Skip to main content
Brain Pathology logoLink to Brain Pathology
. 2015 Jun 11;26(2):167–176. doi: 10.1111/bpa.12267

MiR‐124 Regulates Apoptosis and Autophagy Process in MPTP Model of Parkinson's Disease by Targeting to Bim

Huiqing Wang 1,2, Yongyi Ye 1,2, Zhiyuan Zhu 1,2, Liqian Mo 3, Chunnan Lin 1,2, Qifu Wang 1,2, Haoyuan Wang 1,2, Xin Gong 2,4, Xiaozheng He 1,2, Guohui Lu 5, Fengfei Lu 1,2, Shizhong Zhang 1,2,✉
PMCID: PMC8029438  PMID: 25976060

Abstract

Parkinson's disease (PD) is the most prevalent movement disorder characterized by selective loss of midbrain dopaminergic (DA) neurons. MicroRNA‐124 (miR‐124) is abundantly expressed in the DA neurons and its expression level decreases in the 1‐methyl‐4‐pheny‐1, 2, 3, 6‐tetrahydropyridine (MPTP) model of PD. However, whether the upregulation of miR‐124 could attenuate neurodegeneration remains unknown. Here, we employed miR‐124 agomir and miR‐124 mimics to upregulate miR‐124 expression in MPTP‐treated mice and MPP +‐intoxicated SH‐SY5Y cells, respectively. We found that loss of DA neurons and striatal dopamine in MPTP‐treated mice was significantly reduced by upregulating miR‐124. In addition, we identified a target of miR‐124, Bim that mediated the neuroprotection of miR‐124. Indeed, treatment of miR‐124 agomir in MPTP‐treated mice inhibited Bim expression, thus suppressing Bax translocation to mitochondria. Moreover, impaired autophagy process in MPTP‐treated mice and MPP +‐intoxicated SH‐SY5Y cells characterized as autophagosomes (AP) accumulation and lysosomal depletion were alleviated by the upregulation of miR‐124. Taken together, these results indicate that upregulation of miR‐124 could regulate apoptosis and impaired autophagy process in the MPTP model of PD, thus reducing the loss of DA neurons.

Keywords: apoptosis, autophagy, Bax, Bim, miR‐124, Parkinson's disease

Introduction

Parkinson's disease (PD) is the most prevalent movement disorder and the second most common chronic and systemic neurodegenerative disorder after Alzheimer's disease 23, 24. PD prevalence increases steadily with age 38, which means the number of PD patients would be larger in an aging population 10. A pathological hallmark of PD is the loss of dopaminergic (DA) neurons within the substantia nigra pars compacta (SNpc) of the basal ganglia 7, 24, which causes abnormal nerve signaling that leads to impaired movement. To date, several lines of evidence from PD research find that pathophysiologic mechanisms underlying DA cell loss are related to mitochondrial dysfunction, oxidative stress and protein aggregation, which each could cause the apoptosis or impaired autophagy of DA neurons 1, 18, 28.Thus, strategies aimed at attenuating the loss of SNpc DA cells might provide an effective cure for PD patients.

MicroRNAs (miRNAs) are highly conserved non‐coding RNAs, which modulate transcription of multiple genes via binding to 3′ untranslated regions (3′UTR) 2. Until now, extensive evidence demonstrates that microRNA machinery plays an important role in dopamine neuron biology and diseases of neurodegeneration 16, 21, 31. For example, miR‐7 and miR‐153 negatively regulate α‐synuclein mRNA, a key gene related to inherited PD 11, 19. In addition, miR‐133b is deficient in the PD midbrain as well as in mouse models, and miR‐34b/34c are decreased in several affected brain regions in PD and incidental Lewy body disease 21, 29.

miRNA‐124 (miR‐124) is highly expressed in the brain with abundance (more than 100 times) higher than in other organs 30. Convincing evidence has demonstrated the neuro‐protective effect of miR‐124 in some CNS diseases, such as experimental autoimmune encephalomyelitis 37, focal cerebral ischemia 9 and stroke 44. In addition, a recent study reveals that miR‐124 is downregulated in 1‐methyl‐4‐phenyl‐1, 2, 3, 6‐tetrahydropyridine (MPTP)‐induced animal model of PD 20. In view of the evidence cited above, we hypothesized that miR‐124 might play a vital role in the pathology of DA neurons in PD. In our study, we find that exogenous delivery of miR‐124 maintains the number of DA neurons and midbrain dopamine level in MPTP‐treated mice. Furthermore, we identified a novel target of miR‐124—Bim, a BH3‐only protein that mediates the neuro‐protective effect of miR‐124.

Material and Methods

Animals and treatment

Eight ∼10‐week‐old male C57BL/6 mice were purchased from Guangdong Medical Laboratory Animal Center. The mice received one intraperitoneal injection of MPTP‐HCl per day (30 mg/kg free base; Sigma, MO, USA) for five consecutive days. Control mice received saline injections only. Mice were killed at different timepoints after MPTP intoxication: 0 (immediately after the last MPTP injection), 1, 2, 4, 7, and 21 days after the last MPTP administration 41. Six mice were used in each group. Mice were decapitated and, once the brain was removed, the ventral midbrain, which contained the SNpc, was dissected and stored at −80°C for further experiment. Regarding the experiment of exogenous delivery of miR‐124 in animal model, the right lateral ventricle of mice was surgically implanted with a stereotactic catheter. The stereotactic intraventricular injection site was chosen as previously reported (2 mm rostral to the bregma, 2 mm lateral to the sagittal suture, and 3 mm below the skull surface) 40. After 1 week of recovery, mice were given one treatment of agomir (RiboBio, Guangzhou, China) miR‐124‐3p (20 nM of ribonucleotide in a total volume of 5 μL) through the catheter per day for five consecutive days. Agomir‐negative control sequences were injected into the right lateral ventricle as negative control. The treatment of agomir was performed 2 days prior to injection of MPTP.

