Skip to main content
The Journal of Clinical Hypertension logoLink to The Journal of Clinical Hypertension
. 2016 Nov 29;19(5):524–529. doi: 10.1111/jch.12949

Liddle syndrome: clinical and genetic profiles

Yunying Cui 1, Anli Tong 1,✉, Jun Jiang 2, Fen Wang 1, Chunyan Li 1
PMCID: PMC8030933  PMID: 27896928

Abstract

Liddle syndrome is a rare autosomal dominant monogenic form of hypertension. The authors analyzed clinical and genetic features of 12 cases of Liddle syndrome, the largest sample size ever reported. Clinical data were studied retrospectively. The exon 13 of the β and γ subunits of the epithelial sodium channel were amplified and sequenced in the peripheral blood leukocytes of the patients. The onset age of the 12 patients was 15.5±3.3 years. Their blood pressures were poorly controlled, and serum potassium levels in most patients were <3.0 mmol/L. Upright plasma renin activity and plasma aldosterone concentration were suppressed in all patients. All patients were treated with triamterene, and blood pressures were well controlled and serum potassium levels returned to normal. The serum creatinine level rose to 124 and 161 μmol/L, respectively, in two patients upon triamterene treatment, and returned to normal soon after treatment was discontinued. Eight mutation alleles were identified, and three mutations were newly identified.

Keywords: clinical features, epithelial sodium channel, gene mutation, Liddle syndrome

1. Introduction

Liddle syndrome (MIM #177220) represents a rare autosomal dominant monogenic condition resulting from gain‐of‐function mutations of the epithelial sodium channel (ENaC). ENaC, a channel responsible for Na+ reabsorption in epithelial cells, is composed of three homologous subunits, α ENaC, β ENaC, and γ ENaC, encoded by SCNN1A, SCNN1B, and SCNN1G, respectively.1 Virtually all previously reported mutations in Liddle syndrome were missense, nonsense, or frameshift mutations located at the C‐terminal ends of the β and γ subunits of ENaC.1 Liddle syndrome is extremely rare and characterized by early‐onset salt‐sensitive hypertension, hypokalemia, and metabolic alkalosis. No more than 100 families or sporadic cases have been identified since Liddle first described the condition in 1963,2 and most of them were described in case reports. Presented in this study are clinical and genetic features of 12 cases of Liddle syndrome. To our knowledge, this is the largest sample size of the condition that has been reported.

2. Methods

2.1. Patients

We retrospectively studied the clinical data of 12 patients diagnosed with Liddle syndrome in Peking Union Medical College Hospital from 2002 to 2015. Clinical data, including symptoms, maximal blood pressure (BP), and minimal serum potassium levels in the past; use of antihypertensive drugs; and family history were collected. Data at admission, including BP, serum creatinine, electrolytes, urinalysis, arterial blood gas, plasma renin activity (PRA), and plasma aldosterone concentration (PAC) were also obtained. Candidates with secondary hypertension, such as renal diseases, renovascular diseases, hyperthyroidism, primary aldosteronism, pheochromocytoma, congenital adrenal hyperplasia, and Cushing syndrome, were excluded. Five patients had received spironolactone 60 mg three times a day for at least 2 weeks, and showed no changes in their BP or serum potassium levels. All patients were treated with triamterene. The patients were clinically diagnosed as having Liddle syndrome on the basis of early‐onset hypertension, hypokalemia, metabolic alkalosis, low PRA, normal or low PAC, nonresponsiveness to spironolactone treatment, and responsiveness to triamterene treatment. The study was approved by the local ethics committee and informed consent was obtained from the patients and family members.

2.2. Genetic analysis

Genomic DNA was extracted from peripheral blood leukocytes by using DNAzol (Life Technologies, Carlsbad, CA) in all but one patient (patient K). Polymerase chain reaction (PCR) was employed to amplify the exon 13 of the β and γ subunits of ENaC by using two gene‐specific primer pairs:

SCNN1B (367bp): forward: 5′‐CTGCTCTCGAATCTGGGTGG‐3′, reverse: 5′‐TGGCATCACCCTCACTGTCA‐3′; SCNN1G (509bp): forward: 5′‐TAGCCAGGTCTCAGGTCGGA‐3′, reverse: 5′‐CTCCAAGCGCAAGGTATTGT‐3′. The PCR products were bidirectionally sequenced on an ABI3730 DNA Analyzer (Applied Biosystems, Foster City, CA). All the reagents for amplification were purchased from QIAGEN (Hilden, Germany).

