Skip to main content
PMC home page
Brain Pathology logoLink to Brain Pathology
. 2014 Apr 14;24(6):584–598. doi: 10.1111/bpa.12137

Complex Deregulation and Expression of Cytokines and Mediators of the Immune Response in Parkinson's Disease Brain is Region Dependent

Paula Garcia‐Esparcia 1, Franc Llorens 1, Margarita Carmona 1, Isidre Ferrer 1,2,3,✉
PMCID: PMC8029304  PMID: 24593806

Abstract

Neuroinflammation is common in neurodegenerative diseases including Parkinson disease (PD). Expression of 25 mRNAs was assessed with TaqMan‐PCR including members of the complement system, colony stimulating factors, Toll family, cytokines IL‐8, IL‐6, IL‐6ST, IL‐1B, TNF‐α family, IL‐10, TGFβ family, cathepsins and integrin family, in the substantia nigra pars compacta, putamen, frontal cortex area 8 and angular gyrus area 39, in a total of 43 controls and 56 cases with PD‐related pathology covering stages 1–6 of Braak. Up‐regulation of IL‐6ST was the only change in the substantia nigra at stages 1–2. Down‐regulation of the majority of members examined occurred in the substantia nigra from stage 4 onwards. However, region‐dependent down‐ and up‐regulation of selected mRNAs occurred in the putamen and frontal cortex, whereas only mRNA up‐regulated mRNAs were identified in the angular cortex from stage 3 onwards in PD cases. Protein studies in frontal cortex revealed increased IL6 expression and reduced IL‐10 with ELISA, and increased IL‐6 with western blotting in PD. Immunohistochemistry revealed localization of IL‐5, IL‐6 and IL‐17 receptors in glial cells, mainly microglia; IL‐5, IL‐10 and M‐CSF in neurons; TNF‐α in neurons and microglia; and active NF‐κB in the nucleus of subpopulations of neurons and glial cells in PD. Distinct inflammatory responses, involving pro‐ and anti‐inflammatory cytokines, and variegated mediators of the immune response occur in different brain regions at the same time in particular individuals. Available information shows that altered α‐synuclein solubility and aggregation, Lewy body formation, oxidative damage and neuroinflammation converge in the pathogenesis of PD.

Keywords: cytokines, immune responses, neuroinflammation, Parkinson's disease, α‐synuclein.

Introduction

Inflammation, comprising neuroinflammation and peripheral inflammatory responses are documented in Parkinson's disease (PD; 31, 34, 35, 36, 37, 50, 54, 55, 56, 62, 78, 85, 86, 88, 91). Microglia are activated in the substantia nigra and other brain regions in PD including striatum, frontal and temporal cortex, and pons, as detected by histological and positron emission tomography with specific ligands 9, 13, 30, 40, 41, 54, 55, 66, 67, 78, 86. Increased levels of interleukins (IL)‐1β, IL‐2, IL‐6, and tumor necrosis factor (TNF) α, as revealed by enzyme‐linked immunosorbent assay (ELISA), are found in the striatum and colony stimulating factor (CSF; 5, 59, 60, 62, 63). A microarray study has also shown increased expression of genes encoding cytokines in the substantia nigra in PD 22, whereas increased IL‐6 mRNA has been reported in the hippocampus 40. Under appropriate inflammatory conditions, microglia may produce a wide range of pro‐inflammatory and anti‐inflammatory cytokines, cytokine receptors, and other immune‐related molecules 46. In this line, double immunofluorescence staining has revealed the production of TNF‐α and IL‐6 in activated microglia in the putamen of PD patients 64, and increased cytokine expression has been reported in glial cells (mostly microglia) in several brain regions in dementia with Lewy bodies 45. Moreover, nuclear translocation of NF‐κB (p65), an indicator of NF‐κB activation, has been described in the substantia nigra in PD 39. All these observations point to the activation of innate central nervous system (CNS) immune responses in PD.

Variable increase of serum and peripheral blood mononuclear cells levels of IL‐1β, IL‐2, IL‐4, IL‐6, IL‐8, IL‐10, IL‐12, NT‐proCNP, TNF‐α, soluble TNF‐α receptor‐1 (TNFR1) and chemokine (C‐C motif) ligand 5 (RANTES) in PD 3, 8, 12, 21, 38, 48, 73, 74, 75, 79, 83, indicates the existence of a systemic inflammation manifested as a peripheral dysregulation of cytokines and related molecules in PD. Curiously, increased TNF‐α levels in blood have been reported to be significantly correlated with altered cognition, depression and sleep disturbances in PD 57.

In addition, lymphocytes infiltrate the substantia nigra in PD 54, 58, 71, and CD+4 and CD+8 T‐cells are recruited to the substantia nigra in PD 7. Examination of peripheral blood lymphocytes has shown altered percentages of peripheral T and B lymphocytes 83. Increased CD45RO+ and FAS+ CD4+ T‐cells, and decreased CD31+ and α4β7+ CD4+ T, further supports the concept that chronic immune stimulation is associated with PD pathobiology 77.

Finally, various studies have shown polymorphisms in TNF‐α, IL‐1β and IL‐6 as risk factors of PD 33, 49, 53, 88, 89.

In spite of this volume of information in humans, and additional data provided by several experimental models in vivo and in vitro (which are not the subject of the present study) indicating the role of inflammation in PD, little is known about the regional variability in inflammatory responses revealed by a large‐scale study of brain‐produced cytokines and mediators of immune responses. Moreover, the possible role of other cells in addition to microglia, which may establish interactions between cytokines and their receptors, has not been properly assessed in the CNS, in which immune responses are expected to be triggered locally in primary neurodegenerative diseases.

Materials and Methods

Selection of cases and general processing

Brain tissue was obtained from the Institute of Neuropathology HUB‐ICO‐IDIBELL and Clinic Hospital‐IDIBAPS Biobanks following the guidelines of Spanish legislation on this matter and the approval of the local ethics committees. The post‐mortem interval between death and tissue processing was between 3 and 16 h. One hemisphere was immediately cut in coronal sections, 1‐cm thick, and selected areas of the encephalon were rapidly dissected, frozen on metal plates over dry ice, placed in individual airtight plastic bags, numbered with water‐resistant ink, and stored at −80°C until use for biochemical studies. The other hemisphere was fixed by immersion in 4% buffered formalin for 3 weeks for morphological studies. In addition, samples of substantia nigra, putamen, frontal cortex and angular gyrus were fixed in 4% paraformaldehyde for 24 h and then cryoprotected with 30% saccharose for 48 h, frozen in liquid nitrogen, and maintained at −80°C until use.

Neuropathological diagnosis of PD was based on the classification of Braak, but excluding atypical cases in which no graded pathology from the medulla oblongata, pons and midbrain to limbic structures was confirmed 6. The majority of cases had evidence of classical parkinsonism and had received pharmacological treatment for variable periods (n = 40). Six of these had suffered from dementia. Others did not complain of parkinsonism, and the diagnosis of incidental PD (iPD) was based on the post‐mortem neuropathological study based on the presence of Lewy bodies in selected nuclei of the medulla oblongata, pons and substantia nigra, accompanied by variable neuronal loss in the substantia nigra not exceeding 50% (n = 16). Cases with combined pathologies [i.e. Alzheimer's disease, excepting stages I–II (A) of Braak and Braak; tauopathy; vascular diseases; and metabolic syndrome] were excluded from the present study. Age‐matched control cases had not suffered from neurologic, psychiatric diseases, or metabolic diseases (including metabolic syndrome) and did not have abnormalities in the neuropathological examination (excepting Braak and Braak stages I–II). The total number of cases was 43 controls and 56 cases with PD‐related pathology. The regions analyzed were substantia nigra pars compacta, putamen, frontal cortex area 8 and angular gyrus area 39. However, not all cases had four regions available for biochemical study. The substantia nigra was studied in 14 PD cases stages 1–2 (n = 4), 3 (n = 1), 4 (n = 3) and 5 (n = 6), and 12 controls; the putamen in 7 PD cases stages 3 (n = 1), 4 (n = 4) and 5 (n = 2) and 8 controls; the frontal cortex (area 8) in 26 PD cases stages 3 (n = 1), 4 (n = 14), 5 (n = 10) and 6 (n = 1), and 21 controls; and the angular gyrus (area 39) in 13 PD cases stages 3 (n = 1), 4 (n = 8) and 5 (n = 4), and 9 controls. Representation of genders was as follows: controls: 27 men and 16 women; PD cases: 40 men and 16 women. A summary of cases, and samples and methods available for study in the present series are shown in Table 1.

Table 1.