Cell culture and oligonucleotide transfection

SH‐SY5Y cells were obtained from Central Laboratory of Nanfang Hospital (Guangzhou, China). Cells were maintained in DMEM/F12 (HyClone, Logan, UT, USA) plus 10% fetal bovine serum (Gibco, Grand Island, NY, USA). Besides the mimics/negative control, inhibitor/negative control of miR‐124‐3p and SiRNA duplex oligonucleotides targeting human Bim 5′‐ CCCTACAGACAGAGCCACA‐3′ mRNA were synthesized by Ribobo, then were transfected into SH‐SY5Y cells by using riboFECT™ CP (RiboBio, Guangzhou, China) according to the manufacturer's protocol.

RT‐PCR

Total RNA was extracted from selected mouse brain regions and cells. Complementary DNA was amplified using the Roche LightCycler480 (Roche Diagnostics, Mannheim, Germany). The primer sequences used were as listed in Table 1.

Table 1.

Primer sequences

Gene Forward sequence Reverse sequence
Bim (Human) 5′‐TCATCGCGGTATTCGGTTC‐3′ 5′‐GAAGGTTGCTTTGCCATTTG‐3′
β‐actin (Human) 5′‐GGCATCCTCACCCTGAAGTA‐3′ 5′‐GGGTGTTGAAGGTCTCAAA‐3′
Bim (Mouse) 5′‐CCCGGAGATACGGATTGCAC‐3′ 5′‐CAGCCTCGCGGTAATCATTTG‐3′
β‐actin (Mouse) 5′‐CTTTGATGTCACGCACGATTTC‐3′ 5′‐GGGCCGCTCTAGGCACCAA‐3′
miR‐124 5′‐GCGAGGATCTGTGAATGCCAAA‐3′
U6 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′

Luciferase reporter assay

A 2522‐bp segment from the 3′UTR of the Bim gene containing the two miR‐124 binding sites was produced by PCR with the forward primer 5′‐GCGGTTCTCTTGTGGAGGGG‐3′ and the common reverse primer 5′‐AGAAGGGGAAACGGCAGACA‐3′, and then cloned into the XhoI/NotI site of psi‐CHECK™‐2 vector (Promega, Madison, WI, USA). For mutant construct of Bim 3′UTR, deletion mutagenesis and fusion‐PCR were performed. Four fragments, including two mutant miR‐124 binding sites and two middle segments, were first produced by PCR (Supporting Information Figure S1); the primers are shown in Table 2. The full length of Bim promoter, containing the two mutant miR‐124 binding sites, was obtained by mixing the two fragments produced from the first‐step PCR and then using them as the template in the second PCR reaction with the outermost primers, and then cloned into the XhoI/NotI site of psi‐CHECK™‐2 vector too. All of the constructs were confirmed by sequencing. HEK293 cells were co‐transfected with 100 ng/mL psi‐CHECK™‐2 vector and Luciferase vector, including the 3′UTR of Bim (with either wild‐type or mutant‐type miR‐124 binding sites) and miR mimics or control (RiboBio) at a final concentration of 100 nM using riboFECT™ CP as described by the manufacturer. Luciferase assays were performed with a Dual‐Luciferase Reporter Assay System (Promega) 48 h after transfection. Renilla luciferase activity was normalized to that of firefly luciferase.

Table 2.

Primers of fusion‐PCR

Name Sequence
Bim‐F1 GCGGTTCTCTTGTGGAGGGG
Bim‐R4 AGAAGGGGAAACGGCAGACA
Bim‐mut1‐F2 GCCAGCTAACTTAAAAAGCTTTATTTTTAGAGATTAC
Bim‐mut1‐R1 GTAATCTCTAAAAATAAAGCTTTTTAAGTTAGCTGGC
Bim‐mut2‐F4 GGAAACTTACTGCAGGTTTTGACAACCTCTCCCTATGTG
Bim‐mut2‐R3 CACATAGGGAGAGGTTGTCAAAACCTGCAGTAAGTTTCC
Bim‐F3 GCCCAGGGAGACCCAAGAAAGAG
Bim‐R2 CTCTTTCTTGGGTCTCCCTGGGC

Bold represents the depletion of miR‐124 biding sites.

Western blotting

Total protein samples were collected from SH‐SY5Y cells or selected mouse midbrain with cell lysis buffer. Additional protein extractions of mitochondria were performed with the Mitochondria Isolation Kit (Beyotime, Jiangsu, China) following manufacturer's description. The lysosomes from SH‐SY5Y cells were isolated by a lysosome isolation kit (Sigma, St. Louis, MO, USA) with differential centrifugation, followed by a density gradient centrifugation and Ca2+ precipitation, as detailed in the manufacturer's instruction 34. Western blotting was carried out as previously described 8. Antibodies used were as following: Bim, Bax, β‐actin and Cox‐IV (Cell Signaling Technology, Danvers, MA, USA); LC3II (Novus Biologicals, CO, USA); Lamp1 and Lamp2 (Abcam, MA, USA); and Beclin1 (Sigma).

Immunohistochemistry

Immunostaining was performed with a primary antibody to tyrosine hydroxylase (Millipore, MA, USA). The total number of tyrosine hydroxylase (TH)‐positive neurons and apoptotic neurons in the SNpc of selected mice were counted as previously described 36.

High performance liquid chromatography

Briefly, tissue samples were obtained by dissection and immediately homogenized on ice in 300 μL of perchloric acid 0.4 N and 0.1% (w/v) sodium metabisulfite, followed by a 10 min centrifugation step at 4000 × g at 4°C. The supernatants were filtered and preserved at −70°C until used for chromatographic analysis 36.