3. Results

3.1. Clinical and biochemical features

All patients had intermittent headaches or dizziness. Four of the 12 patients had palpitations, and one had received radiofrequency ablation because of frequent ventricular premature beats. Nine of the 12 patients had limb asthenia, and one had frequent flaccid paralysis. Other clinical and biochemical findings of the series are shown in Table 1. Patients B1 and B2 came from the same family. The onset age of the 12 patients was, on average, 15.5±3.3 years. The BP of the patients was poorly controlled despite taking two to three antihypertensive drugs except ENaC blockers. Serum potassium levels in most patients were <3.0 mmol/L despite potassium supplementation (80–120 mmol daily). Upright PRA and PAC were suppressed in all patients. At the first visit, some patients were screened for hypertensive complications: three of four patients were echocardiographically diagnosed as having left ventricular hypertrophy. In four of five patients, fundus examination showed hypertensive retinopathy. Four patients had urine protein (>0.15 g/24 h), and one developed chronic kidney failure during follow‐up. Patients A, B, and C had a family history of Liddle syndrome presumably because of hypertension and hypokalemia family history. Patients D and I had suspicious family history, because two of his family members had early onset of cerebrovascular events. The family members of patients E, F, G, H, and J had neither hypertension nor hypokalemia, or had no mutations after developing hypertension. The family members of patient K had late‐onset hypertension without hypokalemia. We proposed that patients F and G developed Liddle syndrome because of a de novo mutation, and patients E, H, J, and K developed Liddle syndrome because of a de novo mutation, or there was incomplete penetrance of the phenotype for their parents (Table 2).

Table 1.

Clinical and biochemical characteristics of the patients with Liddle syndrome

Clinical History At Admission Spironolactone Treatment Triamterene Treatment
Patient Sex Age at Onset, y Age at Diagnosis, y BP max, mm Hg Serum K min, mmol/L BPa mm Hg Serum Kb mmol/L 24‐hUK, mmol SBE PRA, ng/mL/h PAC, ng/dL BP, mm Hg Serum K, mmol/L BP, mm Hg Serum K, mmol/L
A M 17 45 180/120 2.6 145/95 2.9 64 2.5 0.1 7.9 – – 120/80 4.4
B1 M 23 31 230/150 2.0 160/115 2.6 45 3.4 0.1 13.4 165/85 2.5 150/85 2.9
B2 M 10 16 190/120 2.9 160/115 3.3 51 4.1 0.5 6.0 125/85 4.5
C F 14 32 190/130 2.1 140/90 2.5 81 4.8 0.7 9.0 130/90 3.0 120/70 4.0
D M 17 18 200/120 2.7 150/90 2.9 70 3.2 0.2 15.0 135/80 3.1 125/70 4.0
E F 18 24 180/140 2.1 120/90 3.0 – 2.1 0.4 7.7 – – 125/85 4.0
F M 13 14 160/85 2.0 135/75 3.0 74 4.2 0.1 6.3 – – 135/85 3.7
G M 13 14 212/120 3.1 150/110 3.6 45 0.7 0.3 11.4 – – 120/80 4.5
H F 15 20 190/120 2.6 140/90 2.9 26 3.5 0.1 15.7 – – 135/75 3.8
I M 15 27 200/110 1.9 150/90 3.0 93 3.4 0.1 11.3 150/86 3.3 130/80 3.5
J M 14 26 185/110 1.8 155/95 2.4 – – 0.4 12.2 – – 125/80 4.0
K M 17 30 240/130 1.6 165/105 2.8 57 5.0 0.1 15.5 155/105 3.1 140/90 3.9
Mean±SD 15.5±3.3 24.8±9.1 196±22/121±16 2.3±0.5 147±12/97±11 2.9±0.3 55±26 3.1±1.5 0.25±0.2 11.0±3.5 147±14/87±10 3.0±0.3 129±9/80±6 3.9±0.4

Abbreviations: F, female; K, potassium; M, male; PAC, plasma aldosterone concentration, normal range: 6.5–29.5 ng/dL; PRA, plasma renin activity, normal range: 0.9–6.6 ng/mL/h; SD, standard deviation; –, unavailable; 24UK, 24‐hour urinary potassium excretion.

a

The patients had two or three antihypertensive drug therapy except epithelial sodium channel blockers.

b

The patients had oral potassium supplement.

Table 2.