Clinical and pathologic characteristics of cases and regions examined

CASE GENDER AGE P‐M PD BRAAK FC SN AG PUT DIAG
 1 M 61 4 h 30 minutes 0 X X C
 2 M 59 4 h 15 minutes 0 X X C
 3 M 77 6 h 50 minutes 0 X X C
 4 M 68 10 h 55 minutes 0 X C
 5 M 64 8 h 30 minutes 0 X X C
 6 M 67 14 h 40 minutes 0 X C
 7 M 66 5 h PD4 X iPD
 8 M 53 3 h PD4 X X PD
 9 M 76 4 h 30 minutes PD4 X PD
10 M 68 4 h 45 minutes PD5 X PD
11 M 79 9 h 15 minutes PD5 X PD
12 M 69 5 h 55 minutes PD5 X PD
13 M 56 5 h 0 X X C
14 M 67 5 h 0 X X C
15 M 62 3 h 0 X X C
16 M 52 4 h 40 minutes 0 X X C
17 M 30 4 h 10 minutes 0 X C
18 M 53 3 h 0 X C
19 F 49 7 h 0 X C
20 F 75 3 h 0 X X C
21 F 46 9 h 35 minutes 0 X X C
22 F 86 4 h 15 minutes 0 X C
23 F 79 3 h 35 minutes 0 X C
24 F 79 6 h 25 minutes 0 X C
25 F 77 3 h 15 minutes 0 X C
26 F 76 5 h 45 minutes 0 X C
27 F 71 8 h 30 minutes 0 X C
28 F 70 4 h 30 minutes PD5 X PD
29 F 77 3 h 30 minutes PD4 X PD
30 M 66 5 h PD4 X X iPD
31 F 81 6 h 30 minutes PD5 X PD
32 F 69 4 h 30 minutes PD5 X PD
33 F 79 3 h 30 minutes PD4 X PD
34 M 57 11 h PD4 X X PD
35 M 57 19 h PD5 X X PD
36 M 76 4 h 30 minutes PD4 X X PD
37 M 68 4 h 45 minutes PD4 X PD
38 M 79 9 h 15 minutes PD4 X iPD
39 M 69 5 h 55 minutes PD4 X X iPD
40 F 54 11 h 10 minutes PD3 X iPD
41 M 78 13 h 30 minutes PD5 X PD
42 M 83 14 h PD5 X PD
43 F 77 7 h 30 minutes PD5 X PD
44 M 80 7 h 30 minutes PD6 X PDD
45 F 84 4 h 30 minutes PD4 X PD
46 M 68 9 h 20 minutes PD4 X PD
47 M 77 12 h PD4 X PD
48 M 59 4 h 15 minutes 0 X C
49 M 67 14 h 40 minutes 0 X C
50 M 70 2 h 0 X C
51 M 61 4 h 30 h 0 X C
52 M 63 8 h 5 h 0 X C
53 M 30 4 h 10 minutes 0 X C
54 M 57 4 h 30 minutes 0 X C
55 M 60 4 h 15 minutes 0 X C
56 F 68 04 h 30 minutes 0 X C
57 F 64 2 h 15 minutes 0 X C
58 F 46 9 h 35 minutes 0 X C
59 F 79 6 h 25 minutes 0 X C
60 M 78 13 h 30 minutes PD5 X PD
61 M 83 14 h PD5 X PD
62 M 76 12 h PD5 X PD
63 M 68 9 h 20 minutes PD4 X PD
64 M 80 7 h 30 minutes PD4 X PD
65 M 85 11 h 45 minutes PD4 X iPD
66 M 81 4 h 55 minutes PD3 X iPD
67 M 84 16 h 30 minutes PD5 X PD
68 F 77 7 h 30 minutes PD5 X PD
69 F 84 4 h 30 minutes PD5 X PD
70 M 56 5 h 0 X C
71 F 78 12 h 0 X C
72 F 78 4 h 30 minutes PD5 X PDD
73 F 79 1 h 30 minutes PD5 X PDD
74 M 76 4 h PD5 X PDD
75 M 84 4 h PD4 X PDD
76 M 68 4 h 45 minutes PD4 X PD
77 M 69 15 h 05 minutes PD4 X PD
78 F 70 10 h 50 minutes PD3 X iPD
79 M 78 12 h 0 X C
80 F 72 4 h 0 X C
81 M 75 5 h 15 minutes 0 X C
82 M 57 4 h 30 minutes 0 X C
83 M 60 4 h 15 minutes 0 X C
84 F 70 4 h 40 minutes PD4 X PD
85 M 81 4 h 55 minutes PD3 X iPD
86 M 84 9 h PD4 X iPD
87 M 74 6 h 45 minutes PD4 X iPD
88 M 79 4 h 30 minutes PD5 X PD
89 M 77 7 h 30 minutes PD5 X PD
90 F 88 11 h 50 minutes PD4 X iPD
91 M 80 15 h 50 minutes 0 C
92 M 66 5 h 45 minutes 0 C
93 M 69 15 h 05 minutes PD4 PDD
94 F 73 15 h 45 minutes 0 C
95 M 50 15 h 30 minutes PD5 PD
96 M 74 10 h 50 minutes PD1 X iPD
97 M 83 3 h 30 minutes PD2 X iPD
98 F 97 3 h 40 minutes PD2 X iPD
99 M 80 6 h PD1 X iPD
Open in a new tab

P‐M = post‐mortem delay (hours, minutes); PD Braak = Parkinson's disease‐related pathology stages of Braak; FC = frontal cortex area 8; SN = substantia nigra pars compacta; AG = angular gyrus, area 39; Put = putamen; DIAG = neuropathological diagnosis; C = control (no neurological and neuropathological anomalies); iPD = incidental Parkinson's disease (no clinical history of parkinsonism); PD = clinical manifestation of parkinsonism; PDD = PD plus dementia. Cases with additional pathology, excepting stages I–II of neurofibrillary pathology and A of senile plaques following Braak and Braak nomenclature, were not considered in the present series.

RNA purification

The purification of RNA was carried out with RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer and following the optional DNase digest. The concentration of each sample was obtained from A260 measurements with NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). RNA integrity was tested using the Agilent 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA). Values of RNA quality, or RNA integrity number (RIN), were from 6.6 to 8.8.

Retrotranscription reaction

The retrotranscriptase reaction of all regions—substantia nigra, putamen, frontal cortex and angular gyrus—was carried out using the high‐capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA) following the protocol provided by the supplier, and using Gene Amp® 9700 PCR System thermocycler (Applied Biosystems). Parallel reactions for each RNA sample were run in the absence of MultiScribe Reverse Transcriptase to assess the degree of contaminating genomic DNA.

TaqMan polymerase chain reaction (PCR)

Cases analyzed included substantia nigra pars compacta (12 control and 14 PD cases), putamen (8 control and 7 PD cases), frontal cortex, area 8 (16 control and 20 PD cases) and angular gyrus (9 control and 12 PD cases). TaqMan PCR assays for each gene were performed in duplicate on cDNA samples in 384‐well optical plates using an ABI Prism 7900 Sequence Detection system (Applied Biosystems). For each 10 μL TaqMan reaction, 4.5 μL cDNA was mixed with 0.5 μL 20× TaqMan Gene Expression Assays and 5 μL of 2× TaqMan Universal PCR Master Mix (Applied Biosystems). Parallel assays for each sample were carried out using probes for β‐glucuronidase (GUS‐B) and X‐prolyl aminopeptidase (aminopeptidase P) 1 (XPNPEP1) for normalization. The reactions were carried out using the following parameters: 50°C for 2‐minute, 95°C for 10‐minute, and 40 cycles of 95°C 15 s, and 60°C for 1‐minute. Finally, all TaqMan PCR data were captured using the Sequence Detector Software (SDS version 1.9, Applied Biosystems). The probes, the housekeeping and all context sequences are listed in Table 2.

Table 2.

Context sequence of TaqMan probes

GUS‐B: GCTACTACTTGAAGATGGTGATCGC
XPNPEP1: CAAAGAGTGCGACTGGCTCAACAAT
C1QL1: CTGCAAGAATGGCCAGGTGCGGGCC
C1QTNF7: GGGAACTGCAGGTTTGAGAGGTAAG
C3AR1: TCTCAGTTTTTTGAAGTTTAGCAAT
CLEC7A: TCTAACTTATTTCAGATCAGAACCA
CSF1R: CCAAAGAATATATACAGCATCATGC
CSF3R: GCTGCTCCCCGGAAGTCTGGAGGAG
CST7: GGCCCTTCCCCAGATACTTGTTCCC
CTSC: CGGTTATGGGACCACAAGAAAAAAA
CTSS: AAAGCCATGGATCAGAAATGTCAAT
CYBA: ATCTCCTGCTCTCGGTGCCCGCCGG
IL‐1B: CAGATGAAGTGCTCCTTCCAGGACC
IL‐6: TCAGCCCTGAGAAAGGAGACATGTA
IL‐6ST: CAAAGTTTGCTCAAGGAGAAATTGA
IL‐8: GTGTGAAGGTGCAGTTTTGCCAAGG
IL‐10: AATAAGCTCCAAGAGAAAGGCATCT
IL‐10RA: CAGTGTCCTGCTCTTCAAGAAGCCC
IL‐10RB: TCCACAGCACCTGAAAGAGTTTTTG
INPP5D: GACGAATCCTATGGCGAGGGCTGCA
ITGB2: GCGACCAGGCCAGGCAGCAGCGTTC
TGFB1: AGTACAGCAAGGTCCTGGCCCTGTA
TGFB2: GCACAGCAGGGTCCTGAGCTTATAT
TLR4: GGAGCCCTGCGTGGAGGTGGTTCCT
TLR7: AGACTAAAAATGGTGTTTCCAATGT
TNF: TGGCCCAGGCAGTCAGATCATCTTC
TNFRSF1A: CTCCTGTAGTAACTGTAAGAAAAGC
Open in a new tab

C1QL1 = complement component 1, q subcomponent‐like 1; C1QTNF7 = C1q and tumor necrosis factor related protein 7; C3AR1 = complement component 3a receptor 1; CLEC7A = C‐type lectin domain family 7, member A; CSF1R = colony stimulating factor 1 receptor; CSF3R = colony stimulating factor 3 receptor; CST7 = cystatin F (leukocystatin); CTSC = cathepsin C; CTSS = cathepsin S; CYBA = cytochrome b‐245, α polypeptide; GUS‐B = β‐glucuronidase; IL‐10 = interleukin 10; IL‐10RA = interleukin 10 receptor α; IL‐10RB = interleukin 10 receptor β; IL‐17R = interleukin 17 receptor A; IL‐1B = interleukin 1β; IL‐5 = interleukin 5; IL‐6 = interleukin 6; IL‐6ST = interleukin 6 signal transducer; IL‐8 = interleukin 8; INPP5D = inositol polyphosphate‐5‐phosphatase; ITGB2 = integrin β2; TGFB1 = transforming growth factor β1; TGFB2 = transforming growth factor β2; TLR4 = toll‐like receptor 4; TLR7 = toll‐like receptor 7; TNF, TNFα = tumor necrosis factor α; TNFRSF1A = TNF receptor superfamily, member 1A; XPNPEP1 = X‐prolyl aminopeptidase (aminopeptidase P) 1.

Samples were analyzed with the double delta cycle threshold (CT) (ΔΔCT) method. Delta CT (ΔCT) values represent normalized target gene levels with respect to the internal controls (GUS‐B and XPNPEP1). These novel reference genes were selected because XPNPEP1 is the most efficient in replicating microarray target gene expression in human post‐mortem brain tissue 2, 23. ΔΔCT values were calculated as the ΔCT of each test sample minus the mean ΔCT of the calibrator samples for each target gene. The fold change was calculated using the equation 2 (−ΔΔCT). Results were analyzed with one‐way analysis of variance (ANOVA) followed by Student's t‐test when required and checked with the Tukey's method. Differences between mean values were considered statistically significant *P < 0.05; **P < 0.01; ***P < 0.001.

ELISA

Seven control samples and seven stage 4 and 5 PD cases from frontal cortex area 8 were used to measure the levels of protein concentration with ELISA. For each essay, we used different Peprotech kits following the instructions provided by the manufacturer: anti‐IL‐6 (human IL‐6, 900‐M16, Mini ELISA Development Kit of Peprotech, London, UK), anti‐IL10 (human IL‐10, 900‐M21, Mini ELISA Development Kit), and anti‐TNF‐α (human TNF‐α, 900‐M25, Mini ELISA Development Kit). These kits of sandwich ELISA format, within the range of 24–1500 pg/mL, recognize natural and/or recombinant IL‐6, IL‐10 and TNF‐α. All the results obtained were analyzed with one‐way ANOVA followed by Student's t‐test when required and checked with the Tukey's method. Differences between mean values were considered statistically significant: P‐values *P < 0.05; **P < 0.01; ***P < 0.001.