In situ hybridization combined with Immunofluorescence

In situ hybridization (ISH) was carried out on deparaffinized brain tissues using the previously published protocol which includes a digestion in pepsin (1.3 mg/mL) for 30 min. The miCURY LNA™ microRNA detection probe was obtained from EXIQON (Vedbaek, Denmark). The sequence of the probe was (5′ ∼ 3′): /5DigN/ATCAAGGTCCGCTGTGAACACG. The probe and tissue miRNA were co‐denatured at 60°C for 5 min, followed by hybridization at 37°C overnight and a stringency wash in 0.2X SSC and 2% bovine serum albumin at 4°C for 10 min. The probe target complex was seen due to the action of alkaline phosphatize on the chromogen nitroblue tetrazolium and bromochloroindolyl phosphate (NBT/BCIP). No counterstain was used to facilitate co‐labeling of TH proteins. After in situ hybridization for miR‐124, the slides were analyzed for immunofluorescence using the optimal conditions for TH (1:100, 30 min).

Immunoprecipitations

Co‐precipitation of Beclin1 and Bim was done from SH‐SY5Y cells. Whole cell lysate was prepared from SH‐SY5Y cells from at least 2 × 106 cells. 15 μL of protein G or A beads suspension were washed with TBS‐T (0.1%), and mixed with 500 μg cell extract and 5 μg of antibody. The reaction was incubated overnight at 4°C, with rotation. The mix was centrifuged for 30 s at 4°C and beads separated from the mixture using a magnetic stand. Beads were washed three times with TBS‐T (0.1%) before adding the sample buffer. The beads were boiled in sample buffer for 5–10 min, cooled, and the IP mix removed from the beads and used for SDS‐PAGE and immunoblot, or stored at −20°C until use.

LysoTracker labeling

To label lysosomes, LysoTracker Red (Invitrogen, Carlsbad, CA, USA) was used at a final concentration of 80 nM. Cells intoxicated with 1 mM MPP+ for 3 h were loaded with LysoTracker Red for 30 min at 37°C. Cells were washed twice in PBS and immediately visualized under fluorescence microscopy.

Electron microscopy

Collected cell pellets were fixed in sodium cacodylate buffer (0.1 M; pH 7.4), 2.5% glutaraldehyde, and 0.25 M sucrose at 4°C, then post‐fixed in 1% osmium tetroxide for 1 h at 4°C. The samples were dehydrated, embedded in plastic, and cut into in 70‐nm sections for microscopy. Sections were subsequently post‐stained with 5% uranyl acetate and viewed with an electron microscope (Hitachi H‐7650, Hitachi, Tokyo, Japan).

Statistical analysis

Data are presented as mean ± SEM from three independent experiments. One‐way analysis of variance with Dunnett's post‐test was used when comparing groups (more than two groups) with only one treatment. Two‐way analysis of variance with Bonferroni post‐tests were performed among experiments with treatments of MPTP/MPP+ and agomir/mimics. A P‐value less than 0.05 was defined as the threshold for significance.

Results

MiR‐124 is downregulated in SNpc DA neurons of MPTP‐treated mice and MPP +‐intoxicated SH‐SY5Y cells

First, we investigated the expression of miR‐124 in the midbrain of MPTP‐treated mice by RT‐PCR. Consistent with a recent study 20, we found that the expression of miR‐124 decreased after intraperitoneal injection of MPTP (Figure 1A). As inflammation is involved in PD, and miR‐124 is associated with microglia quiescence 37, alteration in microglia might also contribute to the reduction of miR‐124 in midbrain. We next determined miR‐124 expression in SNpc DA neurons via in situ hybridization; the result showed that miR‐124 expression was also downregulated in SNpc DA neurons (Figure 1B). The decrease of miR‐124 in DA neurons was determined again on MPP+‐intoxicated SH‐SY5Y cells in vitro. Similarly, MPP iodide induced reduction of miR‐124 expression in SH‐SY5Y cells compared with control (Figure 1C,D).

Figure 1.

figure

Expression of mir‐124 in MPTP‐treated mice and MPP +‐intoxicated SH‐SY5Y cells. A. Total RNA was extracted from midbrain of selected mice and synthesized cDNA, and then analyzed by RT‐PCR to determine the miRNA‐124 level. miRNA‐124 level was normalized to U6. B. miR‐124 expression in SNpc DA neurons of MPTP‐treated mice determined by in situ hybridization combined with Immunofluorescence. C. miR‐124 expression in SH‐SY5Y cells with treatment of MPP + for 24 h at different concentrations. D. miR‐124 expression in SH‐SY5Y cells exposed to 1 mm MPP + for different duration. * < 0.05 compared with control.

Exogenous delivery of miR‐124 attenuates neurodegeneration of MPTP‐treated mice in vivo

Considering the neuroprotection of miR‐124 in other CNS diseases, miR‐124 agomir or negative control were injected into the right lateral ventricle 2 days before MPTP treatment to up‐regulate the miR‐124 expression in midbrain (Supporting Information Figure S2). As a result, the density of TH‐positive neurons in the miR‐124 agomir group was higher than in the negative control group at 21 days after treatment of MPTP (Figure 2A,B). To assess the neurodegeneration, we detected striata levels of dopamine 21 days after MPTP administration, using high‐performance liquid chromatography. Comparing with the negative group, loss of striatal dopamine was significantly less pronounced in the miR‐124 agomir group (Figure 2C).

Figure 2.

figure

Exogenous delivery of mir‐124 rescues DA neurons from MPTP toxicity. (A and B) Immunostaining and stereological counts of TH‐positive neurons in the SNpc were performed in agomir‐treated mice and their negative control counterparts at day 21 after the last injection of MPTP. C. Striatal dopamine level was determined by HPLC. * < 0.05 compared with negative control in the group of MPTP‐treated mice.