Clinical characteristics of family members

Patients Clinical characteristics of family members
A His mother died of stroke at age 32 with unknown blood pressure (BP) and serum potassium (sk+) levels. Two sisters and brother had hypertension and hypokalemia.
B1 His mother died suddenly at age 28 with unknown BP and sk+ levels. His sister and his son (patient B2) had hypertension and hypokalemia (sister: BP 170/110 mm Hg).
C Her mother, brother, and nephew developed hypertension and hypokalemia (mother: BP 170/110 mm Hg, sk+ 2.75–3.3 mmol/L; brother: BP 180/110 mm Hg, sk+ 2.9 mmol/L; nephew: BP 140/90 mm Hg, sk+ 2.8 mmol/L). Two other brothers experienced sudden death with unknown reasons around age 40 with unknown BP and sk+ levels.
D His mother was diagnosed with hypertension at the age of 20 and died of stroke at about age 30. By genetic screening, his father was excluded from the diagnosis of Liddle syndrome.
E Her father did not have hypertension or hypokalemia. Her mother had hypertension, but genetic screening excluded the diagnosis of Liddle syndrome.
F Genetic screening revealed that his parents did not have Liddle syndrome.
G Genetic screening showed that his parents did not have Liddle syndrome.
H Her mother did not have hypertension or hypokalemia. Her father had hypertension, but genetic screening revealed no Liddle syndrome.
I His brother and mother died of stroke at the age of 30 and 40, respectively, with BP and sk+ levels unknown.
J Her parents did not have hypertension or hypokalemia.
K He had a family history of hypertension. Those family members with hypertension developed hypertension after age 40 and did not have hypokalemia.

Five patients were given spironolactone (60 mg 3 times a day) for at least 2 weeks and showed no response in terms of BP and serum potassium level. All of the patients were then treated with triamterene (50–100 mg 3 times a day), after which BP was well controlled and serum potassium level returned to normal in all patients (Table 1). Upon triamterene treatment, in two patients (patients A and D), creatinine level rose to 124 μmol/L and 161 μmol/L, respectively. After treatment was discontinued, serum creatinine levels returned to normal. Triamterene treatment was withdrawn in one patient because of adverse gastrointestinal reactions.

3.2. Genetic analysis

Eight mutation alleles (Figure) were identified in 11 patients, which were c.1690C>T (p.Arg564Ter), c.1696C>T (p.Arg566Ter), c.1702C>T (p.Gln568Ter), c.1849C>T (p.Pro617Ser), c.1853C>T (p.Pro618Leu), c.1806_1807insG (p.Pro603Alafs*5), c.1848_1849insT (p.Pro617Serfs*5), and c.1854_1855insC (p.Asn619Glnfs*3). p.Arg566Ter was found in two patients (patients C and D) and p.Pro603Alafs*5 was identified in another three patients (patients A, B1, and B2). Three of the eight mutations, ie, p.Gln568Ter, p.Pro603Alafs, and p.Pro617Serfs, were newly identified. They were predicted to be disease‐causing mutation sites as suggested by mutationtaster2 analysis, and had not been found in 1000 unrelated normal controls.

Figure 1.

Figure 1

Transition from C to T in different DNA sequences lead to a missense mutation of Arg564Ter, Arg566Ter, and Gln568Ter, respectively, which causes a premature stop codon. Transition from C to T gives rise to the missense mutations of Pro617Ser and Pro618Leu. Insertion of an additional G, T, or C causes mutations Pro603Alafs, Pro617Serfs, and Asn619Glnfs, respectively, which altered the reading frame of the PY motif

3.3. Relationship between genotypes and clinical features

Five Liddle syndrome‐related mutations have been previously reported.3, 4, 5, 6, 7, 8 To clarify whether the phenotypes are similar in the patients with the same mutation, we analyzed the clinical and biochemical profiles of the patients in our series and features of previously reported cases (Table 3). We found that the patients with the same mutation had identical clinical manifestations. Moreover, their clinical features were also similar even when their mutation sites were different.

Table 3.

Comparison of clinical and biochemical characteristics of our patients with previously reported cases who have the same mutations