Gel electrophoresis and Western blotting

Samples of the frontal cortex area 8 (0.1 g) of 12 controls cases and 12 PD cases were homogenized with a glass homogenizer in Mila lysis buffer (0,5 M Tris at pH 7.4 containing 0.5 M ethylenediaminetetraacetic acid at pH 8.0, 5 M NaCl, 0.5% Na doxicholic, 0.5% Nonidet P‐40, 1 mM phenylmethylsulfonyl fluoride, bi‐distilled water and protease and phosphatase inhibitor cocktails (Roche Molecular Systems, Pleasanton, CA, USA), and then centrifuged at 4°C for 15 minutes at 13 000 rpm (Ultracentrifuge Beckman with 70Ti rotor, CA, USA). Protein concentration was determined with the Bradford method (Merck, Darmstadt, Germany). Samples containing 20 μg of protein were loaded onto 10% acrylamide gels. Proteins were separated in sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) and electrophoretically transferred to nitrocellulose membranes (200 mA/membrane, 20 minutes). Nonspecific bindings were blocked by incubation in 5% albumin in phosphate buffered saline (PBS) containing 0.2% Tween for 1 h at room temperature. After washing, the membranes were incubated at 4°C overnight with one of the following rabbit polyclonal antibodies in PBS containing 5% albumin and 0.2% Tween: anti‐IL‐10 diluted 1:200 (IL‐10, AP52181PU‐N; Acris Antibodies, Herford, Germany), anti‐IκBα diluted 1:1000 (IκBα, 9242; Cell Signalling Technology, Beverly, CA, USA), anti‐IKK‐α (IKK‐α, 2682; Cell Signalling Technology), and anti‐IL‐6 (IL‐6, sc‐7920; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Anti‐β‐actin diluted 1:30 000 (β‐Actin, A5316; Sigma‐Aldrich, St. Louis, MO, USA) was blotted for the control of protein loading. Membranes were then incubated for 1 h with the appropriate HRP conjugated secondary antibody (1:1000, Dako, Glostrup, Denmark), and the immune‐complexes were revealed with a chemiluminescence reagent (ECL, Amersham, GE Healthcare, Buckinghamshire, UK). Densitometry of Western blot bands was assessed with the TotalLab program (TotalLab Quant, Newcastle, UK) and subsequently analyzed with the Tukey's method; differences were considered statistically significant with P‐values: *P < 0.05; **P < 0.01; ***P < 0.001.

Immunohistochemistry

De‐waxed sections of the substantia nigra and frontal cortex of 8 controls and 12 PD cases were stained with hematoxylin and eosin, or processed for immunohistochemistry, following the En Vision+ system method. After incubation with methanol and normal serum, the sections were incubated with one of the primary antibodies overnight at 4°C. Monoclonal antibodies against α‐synuclein (Menarini, Florence, Italy), and clones CD68 and CD20 (Ventana, Roche) were used at a dilution of 1/200 or pre‐diluted, respectively. Rabbit polyclonal antibodies CD8 and CD4 (Ventana, Roche, Basel, Switzerland) were used pre‐diluted as recommended by the supplier. Following incubation with the primary antibody, the sections were incubated with EnVision + system peroxidase (Dako) for 15 minutes at room temperature. The peroxidase reaction was visualized with diaminobenzidine and H2O2. Control of the immunostaining included omission of the primary antibody; no signal was obtained following incubation with only the secondary antibody. Sections were slightly counterstained with hematoxylin. Following incubation with the primary antibody, the sections were incubated with EnVision + system peroxidase (Dako) for 15 minutes at room temperature. The peroxidase reaction was visualized with diaminobenzidine and H2O2. Control of the immunostaining included omission of the primary antibody; no signal was obtained following incubation with only the secondary antibody. Sections were slightly counterstained with hematoxylin.

Cryoprotected sections of the substantia nigra, frontal cortex, and angular gyrus (controls, n = 5; PD cases n = 6 substantia nigra, n = 8 frontal cortex and n = 6 angular gyrus) were processed for free‐floating immunohistochemistry. Rabbit polyclonal antibodies against IL‐10 (AP52181PU‐N, Acris) diluted 1/1000; IL‐5 (IL‐5, ab22448, Abcam, Cambridge, UK) diluted 1/1000; IL‐6 (IL‐6, ab6672, Abcam) diluted 1/100; macrophage CSF [H300; macrophage CSF (M‐CSF), sc13103 Santa Cruz Biotechnology] diluted 1/100; nuclear factor of kappa light polypeptide gene enhancer in B‐cells (NFκB) phosphorylated (3033, Cell Signalling Technology) diluted 1/300; and mouse monoclonal antibodies against TNF‐α (ab1793, Abcam) diluted 1/10, and IL‐17 receptor B (ab13653, Abcam) diluted 1/200 were used. The peroxidase reaction was visualized with diaminobenzidine, NH4NiSO4, and H2O2. The immunoreaction results in a blue‐grey precipitate. This procedure permits the visualization of subtle staining properties often missed by more commonly used protocols. Control of the immunostaining included omission of the primary antibody; no signal was obtained following incubation with only the secondary antibody.

Semi‐quantitative studies of neurons, astrocytes [as stained with glial fibrillary acidic protein (GFAP) antibodies], microglia (as recognized with CD68 antibodies) and CD8 T lymphocytes were carried out in the substantia nigra pars compacta, putamen, frontal cortex area 8 and angular gyrus at PD stages 3–4 and 5–6, and controls. For the substantia nigra, all neurons in a given section were counted in every case, whereas for the putamen, frontal cortex and angular cortex, counts were made on three different fields per section and case at a magnification of ×200. The average number of a defined cell type in control cases was considered 100, and the decrease or increase compared with the control values was expressed as a percentage of increase or lost. Lymphocytes in the brain parenchyma were counted as present or absent because no lymphocytes were found in control cases.

α‐Synuclein solubility and aggregation

Brain samples (0.1 g) of substantia nigra pars compacta and frontal cortex area 8 from controls (n = 3 per group) and PD cases stage 5 (n = 3 per group) were homogenized in a glass homogenizer, in 750 μL of ice‐cold PBS+ (sodium phosphate buffer pH 7.0, plus protease inhibitors), sonicated, and centrifuged at 5200 rpm at 4°C for 10‐minutes. The pellet was discarded and the resulting supernatant was ultra‐centrifuged at 43 000 rpm at 4°C for 1 h. The supernatant (S2) was kept as the PBS‐soluble fraction. The resulting pellet was re‐suspended in a solution of PBS, pH 7.0, containing 0.5% sodium deoxycholate, 1% Triton, and 0.1% SDS, and this was ultra‐centrifuged at 43 000 × rpm at 4°C for 1 h. The resulting supernatant (S3) was kept as the deoxycholate‐soluble fraction. The corresponding pellet was re‐suspended in a solution of 2% SDS in PBS and maintained at room temperature for 30‐minute. Immediately afterward, the samples were centrifuged at 43 000 rpm at 25°C for 1 h and the resulting supernatant (S4) was the SDS‐soluble fraction. Equal amounts of each fraction were mixed with reducing sample buffer and processed in parallel for 10% SDS‐PAGE and Western blotting. Membranes were incubated with anti‐α‐synuclein (Chemicon, Temecula, CA, USA) at a dilution of 1:30 00. The protein bands were visualized with the ECL method (Amersham).

Results

mRNA expression of cytokines and mediators of the immune response in the substantia nigra, putamen, frontal cortex and angular cortex in PD

Analyzed mRNAs

Twenty‐five mRNAs were assessed in the present study including members of the complement system [complement component 1, q subcomponent‐like 1 (C1QL1), C1q and tumor necrosis factor related protein 7 (C1QTNF7), complement component 3a receptor 1 (C3AR1) ], CSFs [cytochrome b‐245, α polypeptide (CYBA), cystatin F (leukocystatin) (CST7), INPP5D inositol polyphosphate‐5‐phosphatase, CSF 1 receptor and CSF 3 receptor (CSF3R) ], Toll family [Toll‐like receptors (TLR) 4, TLR7], cytokines IL‐8, IL‐6, IL‐6 signal transducer (IL‐6ST), IL‐1B, TNF‐α family (TNF receptor superfamily, member 1A and TNF), IL‐10 [IL‐10, IL‐10 receptor α (IL‐10RA), IL‐10 receptor β (IL‐10RB) ], transforming growth factor (TGF) β family (TGFβ1, TGFβ2), cathepsins S (CTSS) and cathepsin C (CTSC) and integrin family [C‐type lectin domain family 7, member A (CLEC7A), integrin β2 (ITGB2) ]. Similar results were obtained using two different housekeeping genes: GUS‐B and XPNPEP1. mRNA expression was examined in the substantia nigra pars compacta, putamen, frontal cortex area 8, and angular cortex, in 39 PD samples Braak stages 3–6 with no distinction between cases with and without clinical signs of parkinsonism, compared with corresponding regional controls.

Substantia nigra pars compacta

Down‐regulation of C1QL1, C1QTNF7, C3AR1, TLR7, IL‐1B, IL‐6, IL‐6ST, TNF‐α, IL‐10, IL‐10RB, TGFB2 and CTSC mRNAs was found in the substantia nigra at Braak stages 3–6 whereas no modifications were found in the mRNA expression levels of the remaining cytokines and related molecules. Interestingly, not a single gene was up‐regulated in the series examined (Table 3).

Table 3.