MiR‐124 targets to Bim

Having found that miR‐124 induced neuroprotection in the animal model of PD, we investigated the mechanisms underlying this effect. By using TargetScan software (Whitehead Institute, Cambridge, MA, USA), we analyzed targets predicted for miR‐124. Bim, a BH3‐only protein involved in apoptosis of DA neurons in MPTP model of PD, was predicted as a putative target with two conserved miR‐124 binding sites in its 3′ untranslated region (3′UTR; Figure 3A). When we transfected SH‐SY5Y cells with miR‐124 mimics, Bim expression was reduced on both the protein (Figure 3B) and the mRNA levels (Figure 3C), as compared with the control. Using the luciferase reporter system, we then detected that miR‐124 directly binds the mRNA encoding Bim. Indeed, cells transfected with miR‐124 mimics induced a reduction in luciferase activity (Figure 3D).

Figure 3.

figure

Bim is a target of miR‐124. A. Alignment of two miR‐124 binding sites to Bim 3′UTR is shown for different species predicted by Targetscan. B. Western blot analysis of Bim in SH‐SY5Y cells transfected with miR‐124 mimics (100 nm) or negative control. C. mRNA level of Bim determined by PCR in SH‐SY5Y cells transfected with miR‐124 mimics (100 nm) or negative control. D. Luciferase activity in HEK293 cells transfected with reporter constructs containing wild‐type (WT) or mutated Bim 3′UTR. The cells were co‐transfected with indicated constructs and miR‐124 mimics (100 nm) or control, and normalized levels of luciferase activity are shown.* < 0.05 compared with control.

MiR‐124 attenuates mitochondria‐dependent apoptotic cell death by targeting to Bim

After indentifying that Bim was the target of miR‐124, we further studied whether miR‐124 could attenuate MPTP‐induced expression of Bim. Compared with the negative control group, upregulation of Bim mRNA level, and protein level induced by MPTP, was reduced by miR‐124 agomir (Figure 4A,B). Besides, to determine the specific effects of miR‐124 on Bim, we investigated 3 additional BH3‐only Bcl2‐family members, Puma, Noxa and Bid (Supporting Information Figure S3). And we found there was no change in protein expression of Puma and Noxa in MPTP‐treated mice. Actually, Celine Perier et al. also found that mRNA levels of Puma and Noxa did not alter after MPTP treatment 36. In addition, although the treatment of MPTP enhanced the cleavage of Bid 45, miR‐124 agomir could not counter‐regulate that. As the pro‐apoptotic effect of Bim is mediated through Bax mitochondrial translocation in the MPTP model of PD 36, we then detected the effect of inhibition of Bim by upregulating miR‐124 on Bax mitochondrial translocation. Interestingly, we observed a similar result as a previous study silencing Bim gene—that Bax mitochondrial translocation caused by MPTP was also reduced by upregulation of miR‐124(Figure 4C). Correspondingly, the number of apoptotic cells in SNpc (Figure 4D) was reduced in the miR‐124 agomir group.

Figure 4.

figure

miR‐124 inhibits upregulation of Bim and Bax translocation induced by MPTP  in vivo. A. Expression of Bim in ventral midbrain determined by RT‐PCR. B. Western blot analysis of Bim expression in total protein samples exacted from midbrain. C. Western blot analysis of Bax expression in mitochondrial protein isolated from midbrain. D. Stereological counts of apoptotic neurons in the SNpc were performed in agomir‐treated mice and their negative control littermates at day 4 after the last injection of MPTP. * < 0.05 compared with negative control in the group of MPTP‐treated mice.

MiR‐124 attenuates autophagosome accumulation and lysosomal depletion

Recently, it has been identified that Bim possesses both anti‐autophagy and pro‐apoptotic effects 27. We thus examined the effect of exogenous miR‐124 on impaired autophagy in MPTP‐treated mice, which exhibits as autophagosome accumulation and lysosomal depletion 8. Interestingly, comparing with the control group, miR‐124 agomir significantly reduced autophagosome marker LC3II and restored lysosomal marker LAMP1 protein levels (Figure 5A,B). We next wondered whether the effect of miR‐124 on autophagy was mediated through downregulation of Bim. Therefore, miR‐124 mimics or si‐Bim RNA were transfected into SH‐SY5Y cells 6 h before MPP+ treatment. After downregulating Bim (Figure 5C), both miR‐124 and si‐Bim RNA could attenuate autophagosome accumulation and lysosomal depletion caused by MPP+ (Figure 5D,E).

Figure 5.

figure

miR‐124 attenuates impairment of autophagy in MPTP‐treated mice and MPP +‐intoxicated cells. Western blot analysis of LC3II (A) and Lamp1 (B) expression in total protein samples exacted from midbrain at day 1 after the last injection of MPTP. * < 0.05 compared with negative control in the group of MPTP‐treated mice. C. Bim mRNA level was determined by RT‐PCR in PBS or MPP +‐treated SH‐SY5Y cells transfected with miR‐124, si‐Bim or control 6 h prior. Western blot analysis of LC3II (D) and Lamp1 (E) expression in total protein samples exacted from cells treated as in C. * < 0.05 compared with control in the group of MPP +‐treated cells.

Bim mediates Bax translocation to lysosomal membranes

Previous study demonstrated downregulating Bim in vivo and in vitro would result in enhanced autophagosome formation 27, which seemed paradoxical with our data. Actually, in a steady‐state condition, Bim inhibits autophagosome formation depending on Beclin1 (an autophagy regulator) by interacting with Beclin1 directly 27. However, in response to stress, such as starvation—an autophagic stimulus—the interaction between Bim and Bechlin1 is disrupted with Bim ameliorating autophagy inhibition. Therefore, we wondered how it responded to treatment of MPP+. We found that Bim‐Beclin1 interaction was dramatically weakened after 24 h of treatment with MPP+ (Figure 6A), which indicated that Bim might exhibit autophagy‐permissive rather than autophagy‐inhibitory effects under stimulation of MPP+, similar with starvation. Therefore, there might be other mechanisms responsible to affect downregulation of Bim on autophagy. A recent study identified that following MPTP treatment, activated Bax translocates to both lysosomal and mitochondrial membranes causing lysosomal membrane permeabilization (LMP) and mitochondrial outer membrane permeabilization (MOMP), respectively. Bax‐induced LMP leads to a decreased number of lysosomes and subsequent accumulation of undegraded AP 4. As Bim mediates Bax translocation to mitochondria 36, we then investigated whether Bim participated in Bax translocation to lysosome and finally induced LMP. In our study, we found that downregulating Bim by miR‐124 or si‐Bim RNA reduced Bax translocation to lysosomal membrane in MPP+‐intoxicated cells (Figure 6B). Accordingly, LMP indicted by lysotracker density was also attenuated by downregulating Bim (Figure 6C).