Mutation Alleles Patient Sex Age at Onset, y Age at Diagnosis, y BP, mm Hg Serum K, mmol/L PRA, ng/mL/h PAC, ng/dL Triamterene Treatment
BP, mm Hg Serum K, mmol/L
p.Arg566Ter C F 14 32 190/130 2.5 ↓ ↓ 120/70 4.0
D M 17 18 200/120 2.9 ↓ ↓ 125/70 4.0
Wang3 M 13 – 180/110 3.2 ↓ ↓ 130/70 4.0
Gong4 M 15 – 200/140 2.8 ↓ ↓ Controllable Normal range
p.Arg564Ter E F 18 24 180/140 3.0 ↓ ↓ 125/85 4.0
Melander5 F – 60 160/80 3.8 – –
F – 20 185/120 3.4 ↓ – – –
F – 30 190/115 3.3 ↓ ↓ – –
M – 18 140/90 3.7 ↓ ↓ – –
F – 16 115/80 3.8 – ↓ – –
M – 27 135/80 4.0 – – – –
p.Pro617Ser H F 15 20 190/120 2.9 ↓ ↓ 135/75 3.8
Inoue6 M – 28 142/92 3.4 ↓ ↓ Effective Effective
M – 27 174/120 3.5 ↓ ↓ Effective Effective
M – 20 160/100 3.3 ↓ ↓ Effective Effective
p.Pro618Leu J M 14 26 185/110 3.0 ↓ ↓ 125/80 4.0
Hansson7 – 15 41 180/140 2.8 ↓ ↓ 122/70 –
– 1.5 11 140/95 2.9 ↓ ↓ 115/63 –
– 1.5 13 130/90 3.3 ↓ ↓ – –
p.Asn619Gln I M 15 – 200/110 3.0 ↓ ↓ 130/80 3.5
Yang8 M 17 – 160/100 3.1 ↓ ↓ 110/80 4.1

Abbreviations: F, female; K, potassium; M, male; PAC: plasma aldosterone concentration (normal range: 6.5–29.5 ng/dL); PRA, plasma renin activity (normal range: 0.93–6.56 ng/mL/h); ↓, low plasma renin activity or low plasma aldosterone concentration; –, unavailable.

4. Discussion

The genetic abnormalities of Liddle syndrome involve mutations on chromosome 16p12, encoding β and γ subunits of the collecting tubule sodium channel, labelled SCNN1B and SCNN1G, respectively. Deletions or substitutions in a short proline‐rich amino acid sequence (PPPXYXXL codon, the so‐called PY motif, p.614‐621 in exon 13) of the C‐terminus of SCNN1B and SCNN1G lead to inability of these subunits to bind to an intracellular ubiquitin protein ligase (Nedd4) that normally removes the luminal sodium channel from the cell surface. Gene mutations result in increased ENaC channels on the cell surface, thereby promoting sodium reabsorption and potassium secretion in collecting tubules.9, 10, 11

Clinically, Liddle syndrome is characterized by, among others, the triad of hypertension, hypokalemia, and metabolic alkalosis that develop at a relatively young age and by consistently low PRA and PAC levels. In our series, all but one patient had onset of disease at adolescence. All patients typically had refractory hypertension and hypokalemia and lowered PRA and PAC. Their BP was poorly controlled even after treatment with two or more antihypertensive drugs, while they responded well to triamterene, an ENaC blocker. These findings suggest that early diagnosis and correct treatment are keys to attaining a favorable prognosis.

Our patients were treated with large doses of spironolactone for at least 2 weeks and showed no response. Therefore, the diagnosis of primary aldosteronism could be tentatively excluded. All of the patients responded well to triamterene. Potassium‐sparing diuretics, amiloride or triamterene, can directly block the sodium channels of collecting tubules, and thus effectively control both hypertension and hypokalemia in patients with Liddle syndrome. Therefore, the different responses to spironolactone and triamterene treatment support the clinical diagnosis of Liddle syndrome. Two patients had elevated serum creatinine levels after triamterene therapy and such a scenario had not been previously reported in patients with Liddle syndrome or in the general population. Patients with Liddle syndrome, similar to their counterparts with primary aldosteronism,12 have an exaggerated blood volume, leading to an increased glomerular filtration rate and creatinine clearance rate. Triamterene treatment can ameliorate high blood volume, thereby lowering increased creatinine clearance rate. As a result, in these patients, serum creatinine level was elevated after the triamterene treatment. Other factors might also contribute to the increased serum creatinine level in some patients, as suggested by one of our patients (patient D) who had a remarkably increased serum creatinine level. Our study showed that serum creatinine returned to normal after withdrawal of drug treatment, suggesting that triamterene‐induced change is functionally reversible. Therefore, serum creatinine level should be dynamically monitored during treatment, especially in patients with renal insufficiency. In addition, as with spironolactone, caution should be exercised when ENaC blockers are given to patients with chronic renal disease whose creatinine level is significantly elevated.

Until now, all reported Liddle syndrome–related mutations were missense within the PY motif and nonsense and frameshift mutations before or within the PY motif SCNN1B or SCNN1G, and a total of 27 mutations have been found, including 12 missense mutations, eight nonsense mutations, and seven frameshift mutations. In this study, we identified two missense mutations, three nonsense mutations, and three frameshift mutations in SCNN1B, and three novel mutations were found: p.Gln568Ter, p.Pro603Alafs, and p.Pro617Serfs. Mutations p.Arg564Ter, p.Arg566Ter, and p.Gln568Ter lead to a premature stop codon that deletes the PY motif of β subunit. Mutations p.Pro603Alafs, p.Pro617Serfs, and p.Asn619fs alter the reading frame of the PY motif, and p.Pro617Ser and p.Pro618Leu were missense mutations within the PY motif. We found that the patients with the same mutation had identical clinical manifestations, and their clinical features were also similar even when their mutation sites were different.