Regional differences in mRNA expression levels of cytokines and mediators of the immune response in Parkinson's disease

Substantia nigra Frontal cortex area 8 Angular gyrus Putamen
C PD C PD C PD C PD
Complement system C1QL1 0.73 ± 0.33 0.38 ± 0.22** 0.98 ± 0.56 0.80 ± 0.47 1.04 ± 0.31 1.02 ± 0.23 1.06 ± 0.38 1.04 ± 0.33
C1QTNF7 1.16 ± 0.82 0.50 ± 0.54* 1.06 ± 0.72 1.33 ± 0.96 1.05 ± 0.36 0.86 ± 0.44 1.03 ± 0.25 1.33 ± 0.16*
C3AR1 0.69 ± 0.26 0.37 ± 0.11** 1.06 ± 0.57 1.13 ± 0.90 1.12 ± 0.52 1.61 ± 0.52* 1.06 ± 0.37 0.67 ± 0.26*
Colony stimulating factors CYBA 0.90 ± 035 0.96 ± 0.39 1.00 ± 0.66 1.74 ± 0.86* 1.17 ± 0.62 1.49 ± 0.66 1.10 ± 0.44 1.45 ± 0.47
CST7 0.99 ± 0.62 0.45 ± 029* 0.99 ± 0.65 1.14 ± 0.79 0.67 ± 0.32 1.54 ± 0.92* 1.15 ± 0.66 1.62 ± 0.83
INPP5D 1.07 ± 0.44 0.82 ± 0.35 1.05 ± 0.30 1.25 ± 0.48 1.20 ± 0.21 1.14 ± 0.30 1.01 ± 0.15 1.14 ± 0.37
CSF1R 1.01 ± 0.38 0.67 ± 0.46 1.07 ± 0.37 1.06 ± 0.32 1.10 ± 0.47 1.36 ± 0.38 0.93 ± 0.17 1.07 ± 0.24
CSF3R 1.19 ± 0.39 0.86 ± 0.49 1.16 ± 0.66 0.78 ± 0.46* 0.85 ± 0.32 1.57 ± 0.72* 1.04 ± 031 1.26 ± 0.57
Toll‐like receptors TLR4 1.01 ± 0.37 1.10 ± 0.61 1.22 ± 0.70 0.69 ± 0.52* 1.04 ± 0.29 0.91 ± 0.39 1.09 ± 0.46 0.76 ± 0.31
TLR7 0.96 ± 0.34 0.48 ± 0.22*** 1.03 ± 0.48 1.03 ± 0.68 1.25 ± 075 1.54 ± 0.43 1.05 ± 0.36 0.69 ± 0.23*
Cytokines IL‐8 0.53 ± 0.33 0.51 ± 0.53 0.93 ± 0.75 1.06 ± 0.91 1.29 ± 0.92 0.79 ± 0.55 0.97 ± 0.79 1.29 ± 0.54
IL‐1B 1.38 ± 1.13 0.59 ± 0.50* 0.78 ± 0.70 0.69 ± 0.60 1.17 ± 1.07 1.75 ± 1.34 0.89 ± 0.33 0.65 ± 0.44
IL‐6 0.75 ± 0.38 0.32 ± 0.28** 1.09 ± 0.74 1.56 ± 0.92 1.10 ± 0.83 1.10 ± 0.79 0.86 ± 0.44 1.25 ± 0.76
IL‐6ST 1.07 ± 0.44 0.66 ± 0.30* 1.01 ± 0.35 1.22 ± 0.69 1.02 ± 0.20 1.03 ± 0.19 1.03 ± 0.25 1.07 ± 0.27
TNF family TNF‐α 1.11 ± 0.48 0.32 ± 0.22*** 0.87 ± 0.44 0.87 ± 0.64 1.07 ± 0.28 1.52 ± 1.11 1.22 ± 0.85 0.51 ± 0.19*
TNFRS1A 0.80 ± 0.64 0.62 ± 0.16 1.02 ± 0.50 1.03 ± 0.71 1.11 ± 0.47 1.25 ± 0.57 1.04 ± 0.29 1.02 ± 0.16
IL‐10 family IL‐10 1.13 ± 0.51 0.59 ± 0.37** 1.24 ± 0.72 1.02 ± 0.44 1.37 ± 1.04 1.57 ± 0.92 1.04 ± 0.31 0.93 ± 0.30
IL‐10RA 0.87 ± 0.46 0.73 ± 0.42 0.67 ± 0.17 1.60 ± 1.11** 1.08 ± 0.38 1.58 ± 0.57* 1.02 ± 0.25 1.78 ± 0.92*
IL‐10RB 1.03 ± 0.20 0.77 ± 0.27* 1.08 ± 0.68 1.23 ± 0.58 1.06 ± 0.38 1.10 ± 0.25 1.02 ± 0.22 1.02 ± 0.23
TGF‐β TGFB1 1.10 ± 0.54 0.72 ± 0.32 1.01 ± 0.38 1.07 ± 0.48 1.02 ± 0.24 1.26 ± 0.33 1.01 ± 0.17 0.90 ± 0.39
TGFB2 1.00 ± 0.52 0.55 ± 0.25* 1.12 ± 0.73 0.99 ± 0.64 1.01 ± 0.47 1.01 ± 0.30 1.15 ± 0.42 1.13 ± 0.17
Cathepsins CTSS 1.04 ± 0.30 0.84 ± 0.57 0.97 ± 0.47 1.41 ± 0.66* 1.13 ± 0.52 1.38 ± 0.61 1.06 ± 0.37 0.88 ± 0.48
CTSC 0.98 ± 0.33 0.54 ± 0.35** 0.99 ± 0.52 1.13 ± 0.55 1.11 ± 0.48 1.72 ± 0.84 1.04 ± 0.29 1.18 ± 0.67
Integrins CLEC7A 0.95 ± 0.30 0.66 ± 0.43 0.96 ± 0.29 1.75 ± 0.96** 0.81 ± 0.47 0.70 ± 0.33 1.04 ± 0.31 1.26 ± 0.57
ITGB2 1.01 ± 0.42 1.01 ± 0.53 1.16 ± 0.62 1.36 ± 0.60 1.18 ± 0.65 1.95 ± 0.97* 1.04 ± 0.31 0.97 ± 0.56
Open in a new tab

mRNA expression levels of selected genes of complement system (C1QL1, C1QTNF7, C3AR1), colony stimulation factors [(CSF1R, CSF3R, CYBA, CS7, INPP5D inositol polyphosphate‐5‐phosphatase (INPP5D)], TLRs (TLR4, TLR7), IL‐8, pro‐inflammatory cytokines (IL‐6, IL‐6ST, IL‐1B), TNF‐α family (TNFRS1A, TNF‐α), IL‐10 family (IL‐10, IL‐10RA, IL‐10RB), TGF‐β family (TGFB1, TGFB2), cathepsins (CTSS, CTSC), and integrin family (CLEC7A, ITGB2) in the substantia nigra pars compacta, frontal cortex area 8 and angular gyrus in Parkinson's disease (PD) cases stages 3–5 and age‐matched controls (C), analyzed with TaqMan PCR assays. One‐way analysis of variance followed by Student's t‐test when required and checked with the Tukey's method. Differences between mean values were considered statistically significant *P < 0.05; **P < 0.01; ***P < 0.001. For the meaning of the abbreviations, please refer to Tables 1 and 2 footnotes.

We also analyzed mRNA expression of cytokines and mediators of the immune response in the substantia nigra at stages 1 and 2 of Braak—that is before the appearance of any deposition of α‐synuclein in the substantia nigra pars compacta, but with variable deposits in the motor nucleus of the vagus nerve and locus coeruleus. The number of samples was limited to four PD cases and six age‐matched controls. Only IL‐6ST was significantly up‐regulated (P > 0.05) in PD whereas no differences in the expression of the other genes were observed between control and PD cases.

Putamen

Down‐regulation of C3AR1, TLR7, and TNF‐α, and up‐regulation of C1QTNF7 and IL‐10RA were observed in the putamen (Table 3).

Frontal cortex and angular gyrus

Down‐regulation of CSF3R and TLR4 mRNAs, and up‐regulation of CTSS, CYBA, IL‐10RA and CLEC7A mRNAs were observed in the frontal cortex area 8, whereas no modifications in gene expression were noted in the rest of the mRNAs assessed albeit with a trend of up‐regulation of IL‐6 (Table 3).

Up‐regulation of C3AR1, CST7, CSF3R, IL‐10RA and ITGB2 mRNAs was found in the angular cortex (area 39) in PD cases. Other genes had expression levels similar to controls, and none of them was down‐regulated (Table 3).

Then we analyzed whether differences were seen in frontal cortex area 8 in cases with incidental PD stages 3 and 4 (n = 5) and cases with PD and parkinsonism stages 4 and 5 (n = 20). No significant differences were found between the two groups (data not shown) thus suggesting that inflammatory changes in the frontal cortex were not modified with disease progression or that treatment of parkinsonism stabilized inflammatory responses in the frontal cortex.

Finally, no differences between cases with (n = 6) and without dementia (n = 4) were seen in the angular cortex, the only region tested because of the small number of samples covering both conditions.

ELISA in frontal cortex

A limited study of proteins was performed to correlate the modifications observed in mRNA expression with protein levels. A significant increase in IL‐6 protein expression levels (***P < 0.001 Tukey's method) was seen in the frontal cortex area 8 in PD cases (n = 7, stages 4 and 5) compared with controls (n = 7), whereas a slight significant reduction of IL‐10 (*P < 0.05 Tukey's method) occurred in PD. TNF‐α protein levels did not differ in PD cases from controls (Figure 1A).

Figure 1.

figure

Open in a new tab

A. Protein expression levels of interleukins (IL)‐6, IL‐10 and tumor necrosis factor (TNF)‐α, as revealed by enzyme‐linked immunosorbent assay (ELISA), in the frontal cortex area 8 in control and Parkinson's disease (PD) cases. IL‐10 is down‐regulated whereas IL‐6 is up‐regulated. No significant differences are seen in TNF‐α expression levels between control and PD cases. Significant differences are seen using the Tukey's method; P‐value: *P < 0.05; **P < 0.01; ***P < 0.001. B. Protein expression levels, as revealed with Western blotting, of IL‐6, IL‐10, IKBα and IKK‐α corrected with β‐actin measured by Total Lab (1D Gel analysis) and analyzed with the Tukey's method; P < 0.05; **P < 0.01; ***P < 0.001. Only IL‐6 expression levels are significantly increased in frontal cortex.

Western blotting

Protein expression levels of IL‐6, IL‐10, IκBα (inhibitor of nuclear factor‐kappa‐B subunit alpha) and IKK‐α (inhibitor of nuclear factor kappa‐B kinase subunit alpha) using Western blotting, all of them corrected by β‐actin, measured with Total Lab (1D Gel analysis) and subsequently analyzed with the Tukey's method, revealed significant increments of IL‐6 (P < 0.001) in the frontal cortex area 8 in PD cases (n = 12) compared with controls (n = 12). No differences were observed regarding expression levels of IL‐10, IκBα and IKK‐α (Figure 1B).

Immunohistochemistry

Increased numbers of ramified and amoeboid microglial cells were observed in the substantia nigra in PD cases, with the number of amoeboid microglial cells correlating with neuron loss and debris accumulation. This was accompanied by increased numbers of astrocytes in the substantia nigra pars compacta correlating with dopaminergic neuron loss. A slight increase in microglial cells, most of them ramified, and slight increase in astrocytes occurred in the putamen and cerebral cortex.

Microglia and macrophages with neuromelanin were present in the substantia nigra pars compacta from stage 3 onward. Lesser amounts of CD68‐immunoreactive microglia were observed in the frontal cortex at early and advanced stages of PD. A few lymphocytes expressing CD8 were found in the substantia nigra from stage 3 onward but they were extremely rare or most often absent in the cerebral cortex at all stages of PD (Figure 2). Only a few CD4+ and no CD20+ lymphocytes were seen at any time. A semi‐quantitative study of neurons, astrocytes, microglia and T lymphocytes in the different regions is shown in Table 4.