Figure 6.

figure

Bim mediates Bax translocation and LMP. A. Interaction between Beclin1 and Bim in MPP+‐treated SH‐SY5Y cells analyzed by immunoprecipitation. B. Western blot analysis of Bax in lysosomes isolated from PBS or MPP +‐treated cells transfected with miR‐124 mimics or si‐Bim 6h prior. * < 0.05 compared with control in the group of MPP +‐treated cells. C. LysoTracker Red was used to label lysosome to reflect lysosomal membrane permeabilization (LMP), and visualized by fluorescence microscopy.

Inhibiting miR‐124 in SH‐SY5Y cells causes suppression of basal autophagy

Bim has a key role in inhibiting autophagy under the steady‐state condition, so we tested whether up‐regulating Bim by inhibiting miR‐124 could reduce basal autophagy in SH‐SY5Y cells, as loss of basal autophagy in neurons could cause neurodegeneration 15. First, we found that Bim protein level was up‐regulated after transfecting miR‐124 inhibitor into SH‐SY5Y cells (Figure 7A). Then, we assessed the basal autophagy level by measuring LC3II level and electron microscopy. As a result, basal autophagy level decreased in miR‐124 inhibitor‐treated cells (Figure 7B,C). Unfortunately, although mitoptosis is another mitochondrial death mechanism leading predominantly to activation of autophagy 5, 17, there was no obvious evidence of mitoptosis in our electron microscopy results. In addition, the mitochondrial potential determined by JC‐1 staining was also not affected by miR‐124 inhibitor transfection in SH‐SY5Y cells. (Supporting Information Figure S4)

Figure 7.

figure

Basal autophagy is affected by inhibiting mir‐124 in vitro. Western blot analysis of Bim (A) and LC3II (B) expression in SH‐SY5Y cells transfected with miR‐124 inhibitor. * < 0.05 compared with negative control. C. Basal autophagy level was evaluated by electron microscopy. Arrows indicate autophagosome‐like double‐membrane vesicles, which contain damaged organelles.

Discussion

MicroRNAs play a critical role in neuron biology and miR‐124 is abundantly expressed in the neurons 31, 43. To date, it has been demonstrated that miR‐124 alteration is associated with many CNS diseases, such as injured hypoglossal motor neurons 33, experimental autoimmune encephalomyelitis 37 and cerebral ischemic stroke 44. In addition, we recently found that miR‐124 inhibited the growth of high‐grade gliomas through posttranscriptional regulation of LAMB1 6. In the present study, we focused on the role of miR‐124 in the DA neurons of MPTP‐treated mice and MPP+‐intoxicated SH‐SY5Y cells. Consistent with a recent study 20, the expression of miR‐124 in selected midbrain tissue of mice was down‐regulated. Furthermore, we exclusively investigated the alteration of miR‐124 in SNpc DA neurons by employing in situ hybridization experiment combined with TH staining, with the result of reduction of miR‐124 expression in SNpc DA neurons. In addition, the expression of miR‐124 in MPP+‐intoxicated SH‐SY5Y cells was also down‐regulated. Therefore, the level of miR‐124 in DA neurons declines when exposed to PD stimulus MPTP or MPP+.

Accordingly, Bim, a BH3‐only protein that has been identified as a target of miR‐124 in our study, is upregulated in MPTP‐induced PD model 36. Actually, Bim is a key regulator of neuronal apoptosis, including cerebellar granule neurons (CGNs) deprived of activity 42, sympathetic neurons during removal of nerve growth factor (NGF) 46, and cortical neurons exposed to β‐amyloid peptide 48. And transcriptional control is an important mechanism regulating Bim expression during neuronal apoptosis, including JNK/c‐jun pathway 46, FOXO transcription factors 3 and Egr‐1 transcription factor 47. More specifically, the mechanism regulating Bim expression in the MPTP model of PD has been demonstrated to be associated with JNK/c‐jun activation, with an induction of Bax translocation to mitochondria 36. Nevertheless, we observed that exogenous delivery of miR‐124 could counter‐regulate Bim up‐regulation induced by MPTP in vivo, as miR‐124 targeting to Bim demonstrated by our Luciferase reporter assay, and reduce Bax translocation to mitochondria. Indeed, there are several lines of evidence supporting that Bim is regulated by microRNA in other diseases. For example, miR‐24 represses Bim and inhibits apoptosis in mouse cardiomyocytes 39, and miR‐363 promotes human glioblastoma stem cell survival via direct Inhibition of Bim 12.

