ et al (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352:987–996. [DOI] [PubMed] [Google Scholar]
  • 29. Vargas‐Roig LM, Gago FE, Tello O, Aznar JC, Ciocca DR (1998) Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy. Int J Cancer 79:468–475. [DOI] [PubMed] [Google Scholar]
  • 30. Weidner N (1995) Current pathologic methods for measuring intratumoral microvessel density within breast carcinoma and other solid tumors. Breast Cancer Res Treat 36:169–180. [DOI] [PubMed] [Google Scholar]
  • 31. Wu ZB, Cai L, Lin SJ, Lu JL, Yao Y, Zhou LF (2013) The miR‐92b functions as a potential oncogene by targeting on Smad3 in glioblastomas. Brain Res 1529:16–25. [DOI] [PubMed] [Google Scholar]
  • 32. Wu ZB, Cai L, Lin SJ, Xiong ZK, Lu JL, Mao Y et al (2013) High‐mobility group box 2 is associated with prognosis of glioblastoma by promoting cell viability, invasion, and chemotherapeutic resistance. Neuro‐Oncol 15:1264–1275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Wu ZB, Cai L, Qiu C, Zhang AL, Lin SJ, Yao Y et al (2014) CTL responses to HSP47 associated with the prolonged survival of patients with glioblastomas. Neurology 82:1261–1265. [DOI] [PubMed] [Google Scholar]
  • 34. Xu CJ, Mikami T, Nakamura T, Tsuruta T, Nakada N, Yanagisawa N et al (2013) Tumor budding, myofibroblast proliferation, and fibrosis in obstructing colon carcinoma: the roles of Hsp47 and basic fibroblast growth factor. Pathol Res Pract 209:69–74. [DOI] [PubMed] [Google Scholar]
  • 35. Yamamoto N, Kinoshita T, Nohata N, Yoshino H, Itesako T, Fujimura L et al (2013) Tumor‐suppressive microRNA‐29a inhibits cancer cell migration and invasion via targeting HSP47 in cervical squamous cell carcinoma. Int J Oncol 43:1855–1863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Zhao D, Jiang X, Yao C, Zhang L, Liu H, Xia H, Wang Y (2014) Heat shock protein 47 regulated by miR‐29a to enhance glioma tumor growth and invasion. J Neurooncol 118:39–47. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Representative microscopy (left panel) and quantitative analysis (right panel) demonstrated that HSP47 knockdown suppressed U87 and A172 migration. The cells were transfected with siControl or siHSP47 for 72 h and subjected to cell invasion analysis by transwell assay. **P < 0.01 vs. siControl.

Table S1. Gene expression profile induced by HSP47 silencing in all 3 GBM cell lines.


Articles from Brain Pathology are provided here courtesy of Wiley

RESOURCES