5. Study Limitations

Our study has limitations. First, genetic screening was performed only in patients with early‐onset hypertension or hypertension combined with hypokalemia. We might have excluded some atypical patients with Liddle syndrome. Less severe cases of Liddle syndrome may exist, which may be more common than we know. Systematic studies of hypertensive populations are needed to determine the spectrum and prevalence of Liddle syndrome. Last, we did not sequence the mutated genes of all family members.

6. Conclusions

Our study showed that patients with Liddle syndrome had severe early‐onset hypertension and hypokalemia. Eight gene mutations in SCNN1B were found in our series, and three mutated genes were newly identified. Clinical features of the patients were similar although their mutation sites varied. The patients responded well to triamterene therapy, but serum creatinine levels need to be closely monitored during therapy. Early diagnosis and correct treatment are keys to achieving a favorable outcome.

Disclosure statement

The authors have nothing to disclose.

Cui Y, Tong A, Jiang J, Wang F, Li C. Liddle syndrome: clinical and genetic profiles. J Clin Hypertens. 2017;19:524–529. 10.1111/jch.12949

Funding information

This work was supported by research grants from the National Key Program of Clinical Science of China (No. WBYZ2011‐873).

References

  • 1. Schild L. The ENaC channel as the primary determinant of two human diseases: Liddle syndrome and pseudohypoaldosteronism. Nephrologie. 1996;17:395–400. [PubMed] [Google Scholar]
  • 2. Liddle GWBTCW. A familial renal disorder simulating primary aldosteronism but with negligible aldosterone secretion. Trans Assoc Am Physicians. 1963;79:199–213. [Google Scholar]
  • 3. Wang L, Yang K, Jiang X, et al. Prevalence of Liddle syndrome among young hypertension patients of undetermined cause in a Chinese population. J Clin Hypertens. 2015;17:902–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Gong L, Chen J, Shao L, Song W, Hui R, Wang Y. Phenotype—genotype analysis in two Chinese families with Liddle syndrome. Mol Biol Rep. 2014;41:1569–1575. [DOI] [PubMed] [Google Scholar]
  • 5. Melander O, Orho M, Fagerudd J, et al. Mutations and variants of the epithelial sodium channel gene in Liddle's syndrome and primary hypertension. Hypertension. 1998;31:1118–1124. [DOI] [PubMed] [Google Scholar]
  • 6. Inoue JITTH. A family with Liddle's syndrome caused by a new missense mutation in the beta subunit of the epithelial sodium channel. J Clin Endocrinol Metab. 1998;83:2210–2213. [DOI] [PubMed] [Google Scholar]
  • 7. Hansson JH, Schild L, Lu Y, et al. A de novo missense mutation of the beta subunit of the epithelial sodium channel causes hypertension and Liddle syndrome, identifying a proline‐rich segment critical for regulation of channel activity. Proc Natl Acad Sci U S A. 1995;92:11495–11499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Yang K, Lu C, Xiao Y, et al. A novel frameshift mutation of epithelial sodium channel β‐subunit leads to Liddle syndrome in an isolated case. Clin Endocrinol. 2015;82:611–614. [DOI] [PubMed] [Google Scholar]
  • 9. Yang K, Xiao Y, Tian T, Gao L, Zhou X. Molecular genetics of Liddle's syndrome. Clin Chim Acta. 2014;436:202–206. [DOI] [PubMed] [Google Scholar]
  • 10. Snyder PM, Price MP, McDonald FJ, et al. Mechanism by which Liddle's syndrome mutations increase activity of a human epithelial Na+ channel. Cell. 1995;83:969–978. [DOI] [PubMed] [Google Scholar]
  • 11. Lu C, Pribanic S, Debonneville A, Jiang C, Rotin D. The PY motif of ENaC, mutated in Liddle syndrome, regulates channel internalization, sorting and mobilization from subapical pool. Traffic. 2007;8:1246–1264. [DOI] [PubMed] [Google Scholar]
  • 12. Sechi LA, Di Fabio A, Bazzocchi M, Uzzau A, Catena C. Intrarenal hemodynamics in primary aldosteronism before and after treatment. J Clin Endocrinol Metab. 2009;94:1191–1197. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Clinical Hypertension are provided here courtesy of Wiley

RESOURCES