Currently, it has been demonstrated that Bim possesses dual effects in inhibiting autophagy and promoting apoptosis 27. Interestingly, we found that downregulation of Bim induced by miR‐124 could attenuate autophagosome accumulation and lysosomal depletion in MPTP‐treated mice and MPP+‐intoxicated SH‐SY5Y cells. However, the anti‐autophagy effect of Bim is dependent on interaction of Beclin1 under a steady‐state condition, which is disrupted under stimulus of MPP+. Therefore, it is possible that there are other mechanisms contributing to the effect of Bim on autophagy in the model of PD. In the scenario of apoptosis, Bim mediates the translocation of Bax to mitochondria, thus releasing cytochrome c and resulting in apoptosis of neurons in MPTP‐treated mice 36. In our study, we determined that Bim is likewise correlated to Bax translocation to lysosome, which has just been demonstrated to be associated with lysosomal disruption and impaired autophagy linked to Parkinson's disease 4. In fact, autophagy and apoptosis are two important cellular processes with complex and interconnected protein networks 5, 14, 32. For example, p53 protein possesses dual regulatory function in apoptosis and autophagy, p53 protein induces apoptosis mostly through transcription regulation, while it could activate or suppress autophagy depending on cellular energy status 5. Bcl2‐family proteins are another crucial factors governing the crosstalk between autophagy and apoptosis 25. It has also been shown that Bcl‐2 not only functions as an anti‐apoptotic protein, but also as an anti‐autophagy protein via its inhibitory interaction with Beclin1 35. Indeed, a recent study suggests that prosurvival Bcl‐2 family members affect autophagy only indirectly, by inhibiting Bax and Bak 26. Actually, apoptosis and autophagy are different processes of cell death classified according to morphological appearance, enzymological criteria, functional aspects or immunological characteristics 13. In common, mitochondrial outer membrane permeabilization (MOMP) and lysosomal membrane permeabilization (LMP) would respectively cause apoptosis and autophagy. In the MPTP‐induced model of PD, apoptosis (named as type I cell death) is attributed to MOMP, which is caused by Bax translocation to mitochondria 36; impaired autophagy (named as type II cell death) is a result of LMP, which is caused by Bax translocation to lysosome 4. Thus, Bax activity is important in the pathogenesis of PD both in the process of apoptosis and autophagy. In our study, translocation of Bax to the mitochondria and the lysosome could be both suppressed by upregulation of miR‐124 targeting to Bim, thus attenuating the apoptosis and impaired autophagy of DA neurons in PD.

And last, regarding that Bim possesses apoptosis‐inactive/autophagy‐inhibitory effects under steady‐state condition 27, we found that upregulating Bim in SH‐SY5Y cells by inhibiting miR‐124 reduced basal autophagy level. Previous studies have demonstrated that suppression of basal autophagy in neural cells causes neurodegenerative disease in mice and loss of autophagy in the central nervous system also causes neurodegeneration in mice 15, 22. So, it would be interesting to perform further experiments to test whether inhibition of miR‐124 in vivo could result in reduced basal autophagy and neurodegeneration or not, as we have observed downregulation of miR‐124 in MPTP model of PD. Besides, it is also worth noting that the mechanisms underlying neuroprotection of miR‐124 on PD maybe more complicated, not just only targeting to Bim. For example, miR‐124 might suppress microglia activation by inhibiting C/EBP‐a 37, and then attenuating inflammation, which is responsible for pathogenesis of PD.

In conclusion, we have found that miR‐124 is down‐regulated in MPTP‐treated mice and MPP+‐intoxicated SH‐SY5Y cells, and exogenous delivery of miR‐124 could attenuate the loss of SNpc DA neurons in MPTP‐treated mice. Furthermore, we demonstrate that miR‐124 targets to Bim, a BH3‐only protein, which is a vital protein regulating apoptosis and autophagy process of SNpc DA neurons in the pathogenesis of PD 4, 36. The mechanisms underlying the neuro‐protection of miR‐124 on PD in our study is likely due to the reduction of Bax translocation to mitochondria and lysosome by suppression of Bim, which results in alleviation of apoptosis and impaired autophagy of SNpc DA neurons.

Conflict of Interest

No potential conflicts of interest were disclosed.

Supporting information

Figure S1. Fusion‐PCR for mutant construct of Bim 3̀UTR. First‐step PCR was performed to produce four fragments, including two mutant miR‐124 binding sites and two middle segments. And fragments produced from the first‐step PCR were mixed to generate the template of second PCR reaction with the outermost primers, and finally the PCR production from previous step was ligated.

Figure S2. The expression level of miR‐124 after exogenous delivery of miR‐124 agomir. MiR‐124 agomir or negative control were injected into right lateral ventricle for 5 days and 2 days prior to MPTP treatment, and total RNA was extracted from midbrain of selected mice and synthesized cDNA, and then analyzed by RT‐PCR to determine the miRNA‐124 level. MiRNA‐124 level was normalized to U6. *<0.05 compared with respective negative control.

Figure S3. Western blot analysis of BH3‐only protein (Puma, Noxa and Bid) after treatment of MPTP. Left graph shows the expression of Puma and Noxa in total protein samples is not changed exacted from midbrain at day 4 after the last injection of MPTP. Although MPTP treatment upregulated the expression of Bid, the agomir of miR‐124 could not counter‐regulate it.

Figure S4. JC‐1 staining in the SH‐SY5Y cells transfected with miR‐124 inhibitor or negative control was analyzed by Fluorescence‐activated cell sorting.

Acknowledgments

This study was supported by a grant from the National Natural Science Foundation of China (No. 81371397)