Figure 2.

figure

Open in a new tab

Immunohistochemistry of α‐synuclein (A, D, G), CD68 (B, E, H, I), and CD8 (C and F) in the substantia nigra stage 3 (A–C), stage 5 (D–F), frontal cortex stage 5 (G, H), and stage 3 (i). A, D, G. α‐synuclein decorates Lewy bodies and neurites in the substantia nigra and frontal cortex; CD68 is found in microglia and macrophages in the substantia nigra B, E. and frontal cortex at stages with H and without I concomitant Lewy bodies. Lymphocytes C8 are found in the substantia nigra pars compacta at early C and late stages F of PD. Paraffin sections, visualized with diaminobenzidine and H2O2 with hematoxylin counterstaining. Neuromelanin is distinguished by the moderately dense accumulation of regular granules in contrast to 3, 3'‐diaminobenzidine (DAB)‐positive inclusions, which are darker and commonly homogeneous, as seen in B, C, D and F; however, differences are more subtle regarding fine granular α‐synuclein inclusions in addition to Lewy bodies, that may deposit together with neuromelanion as seen in A and B. Bar = 25 μm.

Table 4.

Semi‐quantitative values of neurons, astrocytes, microglia and CD8 T lymphocytes in the substantia nigra pars compacta, putamen, frontal cortex area 8 and angular gyrus at stages 3–4 and 5–6 of Braak

Region Braak stages Neurons Astrocytes Microglia CD8 T
Substantia nigra 3–4 – – * * * * +
5–6 – – – * * * * +
Putamen 3–4 = = * 0
5–6 = * * 0
Frontal cortex area 8 3–4 = = = 0
5–6 = * * 0
Angular gyrus 3–4 = = = 0
5–6 – * * 0
Open in a new tab

Loss of neurons in the substantia nigra and cortex is represented as follows: – less than 20%; – – between 40% and 60%, and – – – more than 50% neuron loss compared with controls. Increased numbers of astrocytes, as revealed with GFAP immunostaining, and microglia, as revealed by CD68 immunoreactivity, are represented as follows: * between 10% and 20%; * * more than 20% when compared with controls. Presence or absence of CD8 lymphocytes is represented as + and 0, respectively. Lack of differences between control and diseased cases is marked as =. No attempts to discriminate between iPD and PD, and PD and PDD were made. iPD = incidental Parkinson's disease (no clinical history of parkinsonism); PD = clinical manifestation of parkinsonism; PDD = PD plus dementia.

The study with immunohistochemistry of cytokines and mediators of the immune response in substantia nigra and frontal cortex was limited to ILs IL‐5, IL‐6, IL‐10; IL‐17 receptor; M‐CSF; phosphorylated (active) NFκB; and TNF‐α. IL‐5, IL‐6 and IL‐17 receptor were expressed in glial cells, mainly microglia, whereas IL‐5, IL‐10, M‐CSF and TNF‐α were expressed in neurons; TNF‐α was expressed in neurons and microglia. Active NFκB was found in the nucleus of subpopulations of neurons and glial cells mainly in substantia nigra and less frequently in putamen and cerebral cortex (Figure 3).

Figure 3.

figure

Open in a new tab

Immunohistochemistry of interleukins (IL)‐5 (A, B), IL‐6 (C), IL‐10 (D), IL‐17R (E), M‐CSF (F) NFκB phosphorylated (G, H), and TNF‐α (I) in the substantia nigra pars compacta (A, D–I) in PD stages 3–4, and frontal cortex (B, C) in PD staged 4–5. A. IL‐5 immunoreactivity is seen in neurons (arrows) and astrocytes (arrowhead); and B. in astrocytes in the subcortical white matter (arrows); C. IL‐6 is mainly expressed in astrocytes (arrows); D. IL‐10 immunoreactivity occurs in neurons (arrowheads) and in beaded cell processes (arrows) in the substantia nigra; E. IL‐17 receptor is expressed in glial cells (probably microglia); F. Macrophage colony stimulating factor (M‐CSF) is expressed in neurons; whereas G, H. phosphorylated (active) NFκB immunoreactivity is found in the nucleus of neurons (arrows) and glial cells (arrowheads); I. weak TNF‐α immunoreactivity is found in neurons. Cryostat sections processed free‐floating visualized with diaminobenzidine, NH4NiSO4, and H2O2 without haematoxylin counterstaining. A, D, F–I, bar in I = 25 μm; B, C, E, bar in E = 10 μm.

α‐Synuclein solubility and aggregation

α‐Synuclein solubility and aggregation were assessed in samples of the substantia nigra pars compacta and frontal cortex area 8 in cytosolic, deoxycholate and SDS fractions. In the substantia nigra, a band of α‐synuclein at the expected molecular weight (about 20 kDa) was observed in control and PD cases in the cytosolic, deoxycholate and SDS fractions. α‐Synuclein bands of variable molecular weight (between 40 and 80 kDa) were observed in deoxycholate fractions in control and PD cases, but multiple bands between 40 and 80 kD were only found in PD. Altered α‐synuclein solubility and aggregation was also seen in the frontal cortex with increased numbers of bands between 50 and 100 kDa in SDS fractions from PD cases (Figure 4). It is worth stressing that the patterns, and more importantly, the exposure time to reveal the bands of high molecular weight corresponding to α‐synuclein aggregates differed in the substantia nigra and frontal cortex in samples run in parallel under the same conditions. α‐synuclein aggregates were clearly identified after 1 min of exposure in samples of the substantia nigra whereas α‐synuclein aggregates were only seen after 10 minutes of exposure, accompanied by a grey background, in frontal cortex samples.

Figure 4.

figure

Open in a new tab

Representative figure of α‐synuclein solubility and aggregation in the substantia nigra (SN) and frontal cortex area 8 (FC) in Parkinson's disease (PD) stage 4 and age‐matched control (C). Cyt, cytosolic fraction, DXC, deoxycholate‐soluble fraction, SDS: SDS‐soluble fraction. α‐synuclein at the appropriate molecular weight (about 20 kDa) is observed at 30″ of exposure of the membrane in the substantia nigra and frontal cortex in control and diseased samples in all the fractions. Altered solubility and presence of multiple bands of aggregated α‐synuclein of molecular masses between 40 and 80 kDa are seen in PD  substantia nigra when compared with substantia nigra in control after 1‐minute of exposure. A different pattern of α‐synuclein solubility and aggregation is seen in the frontal cortex in PD when compared with control. Note that the exposure time needed to visualize the bands is greater (10‐minute) in the frontal cortex than in the substantia nigra under exactly the same protein loading conditions.

Discussion

The study was designed to compare and evaluate the expression of several cytokines and mediators of the immune response in different brain regions at progressive stages of PD. The selection of molecules was performed taking into consideration to include members of the complement system, CSFs, pro‐ and anti‐inflammatory cytokines, TGF‐β, cathepsins and integrins which have been found abnormally regulated in the cerebral cortex in a parallel study in progress of Alzheimer's disease. Therefore, the study of the same molecules will serve, not only to increase understanding about neuroinflammation in PD but also to compare disease‐dependent, region‐dependent and stage‐dependent neuroinflammatory responses in selected neurodegenerative diseases in the near future. Regarding the choice of regions in the present study, the substantia nigra and the putamen are obliged areas because they are primary substrates of parkinsonism 22. The study of the cerebral cortex is due to its involvement in PD even at early stages of the neurodegenerative process 25, 26. The selection of the frontal cortex area 8 and angular gyrus is based on neuroimaging observations showing that these areas are particularly vulnerable to PD 13, 87.

The present findings showing increased microglia and macrophages, and T lymphocytes in the substantia nigra, and increased microglia in the cerebral cortex, are in line with previous observations in PD, and they further support neuroinflammation in the pathogenesis of PD. Deregulation of several genes involved in the inflammatory and immune responses has also been demonstrated by using quantitative reverse transcription‐polymerase chain reaction (RT‐PCR). However, the diversity of inflammatory responses in the substantia nigra pars compacta, putamen, and cortical regions frontal cortex area 8 and angular gyrus at the same stages of disease progression reveals a new scenario that is more complex than formerly envisaged.

Increased IL‐6st mRNA expression has been observed at early stages of PD‐related pathology (stages 1–2 of Braak). Yet mRNA expression levels of several mediators of inflammation and immune response are significantly decreased in the substantia nigra at stages 3–5 of Braak; these include members of the complement system C1QL1, C1QTNF7 and C3AR1; TLR7; IL‐1B, IL‐6, IL‐6ST, TNF‐α; IL‐10; IL‐10β; TGFβ2; and cathepsin C when compared with age‐matched controls. This contrasts with previous observations reporting up‐regulation of pro‐inflammatory cytokines such as IL‐1β in the substantia nigra pars compacta in PD 71, 72. Down‐regulation of C3AR1, TLR7 and TNF‐α, and up‐regulation of C1QTNF7 and IL‐RA have been observed in the putamen at stages 5 and 6, which does not match with the transient profile of increased mRNA expression of inflammatory mediators in the striatum of mice following administration of 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) 68. Yet chronic responses in the putamen in PD cases are barely comparable with acute changes in the striatum of mice following MPTP administration.

In contrast, down‐regulation of CSF3R and TLR4 mRNAs, together with up‐regulation of CTSS, CYBA, IL‐10RA, and CLEC7A mRNAs, is found in the frontal cortex. Finally, up‐regulation of C3AR1, CST7, CSF3R, IL‐10RA, and ITGB2 mRNAs without accompanying modifications in the expression of genes which were down‐regulated in other brain regions occurs in the angular gyrus area 39.

Taken together, the results of the study of the mRNA expression profile of cytokines and mediators of the immune response in PD reveal marked regional variations, with expression levels markedly reduced in the substantia nigra pars compacta, variably down‐regulated or up‐regulated in the putamen and frontal cortex area 8, and up‐regulated in the angular gyrus.

Interestingly mRNA and protein expression did not correlate, at least in the frontal region—the only one examined for mRNA and protein. ELISA and Western blotting showed a marked increase in IL‐6 protein expression in PD, whereas IL‐10 was reduced with ELISA, but not with Western blots. TNF‐α, IκBα, and IKK‐α protein levels did not differ in PD from controls.

Finally, immunohistochemistry reveals the presence of IL‐5, IL‐6, IL‐10; IL‐17 receptor; M‐CSF and TNF‐α protein expression in the PD substantia nigra and frontal cortex cytokines and mediators of the immune response are localized in neurons, astrocytes and microglia. Interleukines IL‐5, IL‐6, IL‐17 receptor, and TNF‐α are expressed in glial cells, mainly microglia, whereas IL‐5, IL‐10, M‐CSF, and TNF‐α are expressed in neurons. Active NFκB is localized in the nucleus of subpopulations of neurons and glial cells mainly in substantia nigra and less frequently in putamen and cerebral cortex. These findings confirm and expand previous information describing the localization of cytokines and mediators of the immune response, including nuclear translocation of NF‐κB in the substantia nigra in PD 39, 45, 63. The presence of isolated lymphocytes in the substantia nigra in PD here observed is also in line with previous observations 7, 54, 58, 71.

Differences in mRNA levels as revealed by qRT‐PCR and protein expression as seen with immunohistochemistry is particularly notorious in the substantia nigra. Down‐regulation of the majority of genes is accompanied by increased expression of cytokine and mediators of the immune response in subpopulations of neurons, microglia and astrocytes, thus indicating a complex modulation of neuroinflammation in the substantia nigra in PD.

An important difficulty in the study of putative signaling in the human brain under physiological and pathological conditions is the information about dynamics and mechanistic aspects. Therefore, the significance of the complex scenario of neuroinflammation in PD still remains elusive. For example, IL‐6 in the nervous system acts mainly as a neurotrophic factor in normal conditions and in several experimental models, although it can also play a role as a pro‐inflammatory cytokine 24. It may be speculated that the trend of increased IL‐6 mRNA in frontal cortex, accompanied by a significant increase in IL‐6 protein as revealed by ELISA and Western blotting, is consistent with a protective role of this IL in PD progression, but the opposite is also a possibility depending on the region and the accompanying responses. As another example, in spite of the reduced IL‐1β mRNA expression here observed and the presumed lower levels of the encoded protein, phosphorylated (active) NFκB is found in the nucleus of several neurons and glial cells in the substantia nigra pars compacta in PD at stages 3–5 of Braak, thus indicating that NFκB can play a role in neuroinflammation in the substantia nigra in PD 84. However, NFκB is regulated by oxidative stress 61, and reactive oxygen species may activate or inhibit NF‐κB activity 70. It has been reported that inhibition of NFκB activity by injection of modifier‐binding domain of IκB kinase α (IKKα) or IKKβ promotes cell survival in MPTP‐induced dopaminergic cell death in mice 31; however, we cannot merely translate observations in an acute model to those that work in a chronic state such as PD.

The reasons for increased neuroinflammatory responses in PD are not known, but it has been shown that regional‐specific microglial activation together with increased levels of Tnf‐α mRNA, but not of Il‐1β, Tgf‐β, and certain toll‐like receptors, occurs in the substantia nigra but not in the cerebral cortex in young mice overexpressing human wild‐type α‐synuclein 90. This is in line with pioneering studies showing that α‐synuclein extracellular aggregates activate microglia in primary mesencephalic neuron‐glia culture system and that microglial activation increases dopaminergic neurodegeneration induced by aggregated α‐synuclein 94. Astrocytes are also stimulated by α‐synuclein in vitro 47. The present studies in human brains have shown a relationship between the presence of Lewy bodies and neurites, α‐synuclein aggregates of variable solubility, astrocyte and microglial proliferation, and deregulated mRNA expression of cytokines and mediators of the immune response in the substantia nigra in PD. Microglial and astrocytic responses are much more limited in the putamen, frontal cortex and angular gyrus in PD in parallel with the absence of Lewy bodies and the lower formation of α‐synuclein aggregates in these regions when compared with the substantia nigra at similar Braak stages. Therefore, the present findings support the idea that altered α‐synuclein including nitrated α‐synuclein can trigger neuroinflammation in PD 4. However, it is clear from the present data that α‐synuclein cannot be considered simply as an activator of cytokine expression in PD, as the region with largest numbers of Lewy bodies and abnormal α‐synuclein aggregates (i.e. substantia nigra pars compacta) has the lowest up‐regulation of cytokines and immune response mediators when compared with other brain regions (putamen, frontal cortex area 8, and angular gyrus).

Other factors that can activate neuroinflammation in PD are related to the production of reactive oxygen and nitrogen species by neurons. Studies in the substantia nigra in PD have shown decreased levels of reduced glutathione 69, 82, 93, increased Cu/Zn‐superoxide dismutase I (SOD1), and Mn‐superoxide dismutase (SOD2) protein and mRNA levels 11, 52, 76; and increased levels of protein carbonyls 1, 28, lipid hydroperoxides 19, 43, 4‐hydroxy‐2‐nonenal 81, 92, as well as advanced glycation end products 10. Reduced gluthatione levels are decreased in the substantia nigra in cases with incidental PD 20, 42 indicating that alterations in glutathione function in the substantia nigra are an early marker of nigral pathology in PD 20, 44, 93. Oxidative damage in the substantia nigra and proteins related to oxidative stress responses are already present at stages 2 and 3 of Braak 18, 28. Lipoxidative damage of α‐synuclein is found in incidental PD 18. Oxidative damage of DNA and RNA has also been reported in PD 27, 29, 65, 80.

Oxidative damage is not restricted to the substantia nigra in PD. Increased oxidative damage and increased expression of advanced glycation end products have been observed in the amygdala and cerebral cortex in incidental PD, and in parkinsonian stages of PD without cognitive impairment 18, 25, 28. Redox proteomics has been useful in identifying protein targets of oxidative damage in PD 51. In addition to α‐synuclein 17, several key proteins have been identified as targets of oxidative damage including β‐synuclein and SOD2 17, 18, 25, UCHL1, SOD1 and DJ‐1 14, 15, 16, and aldolase A, enolase 1 and glyceraldehyde dehydrogenase, all of them involved in glycolysis and energy metabolism 32 in the frontal cortex in pre‐motor stages of PD and in established PD. Other proteins have also been identified as lipoxidatively damaged using the malonaldehyde‐Lysine marker: phosphoprotein enriched in astrocytes, SH3 domain binding glutamic acid‐rich protein‐like, ubiquitin‐conjugating enzyme E2N‐like, proteasome subunit Y, and thioredoxin 26.

Together, available information shows that altered α‐synuclein solubility and aggregation, and Lewy body formation, oxidative damage, and neuroinflammation converge in the pathogenesis of PD, but it is difficult to reconcile a simple scenario of direct cause–effect mechanisms. Regarding neuroinflammation, the present findings have important implications not only in the pathogenesis, but also in the therapeutics of PD, as neuroinflammation involves pro‐ and anti‐inflammatory cytokines, and variegated mediators of the immune response which, at least in the immune system, have distinct often opposing functions. Moreover, neuroinflammatory responses are subject to regional variations at the same stages of PD‐related pathology, implying that distinct inflammatory responses occur in different brain regions at the same time in a particular individual.

Concluding comments

The added value of the present comprehensive study using complementary methods and different brain regions in a large series of PD cases when compared with previous studies can be summarized as follows: (i) genes encoding cytokines and mediators of the immune response are markedly deregulated in PD; (ii) deregulation is subject to regional differences, certain genes being oppositely regulated in the substantia nigra and cerebral cortex at the same PD stages; (iii) the majority of analyzed genes are down‐regulated in the substantia nigra from stage 4 onward; (iv) mRNA gene expression levels do not always correlate with protein expression levels, suggesting that altered gene regulation is accompanied by modified protein expression either because of altered translation or modified protein degradation; (v) immunohistochemistry localizes intrinsic neuroinflammatory responses either in neurons and glial cells, or in both, mainly in neurons and microglia; (vi) particular protein expression in neurons and in glial cells suggests intrinsic neuroinflammatory cross‐information among neurons, astrocytes, and microglia in PD with limited participation of the peripheral immune system excepting the scant infiltration of isolated lymphocytes in the substantia nigra; (vii) in line with the previous point, neurons may be considered as active trigger agents of neuroinflammation in PD expressing certain cytokines and mediators of the immune response. Available information shows that altered α‐synuclein solubility and aggregation; and (viii) Lewy body formation, oxidative damage, and neuroinflammation converge in the pathogenesis of PD.

Acknowledgments

This study was funded by the Seventh Framework Programme of the European Commission, grant agreement 278486: DEVELAGE and by the Institute Carlos III, FIS grant PI1100968. We thank T. Yohannan for editorial help.