References

  • 1. Abou‐Sleiman PM, Muqit MM, Wood NW (2006) Expanding insights of mitochondrial dysfunction in Parkinson's disease. Nat Rev Neurosci 7:207–219. [DOI] [PubMed] [Google Scholar]
  • 2. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136:215–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Biswas SC, Shi Y, Sproul A, Greene LA (2007) Pro‐apoptotic Bim induction in response to nerve growth factor deprivation requires simultaneous activation of three different death signaling pathways. J Biol Chem 282:29368–29374. [DOI] [PubMed] [Google Scholar]
  • 4. Bove J, Martinez‐Vicente M, Dehay B, Perier C, Recasens A, Bombrun A et al (2014) BAX channel activity mediates lysosomal disruption linked to Parkinson disease. Autophagy 10:889–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Chaabane W, User SD, El‐Gazzah M, Jaksik R, Sajjadi E, Rzeszowska‐Wolny J, Los MJ (2013) Autophagy, apoptosis, mitoptosis and necrosis: interdependence between those pathways and effects on cancer. Arch Immunol Ther Exp (Warsz) 61:43–58. [DOI] [PubMed] [Google Scholar]
  • 6. Chen Q, Lu G, Cai Y, Li Y, Xu R, Ke Y, Zhang S (2014) MiR‐124‐5p inhibits the growth of high‐grade gliomas through posttranscriptional regulation of LAMB1. Neuro‐Oncol 16:637–651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Dawson TM, Dawson VL (2003) Molecular pathways of neurodegeneration in Parkinson's disease. Science 302:819–822. [DOI] [PubMed] [Google Scholar]
  • 8. Dehay B, Bove J, Rodriguez‐Muela N, Perier C, Recasens A, Boya P, Vila M (2010) Pathogenic lysosomal depletion in Parkinson's disease. J Neurosci 30:12535–12544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Doeppner TR, Doehring M, Bretschneider E, Zechariah A, Kaltwasser B, Muller B et al (2013) MicroRNA‐124 protects against focal cerebral ischemia via mechanisms involving Usp14‐dependent REST degradation. Acta Neuropathol 126:251–265. [DOI] [PubMed] [Google Scholar]
  • 10. Dorsey ER, Constantinescu R, Thompson JP, Biglan KM, Holloway RG, Kieburtz K et al (2007) Projected number of people with Parkinson disease in the most populous nations, 2005 through 2030. Neurology 68:384–386. [DOI] [PubMed] [Google Scholar]
  • 11. Doxakis E (2010) Post‐transcriptional regulation of alpha‐synuclein expression by mir‐7 and mir‐153. J Biol Chem 285:12726–12734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Floyd DH, Zhang Y, Dey BK, Kefas B, Breit H, Marks K et al (2014) Novel anti‐apoptotic microRNAs 582‐5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS ONE 9:e96239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Galluzzi L, Maiuri MC, Vitale I, Zischka H, Castedo M, Zitvogel L, Kroemer G (2007) Cell death modalities: classification and pathophysiological implications. Cell Death Differ 14:1237–1243. [DOI] [PubMed] [Google Scholar]
  • 14. Ghavami S, Shojaei S, Yeganeh B, Ande SR, Jangamreddy JR, Mehrpour M et al (2014) Autophagy and apoptosis dysfunction in neurodegenerative disorders. Prog Neurobiol 112:24–49. [DOI] [PubMed] [Google Scholar]
  • 15. Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki‐Migishima R et al (2006) Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441:885–889. [DOI] [PubMed] [Google Scholar]
  • 16. Hebert SS, De Strooper B (2009) Alterations of the microRNA network cause neurodegenerative disease. Trends Neurosci 32:199–206. [DOI] [PubMed] [Google Scholar]
  • 17. Jangamreddy JR, Los MJ (2012) Mitoptosis, a novel mitochondrial death mechanism leading predominantly to activation of autophagy. Hepat Mon 12:e6159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 (Suppl. 3(S3)):S26–S36, discussion S36–8. [DOI] [PubMed] [Google Scholar]
  • 19. Junn E, Lee KW, Jeong BS, Chan TW, Im JY, Mouradian MM (2009) Repression of alpha‐synuclein expression and toxicity by microRNA‐7. Proc Natl Acad Sci U S A 106:13052–13057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kanagaraj N, Beiping H, Dheen ST, Tay SS (2014) Downregulation of miR‐124 in MPTP‐treated mouse model of Parkinson's disease and MPP iodide‐treated MN9D cells modulates the expression of the calpain/cdk5 pathway proteins. Neuroscience 272:167–179. [DOI] [PubMed] [Google Scholar]
  • 21. Kim J, Inoue K, Ishii J, Vanti WB, Voronov SV, Murchison E et al (2007) A MicroRNA feedback circuit in midbrain dopamine neurons. Science 317:1220–1224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Komatsu M, Waguri S, Chiba T, Murata S, Iwata J, Tanida I et al (2006) Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature 441:880–884. [DOI] [PubMed] [Google Scholar]
  • 23. de Lau LM, Breteler MM (2006) Epidemiology of Parkinson's disease. Lancet Neurol 5:525–535. [DOI] [PubMed] [Google Scholar]
  • 24. Lees AJ, Hardy J, Revesz T (2009) Parkinson's disease. Lancet 373:2055–2066. [DOI] [PubMed] [Google Scholar]
  • 25. Levine B, Sinha S, Kroemer G (2008) Bcl‐2 family members: dual regulators of apoptosis and autophagy. Autophagy 4:600–606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Lindqvist LM, Heinlein M, Huang DC, Vaux DL (2014) Prosurvival Bcl‐2 family members affect autophagy only indirectly, by inhibiting Bax and Bak. Proc Natl Acad Sci U S A 111:8512–8517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Luo S, Garcia‐Arencibia M, Zhao R, Puri C, Toh PP, Sadiq O, Rubinsztein DC (2012) Bim inhibits autophagy by recruiting Beclin 1 to microtubules. Mol Cell 47:359–370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. McNaught KS, Olanow CW (2006) Protein aggregation in the pathogenesis of familial and sporadic Parkinson's disease. Neurobiol Aging 27:530–545. [DOI] [PubMed] [Google Scholar]
  • 29. Minones‐Moyano E, Porta S, Escaramis G, Rabionet R, Iraola S, Kagerbauer B et al (2011) MicroRNA profiling of Parkinson's disease brains identifies early downregulation of miR‐34b/c which modulate mitochondrial function. Hum Mol Genet 20:3067–3078. [DOI] [PubMed] [Google Scholar]