References

  • 1. Alam ZI, Daniel SE, Lees AJ, Marsden DC, Jenner P, Halliwell B (1997) A generalized increase in protein carbonyls in the brain in Parkinson's disease but not in incidental Lewy Body disease. J Neurochem 69:1326–1329. [DOI] [PubMed] [Google Scholar]
  • 2. Barrachina M, Castaño E, Ferrer I (2006) TaqMan PCR assay in the control of RNA normalization in human post‐mortem brain tissue. Neurochem Int 49:276–284. [DOI] [PubMed] [Google Scholar]
  • 3. Bessler H, Djaldetti R, Salman H, Bergman M, Djaldetti M (1999) IL‐1 beta, IL‐2, IL‐6 and TNF‐alpha production by peripheral blood mononuclear cells from patients with Parkinson's disease. Biomed Pharmacother 53:141–145. [DOI] [PubMed] [Google Scholar]
  • 4. Block ML, Hong JS (2005) Microglia and inflammation‐mediated neurodegeneration: multiple triggers with a common mechanism. Prog Neurobiol 76:77–98. [DOI] [PubMed] [Google Scholar]
  • 5. Blum‐Degen D, Muller T, Kuhn W, Gerlach M, Przuntek H, Riederer P (1995) Interleukin‐1 beta and interleukin‐6 are elevated in the cerebrospinal fluid of Alzheimer's and de novo Parkinson's disease patients. Neurosci Lett 202:17–20. [DOI] [PubMed] [Google Scholar]
  • 6. Braak H, del Tredici K, Rüb U, de Vos RAI, Jansen Steur ENH, Braak E (2003) Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol Aging 24:197–211. [DOI] [PubMed] [Google Scholar]
  • 7. Brochard V, Combadière B, Prigent A, Laouar Y, Perrin A, Beray‐Berthat V et al (2009) Infiltration of CD4+ lymphocytes into the brain contributes to neurodegeneration in a mouse model of Parkinson disease. J Clin Invest 119:182–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Brodacki B, Staszewski J, Toczyłowska B, Kozłowska E, Drela N, Chalimoniuk M, Stepien A (2008) Serum interleukin (IL‐2, IL‐10, IL‐6, IL‐4), TNFalpha, and INFgamma concentrations are elevated in patients with atypical and idiopathic parkinsonism. Neurosci Lett 441:158–162. [DOI] [PubMed] [Google Scholar]
  • 9. Brooks DJ (2010) Imaging approaches to Parkinson disease. J Nucl Med 51:596–609. [DOI] [PubMed] [Google Scholar]
  • 10. Castellani R, Smith MA, Richey PL, Perry G (1996) Glycoxidation and oxidative stress in Parkinson's disease and diffuse Lewy body disease. Brain Res 737:195–200. [DOI] [PubMed] [Google Scholar]
  • 11. Ceballos I, Lafon M, Javoy‐Agid F, Hirsch E, Nicole A, Sinet PM et al (1990) Superoxide dismutase and Parkinson's disease. Lancet 335:1035–1036. [DOI] [PubMed] [Google Scholar]
  • 12. Chen H, O'Reilly EJ, Schwarzchild MA, Adscherio A (2008) Peripheral inflammatory biomarkers and risk of Parkinson's disease. Am J Epidemiol 167:90–95. [DOI] [PubMed] [Google Scholar]
  • 13. Choe IH, Yeo S, Chung KC, Kim SH, Lim S (2013) Decreased and increased cerebral regional homogeneity in early Parkinson's disease. Brain Res 1527:230–237. [DOI] [PubMed] [Google Scholar]
  • 14. Choi J, Levey AI, Weintraub ST, Rees HD, Gearing M, Chin LS et al (2004) Oxidative modifications and down‐regulation of ubiquitin carboxyl‐terminal hydrolase L1 associated with idiopathic Parkinson's and Alzheimer's disease. J Biol Chem 279:13256–13264. [DOI] [PubMed] [Google Scholar]
  • 15. Choi J, Rees HD, Weintraub ST, Levey AI, Chin LS, Li L (2005) Oxidative modifications and aggregation of Cu,Zn‐superoxide dismutase associated with Alzheimer and Parkinson diseases. J Biol Chem 280:11648–11655. [DOI] [PubMed] [Google Scholar]
  • 16. Choi J, Sullards MC, Olzmann JA, Rees HD, Weintraub ST, Bostwick DE et al (2006) Oxidative damage of DJ‐1 is linked to sporadic Parkinson and Alzheimer diseases. J Biol Chem 281:10816–10824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Dalfó E, Ferrer I (2008) Early α‐synuclein lipoxidation in neocortex in Lewy body diseases. Neurobiol Aging 29:408–417. [DOI] [PubMed] [Google Scholar]
  • 18. Dalfó E, Portero‐Otín M, Ayala V, Martínez A, Pamplona R, Ferrer I (2005) Evidence of oxidative stress in the neocortex in incidental Lewy body disease. J Neuropathol Exp Neurol 64:816–830. [DOI] [PubMed] [Google Scholar]
  • 19. Dexter DT, Carter CJ, Wells FR, Javoy‐Agid F, Agid Y, Lees A et al (1989) Basal lipid peroxidation in substantia nigra is increased in Parkinson's disease. J Neurochem 52:381–389. [DOI] [PubMed] [Google Scholar]
  • 20. Dexter DT, Sian J, Rose S, Hindmarsh JG, Mann VM, Cooper JM et al (1994) Indices of oxidative stress and mitochondrial function in individuals with incidental Lewy body disease. Ann Neurol 35:38–44. [DOI] [PubMed] [Google Scholar]
  • 21. Dufek M, Hamanová M, Lokaj J, Goldemund D, Rektorová I, Michálková Z et al (2009) Serum inflammatory biomarkers in Parkinson's disease. Parkinsonism Relat Disord 15:318–320. [DOI] [PubMed] [Google Scholar]
  • 22. Duke DC, Moran LB, Pearce RK, Graeber MB (2007) The medial and lateral substantia nigra in Parkinson's disease: mRNA profiles associated with higher brain tissue vulnerability. Neurogenetics 8:83–94. [DOI] [PubMed] [Google Scholar]
  • 23. Durrenberger PF, Fernando FS, Magliozzi R, Kashefi SN, Bonnert TP, Ferrer I et al (2012) Selection of novel reference genes for use in the human central nervous system: a BrainNet Europe study. Acta Neuropathol 124:893–903. [DOI] [PubMed] [Google Scholar]
  • 24. Erta M, Quintana A, Hidalgo J (2012) Interleukin‐6, a major cytokine in the central nervous system. Int J Biol Sci 8:1254–1266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ferrer I (2009) Early involvement of the cerebral cortex in Parkinson's disease: convergence of multiple metabolic defects. Prog Neurobiol 88:89–103. [DOI] [PubMed] [Google Scholar]
  • 26. Ferrer I, López‐Gonzalez I, Carmona M, Dalfó E, Pujol A, Martínez A (2012) Neurochemistry and the non‐motor aspects of PD. Neurobiol Dis 46:508–526. [DOI] [PubMed] [Google Scholar]
  • 27. Ferrer I, Martinez A, Blanco R, Dalfó E, Carmona M (2011) Neuropathology of sporadic Parkinson disease before the appearance of parkinsonism: preclinical Parkinson disease. J Neural Transm 118:821–839. [DOI] [PubMed] [Google Scholar]
  • 28. Floor E, Wetzel MG (1998) Increased protein oxidation in human substantia nigra pars compacta in comparison with basal ganglia and prefrontal cortex measured with an improved dinitrophenylhydrazine assay. J Neurochem 70:268–275. [DOI] [PubMed] [Google Scholar]
  • 29. Fukae J, Takanashi M, Kubo S, Nishioka K, Nakabeppu Y, Mori H et al (2005) Expression of 8‐oxoguanine DNA glycosylase (OGG1) in Parkinson's disease and related neurodegenerative disorders. Acta Neuropathol 109:256–262. [DOI] [PubMed] [Google Scholar]
  • 30. Gerhard A, Pavese N, Hotton G, Turkheimer F, Es M, Hammers A et al (2006) In vivo imaging of microglial activation with [11C](R)‐PK11195 PET in idiopathic Parkinson's disease. Neurobiol Dis 21:404–412. [DOI] [PubMed] [Google Scholar]
  • 31. Ghosh A, Roy A, Liu X, Kordower JH, Mufson EJ, Hartley DM et al (2007) Selective inhibition of NF‐kappaB activation prevents dopaminergic neuronal loss in a mouse model of Parkinson's disease. Proc Natl Acad Sci USA 104:18754–18759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Gómez A, Ferrer I (2009) Increased oxidation of certain glycolysis and energy metabolism enzymes in the frontal cortex in Lewy body diseases. J Neurosci Res 87:1002–1013. [DOI] [PubMed] [Google Scholar]
  • 33. Hakansson A, Westberg L, Nilsson S, Buervenich S, Carmine A, Holmberg B et al (2005) Interaction of polymorphisms in the genes encoding interleukin‐6 and estrogen receptor beta on the susceptibility to Parkinson's disease. Am J Med Genet B Neuropsychiatr Genet 133B:88–92. [DOI] [PubMed] [Google Scholar]
  • 34. Hirsch EC, Breidert T, Rousselet E, Hunot S, Hartmann A, Michel PP (2003) The role of glial reaction and inflammation in Parkinson's disease. Ann N Y Acad Sci 991:214–228. [DOI] [PubMed] [Google Scholar]
  • 35. Hirsch EC, Hunot S, Damier P, Brugg B, Faucheux BA, Michel PP et al (1999) Glial cell participation in the degeneration of dopaminergic neurons in Parkinson's disease. Adv Neurol 80:9–18. [PubMed] [Google Scholar]
  • 36. Hirsch EC, Hunot S, Damier P, Faucheux B (1998) Glial cells and inflammation in Parkinson's disease: a role in neurodegeneration? Ann Neurol 44:S115–S120. [DOI] [PubMed] [Google Scholar]
  • 37. Hirsch EC, Vyas S, Hunot S (2012) Neuroinflammation in Parkinson's disease. Parkinsonism Relat Disord 18(Suppl. 1):S210–S212. [DOI] [PubMed] [Google Scholar]
  • 38. Hofmann KW, Schuh AF, Saute J, Townsend R, Fricke D, Leke R et al (2009) Interleukin‐6 serum levels in patients with Parkinson's disease. Neurochem Res 34:1401–1404. [DOI] [PubMed] [Google Scholar]
  • 39. Hunot S, Brugg B, Ricard D, Michel PP, Muriel MP, Ruberg M et al (1997) Nuclear translocation of NF‐kappaB is increased in dopaminergic neurons of patients with Parkinson disease. Proc Natl Acad Sci USA 94:7531–7536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Imamura K, Hishikawa N, Ono K, Suzuki H, Sawada M, Nagatsu T et al (2005) Cytokine production of activated microglia and decrease in neurotrophic factors of neurons in the hippocampus of Lewy body disease brains. Acta Neuropathol 109:141–150. [DOI] [PubMed] [Google Scholar]
  • 41. Imamura K, Hishikawa N, Sawada M, Nagatsu T, Yoshida M, Hashizume Y (2003) Distribution of MHC class II‐positive microglia and cytokine profile of Parkinson's disease v brains. Acta Neuropathol 106:518–526. [DOI] [PubMed] [Google Scholar]
  • 42. Jenner P (1993) Altered mitochondrial function, iron metabolism and glutathione levels in Parkinson's disease. Acta Neurol Scand Suppl 146:6–13. [PubMed] [Google Scholar]
  • 43. Jenner P (1998) Oxidative mechanisms in nigral cell death in Parkinson's disease. Mov Disord 13:24–34. [PubMed] [Google Scholar]
  • 44. Jenner P, Dexter DT, Sian J, Schapira AH, Marsden CD, The Royal Kings and Queens Parkinson's Disease Research Group (1992) Oxidative stress as a cause of nigral cell death in Parkinson's disease and incidental Lewy body disease. Ann Neurol 32:S82–S87. [DOI] [PubMed] [Google Scholar]
  • 45. Katsuse O, Iseki E, Kosaka K (2003) Immunohistochemical study of the expression of cytokines and nitric oxide synthases in brains of patients with dementia with Lewy bodies. Neuropathology 23:9–15. [DOI] [PubMed] [Google Scholar]
  • 46. Kim YS, Joh TH (2006) Microglia, major player in the brain inflammation: their roles in the pathogenesis of Parkinson's disease. Exp Mol Med 38:333–347. [DOI] [PubMed] [Google Scholar]
  • 47. Klegeris A, Giasson BI, Zhang H, Maguire J, Pelech S, McGeer PL (2006) α‐synuclein and its disease‐causing mutants induce ICAM‐1 and IL‐6 in human astrocytes and astrocytoma cells. FASEB J 20:2000–2008. [DOI] [PubMed] [Google Scholar]
  • 48. Koziorowski D, Tomasiuk R, Szlufik S, Friedman A (2012) Inflammatory cytokines and NT‐proCNP in Parkinson's disease patients. Cytokine 60:762–766. [DOI] [PubMed] [Google Scholar]
  • 49. Krügler R, Hardt C, Tschentscher F, Jäckel S, Kuhn W, Müller T et al (2000) Genetic analysis of immunomodulating factors in sporadic Parkinson's disease. J Neural Transm 107:553–562. [DOI] [PubMed] [Google Scholar]
  • 50. Long‐Smith CM, Sullivan AM, Nolan YM (2009) The influence of microglia on the pathogenesis of Parkinson's disease. Prog Neurobiol 89:277–287. [DOI] [PubMed] [Google Scholar]
  • 51. Martínez A, Portero‐Otin M, Pamplona R, Ferrer I (2010) Protein targets of oxidative damage in human neurodegenerative diseases with abnormal protein aggregates. Brain Pathol 20:281–297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Marttila RJ, Viljanen M, Toivonen E, Lorentz H, Rinne UK (1990) Superoxide dismutase‐like activity in the Parkinson's disease brain. Adv Neurol 53:141–144. [PubMed] [Google Scholar]
  • 53. Mattila KM, Rinne JO, Lehtimäki T, Röyttä M, Ahonen JP, Hurme M (2002) Association of an interleukin 1B gene polymorphism (‐511) with Parkinson's disease in Finnish patients. J Med Genet 39:400–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. McGeer PL, Itagaki S, Boyes BE, McGeer EG (1988) Reactive microglia are positive for HLA‐DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology 38:1285–1291. [DOI] [PubMed] [Google Scholar]
  • 55. McGeer PL, McGeer EG (2004) Inflammation and neurodegeneration in Parkinson's disease. Parkinsonism Relat Disord 10(Suppl. 1):S3–S7. [DOI] [PubMed] [Google Scholar]
  • 56. McGeer PL, Yasojima K, McGeer EG (2002) Association of interleukin‐1 beta polymorphisms with idiopathic Parkinson's disease. Neurosci Lett 326:67–69. [DOI] [PubMed] [Google Scholar]
  • 57. Menza M, DeFrozo Dobkin R, Marin H, Mark MH, Gara M et al (2010) The role of inflammatory cytokines in cognition and other non‐motor symptoms of Parkinson's disease. Psychosomatics 51:474–479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Miklossy J, Doudet DD, Schwab C, Yu S, McGeer EG, McGeer PL (2006) Role of ICAM‐1 in persisting inflammation in Parkinson disease and MPTP monkeys. Exp Neurol 197:275–283. [DOI] [PubMed] [Google Scholar]
  • 59. Mogi M, Harada M, Kondo T, Riedered P, Nagatsu T (1996) Interleukin‐2 but not basic fibroblast growth factor is elevated in parkinsonian brain. J Neural Transm 103:1077–1081. [DOI] [PubMed] [Google Scholar]
  • 60. Mogi M, Harada M, Kondo T, Riederer P, Inagaki H, Minami M et al (1994) Interleukin‐1 beta, interleukin‐6, epidermal growth factor and transforming growth factor‐alpha are elevated in the brain from parkinsonian patients. Neurosci Lett 180:147–150. [DOI] [PubMed] [Google Scholar]
  • 61. Morgan MJ, Liu ZG (2011) Crosstalk of reactive oxygen species and NF‐κB signaling. Cell Res 21:103–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Nagatsu T, Mogi M, Ichinose H, Togari A (2000) Changes in cytokines and neurotrophins in Parkinson's disease. J Neural Transm Suppl 60:277–290. [DOI] [PubMed] [Google Scholar]
  • 63. Nagatsu T, Sawada M (2005) Inflammatory process in Parkinson's disease: role for cytokines. Curr Pharm Des 11:999–1016. [DOI] [PubMed] [Google Scholar]
  • 64. Nagatsu T, Sawada M (2007) Biochemistry of post‐mortem brains in Parkinson's disease: historical overview and future prospects. J Neural Transm Suppl 72:113–120. [DOI] [PubMed] [Google Scholar]
  • 65. Nunomura A, Hofer T, Moreira PI, Castellani RJ, Smith MA, Perry G (2009) RNA oxidation in Alzheimer disease and related neurodegenerative disorders. Acta Neuropathol 118:151–166. [DOI] [PubMed] [Google Scholar]
  • 66. Ouchi Y, Yagi S, Yokokura M, Sakamoto M (2009) Neuroinflammation in the living brain of Parkinson's disease. Parkinsonism Relat Disord 15(Suppl. 3):S200–S204. [DOI] [PubMed] [Google Scholar]
  • 67. Ouchi Y, Yoshikawa E, Sekine Y, Futatsubashi M, Kanno T, Ogusu T et al (2005) Microglial activation and dopamine terminal loss in early Parkinson's disease. Ann Neurol 57:168–175. [DOI] [PubMed] [Google Scholar]
  • 68. Pattarini R, Smeyne RJ, Morgan JI (2007) Temporal mRNA profiles of inflammatory mediators in the murine 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyrimidine model of Parkinson's disease. Neuroscience 145:654–668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Perry TL, Godin DV, Hansen S (1982) Parkinson's disease: a disorder due to nigral glutathione deficiency. Neurosci Lett 33:305–310. [DOI] [PubMed] [Google Scholar]
  • 70. Peterson LJ, Flood PM (2012) Oxidative stress and microglial cells in Parkinson's disease. Mediators Inflamm ID 2012:401264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Phani S, Loike JD, Przedborski S (2012) Neurodegeneration and inflammation in Parkinson's disease. Parkinsonism Relat Disord 18:S207–S209. [DOI] [PubMed] [Google Scholar]
  • 72. Przedborski S (2007) Neuroinflammation and Parkinson's disease. In: Handbook of Clinical Neurology; Parkinson's Disease and Related Disorders, Part I, Vol. 83. Aminoff MJ, Boller F, Swaab DF, Koller WC, Melamed E (eds), pp. 535–551. Elsevier: Oxford. [DOI] [PubMed] [Google Scholar]
  • 73. Reale M, Iarlori C, Thomas A, Gambi D, Pefetti B, Di Nicola M et al (2009) Peripheral cytokines profile in Parkinson's disease. Brain Behav Imm 23:55–63. [DOI] [PubMed] [Google Scholar]
  • 74. Rentzos M, Nikolaou C, Andreadou E, Paraskevas GP, Rombos A, Zoga M et al (2007) Circulating interleukin‐15 and RANTES chemokine in Parkinson's disease. Acta Neurol Scand 116:374–379. [DOI] [PubMed] [Google Scholar]
  • 75. Rentzos M, Nikolaou C, Andreadou E, Paraskevas GP, Rombos A, Zoga M et al (2009) Circulating interleukin‐10 and interleukin‐12 in Parkinson's disease. Acta Neurol Scand 119:332–337. [DOI] [PubMed] [Google Scholar]
  • 76. Saggu H, Cooksey J, Dexter D, Wells FR, Lees A, Jenner P et al (1989) A selective increase in particulate superoxide dismutase activity in Parkinson's substantia nigra . J Neurochem 53:692–697. [DOI] [PubMed] [Google Scholar]
  • 77. Saunders JA, Estes KA, Kosloski LM, Allen HE, Dempsey KM, Torres‐Russotto DR et al (2012) CD4+ regulatory and effector/memory T cell subsets profile motor dysfunction in Parkinson's disease. J Neuroimmune Pharmacol 7:927–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Sawada M, Imamura K, Nagatsu T (2006) Role of cytokines in inflammatory process in Parkinson's disease. J Neural Transm Suppl 70:373–381. [DOI] [PubMed] [Google Scholar]
  • 79. Scalzo P, Kümmer A, Cardoso F, Teixeira AL (2009) Increased serum levels of soluble tumor necrosis factor‐alpha receptor‐1 in patients with Parkinson's disease. J Neuroimmunol 216:122–125. [DOI] [PubMed] [Google Scholar]
  • 80. Seet RC, Lee CY, Lim EC, Tan JJ, Quek AM, Chong WL et al (2010) Oxidative damage in Parkinson disease: measurement using accurate biomarkers. Free Radic Biol Med 48:560–566. [DOI] [PubMed] [Google Scholar]
  • 81. Shelley ML (1998) 4‐hydroxy‐2‐nonenal may be involved in the pathogenesis of Parkinson's disease. Free Radic Biol Med 25:169–174. [DOI] [PubMed] [Google Scholar]
  • 82. Sian J, Dexter DT, Lees AJ, Daniel S, Jenner P, Marsden CD (1994) Glutathione‐related enzymes in brain in Parkinson's disease. Ann Neurol 36:356–361. [DOI] [PubMed] [Google Scholar]
  • 83. Stevens CH, Rowe D, Morel‐Kopp MC, Orr C, Russell T, Ranola M et al (2012) Reduced T helper and B lymphocytes in Parkinson's disease. J Neuroimmunol 252:95–99. [DOI] [PubMed] [Google Scholar]
  • 84. Sun Z, Andersson R (2002) NF‐kappaB activation and inhibition: a review. Shock 18:99–106. [DOI] [PubMed] [Google Scholar]
  • 85. Tansey MG, Goldberg MS (2010) Neuroinflammation in Parkinson's disease: its role in neuronal death and implications for therapeutic intervention. Neurobiol Dis 37:510–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Teismann K, Tieu K, Cohen O, Choi DK, Wu DC, Marks D et al (2003) Pathogenic role of glial cells in Parkinson's disease. Mov Disord 18:121–129. [DOI] [PubMed] [Google Scholar]
  • 87. Tessa C, Lucetti C, Diciotti S, Paoli L, Cecchi P, Gianelli M et al (2012) Hypoactivation of the primary sensorimotor cortex in de novo Parkinson's disease: a motor fMRI study under controlled conditions. Neuroradiology 54:261–268. [DOI] [PubMed] [Google Scholar]
  • 88. Tufekci KU, Meuwissen R, Genc S, Genc K (2012) Inflammation in Parkinson's disease. Adv Protein Chem Struct Biol 88:69–132. [DOI] [PubMed] [Google Scholar]
  • 89. Wahner AD, Sinsheimer JS, Bronstein JM, Ritz B (2007) Inflammatory cytokine gene polymorphisms and increased risk of Parkinson disease. Arch Neurol 64:836–840. [DOI] [PubMed] [Google Scholar]
  • 90. Watson MB, Richter F, Lee SK, Gabby L, Wu J, Masliah E et al (2012) Regionally‐specific microglial activation in young mice over‐expressing human wildtype α‐synuclein. Exp Neurol 237:318–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Whitton PS (2007) Inflammation as a causative factor in the aetiology of Parkinson's disease. Br J Pharmacol 150:963–976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92. Yoritaka A, Hattori N, Uchida K, Tanaka M, Stadtman ER, Mizuno Y (1996) Immunohistochemical detection of 4‐hydroxynonenal protein adducts in Parkinson disease. Proc Natl Acad Sci USA 93:696–701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93. Zeevalk GD, Razmpour R, Bernard LP (2008) Glutathione and Parkinson's disease: is this the elephant in the room? Biomed Pharmacother 62:236–249. [DOI] [PubMed] [Google Scholar]
  • 94. Zhang W, Wang T, Pei Z, Miller DS, Wu X, Block ML et al (2005) Aggregated α‐synuclein activates microglia: a process leading to disease progression in Parkinson's disease. FASEB J 19:533–542. [DOI] [PubMed] [Google Scholar]

Articles from Brain Pathology are provided here courtesy of Wiley

RESOURCES