  • 30. Mishima T, Mizuguchi Y, Kawahigashi Y, Takizawa T, Takizawa T (2007) RT‐PCR‐based analysis of microRNA (miR‐1 and ‐124) expression in mouse CNS. Brain Res 1131:37–43. [DOI] [PubMed] [Google Scholar]
  • 31. Mouradian MM (2012) MicroRNAs in Parkinson's disease. Neurobiol Dis 46:279–284. [DOI] [PubMed] [Google Scholar]
  • 32. Mukhopadhyay S, Panda PK, Sinha N, Das DN, Bhutia SK (2014) Autophagy and apoptosis: where do they meet? Apoptosis 19:555–566. [DOI] [PubMed] [Google Scholar]
  • 33. Nagata K, Hama I, Kiryu‐Seo S, Kiyama H (2014) microRNA‐124 is down regulated in nerve‐injured motor neurons and it potentially targets mRNAs for KLF6 and STAT3. Neuroscience 256:426–432. [DOI] [PubMed] [Google Scholar]
  • 34. Oberle C, Huai J, Reinheckel T, Tacke M, Rassner M, Ekert PG et al (2010) Lysosomal membrane permeabilization and cathepsin release is a Bax/Bak‐dependent, amplifying event of apoptosis in fibroblasts and monocytes. Cell Death Differ 17:1167–1178. [DOI] [PubMed] [Google Scholar]
  • 35. Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N et al (2005) Bcl‐2 antiapoptotic proteins inhibit Beclin 1‐dependent autophagy. Cell 122:927–939. [DOI] [PubMed] [Google Scholar]
  • 36. Perier C, Bove J, Wu DC, Dehay B, Choi DK, Jackson‐Lewis V et al (2007) Two molecular pathways initiate mitochondria‐dependent dopaminergic neurodegeneration in experimental Parkinson's disease. Proc Natl Acad Sci U S A 104:8161–8166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ponomarev ED, Veremeyko T, Barteneva N, Krichevsky AM, Weiner HL (2011) MicroRNA‐124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP‐alpha‐PU.1 pathway. Nat Med 17:64–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Pringsheim T, Jette N, Frolkis A, Steeves TD (2014) The prevalence of Parkinson's disease: a systematic review and meta‐analysis. Mov Disord 29:1583–1590. [DOI] [PubMed] [Google Scholar]
  • 39. Qian L, Van Laake LW, Huang Y, Liu S, Wendland MF, Srivastava D (2011) miR‐24 inhibits apoptosis and represses Bim in mouse cardiomyocytes. J Exp Med 208:549–560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Qu Y, Wu J, Chen D, Zhao F, Liu J, Yang C et al (2014) MiR‐139‐5p inhibits HGTD‐P and regulates neuronal apoptosis induced by hypoxia‐ischemia in neonatal rats. Neurobiol Dis 63:184–193. [DOI] [PubMed] [Google Scholar]
  • 41. Sathe K, Maetzler W, Lang JD, Mounsey RB, Fleckenstein C, Martin HL et al (2012) S100B is increased in Parkinson's disease and ablation protects against MPTP‐induced toxicity through the RAGE and TNF‐alpha pathway. Brain 135 (Pt 11):3336–3347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Shi L, Gong S, Yuan Z, Ma C, Liu Y, Wang C et al (2005) Activity deprivation‐dependent induction of the proapoptotic BH3‐only protein Bim is independent of JNK/c‐Jun activation during apoptosis in cerebellar granule neurons. Neurosci Lett 375:7–12. [DOI] [PubMed] [Google Scholar]
  • 43. Sonntag KC (2010) MicroRNAs and deregulated gene expression networks in neurodegeneration. Brain Res 1338:48–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Sun Y, Gui H, Li Q, Luo ZM, Zheng MJ, Duan JL, Liu X (2013) MicroRNA‐124 protects neurons against apoptosis in cerebral ischemic stroke. CNS Neurosci Ther 19:813–819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Viswanath V, Wu Y, Boonplueang R, Chen S, Stevenson FF, Yantiri F et al (2001) Caspase‐9 activation results in downstream caspase‐8 activation and bid cleavage in 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine‐induced Parkinson's disease. J Neurosci 21:9519–9528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Whitfield J, Neame SJ, Paquet L, Bernard O, Ham J (2001) Dominant‐negative c‐Jun promotes neuronal survival by reducing BIM expression and inhibiting mitochondrial cytochrome c release. Neuron 29:629–643. [DOI] [PubMed] [Google Scholar]
  • 47. Xie B, Wang C, Zheng Z, Song B, Ma C, Thiel G, Li M (2011) Egr‐1 transactivates Bim gene expression to promote neuronal apoptosis. J Neurosci 31:5032–5044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Yao M, Nguyen TV, Pike CJ (2007) Estrogen regulates Bcl‐w and Bim expression: role in protection against beta‐amyloid peptide‐induced neuronal death. J Neurosci 27:1422–1433. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Fusion‐PCR for mutant construct of Bim 3̀UTR. First‐step PCR was performed to produce four fragments, including two mutant miR‐124 binding sites and two middle segments. And fragments produced from the first‐step PCR were mixed to generate the template of second PCR reaction with the outermost primers, and finally the PCR production from previous step was ligated.

Figure S2. The expression level of miR‐124 after exogenous delivery of miR‐124 agomir. MiR‐124 agomir or negative control were injected into right lateral ventricle for 5 days and 2 days prior to MPTP treatment, and total RNA was extracted from midbrain of selected mice and synthesized cDNA, and then analyzed by RT‐PCR to determine the miRNA‐124 level. MiRNA‐124 level was normalized to U6. *<0.05 compared with respective negative control.

Figure S3. Western blot analysis of BH3‐only protein (Puma, Noxa and Bid) after treatment of MPTP. Left graph shows the expression of Puma and Noxa in total protein samples is not changed exacted from midbrain at day 4 after the last injection of MPTP. Although MPTP treatment upregulated the expression of Bid, the agomir of miR‐124 could not counter‐regulate it.

Figure S4. JC‐1 staining in the SH‐SY5Y cells transfected with miR‐124 inhibitor or negative control was analyzed by Fluorescence‐activated cell sorting.


Articles from Brain Pathology are provided here courtesy of Wiley

RESOURCES