Abstract
The angiotensin‐converting enzyme insertion/deletion (I/D) gene polymorphism has been widely reported as being associated with hypertension; however, most studies do not consider environmental/behavioral factors. This study aimed to investigate the relationship among angiotensin‐converting enzyme insertion/deletion gene polymorphism, environmental/behavioral factors, and hypertension in community‐dwelling elderly individuals. All community‐dwelling older adults from Aiquara, Bahia, Brazil, were invited to take part in this study. After exclusions, 234 elderly participants were submitted to a data collection, which included sociodemographics, lifestyle and health status questionnaires, clinical assessment, and blood withdrawal. From the blood samples, the gene polymorphism was identified through polymerase chain reaction and patients grouped as II or D allele carriers (ID and DD genotypes). Hypertension was defined by self‐report of the condition and confirmed by antihypertensive drug treatment. Chi‐square test was used to identify differences in the proportions distributed between groups of each dependent variable (ie, genotype, diagnosis of hypertension, and blood pressure state from medicated patients with hypertension). The prevalence of hypertension was 59.3% and was associated with diabetes mellitus and obesity, but not with angiotensin‐converting enzyme insertion/deletion gene polymorphism. However, carriers of the II genotype, a salt‐sensitivity genotype, exhibited a significantly greater estimated sodium intake. In addition, among medicated elderly patients with hypertension, II genotype carriers exhibited poor blood pressure control, despite similar antihypertensive drug treatment in D allele carriers, while exhibiting a greater estimated sodium intake. Our results provide new evidence regarding the interaction of genetic and environmental/behavioral factors in the genesis of hypertension among elderly patients, as well as in blood pressure control in medicated elderly patients with hypertension.
Keywords: dietary sodium, genetic polymorphism, hypertension, sodium sensitivity
1. INTRODUCTION
The increase in life expectancy, accompanied by an improvement in health indicators, is a great contemporary achievement.1 However, observed changes in the population pyramid have become one of the major concerns, increasing the need for research involving chronic noncommunicable diseases.2
Noncommunicable diseases accounted for 68% of worldwide deaths in 2012,3 contributing to 72.7% of deaths recorded in Brazil in 2011.4 Among noncommunicable diseases, hypertension has a high prevalence and low rate of control, being an important public health problem.5
Hypertension is a multifactorial disease associated with a large number of modifiable (eg, obesity, excessive sodium intake, and physical inactivity) and nonmodifiable risk factors (eg, age, sex, ethnicity, and genetics) that are identified as predisposing or aggravating.5
Salt intake, a major source of sodium in the general population, is at least two times greater than the recommendation6 and 10 times greater than what was consumed in the past.7 A high‐salt diet increases cardiovascular morbidity and mortality, being clearly associated with hypertension.8 Notwithstanding, genetic factors, such as angiotensin‐converting enzyme (ACE) gene polymorphisms, a key element in the renin‐angiotensin‐aldosterone system, have been associated with hypertension,9 as well as sodium sensitivity,10 defined as an increase in blood pressure (BP) in response to a higher sodium intake.
Interestingly, sodium sensitivity is heightened with age.11
The ACE insertion/deletion (I/D) gene polymorphism has been widely reported as being associated with hypertension12, 13; however, most studies that support this hypothesis come from research involving young adults,14, 15 and studies about this issue involving older people are scarce.
It is reported that patients who carry the D allele have high plasma concentrations of ACE,16 leading to deleterious vascular events, such as an increased peripheral vascular resistance, loss of arterial elasticity, and elevated BP,14 justifying the hypothesis regarding the association between the presence of the D allele and hypertension.
It is important to note that, in sodium sensitivity, many physiological functions that contribute to hemodynamic control are impaired with aging17; thus, the same genetic background could interact differently (ie, in a different way or strength) with environmental factors along life.
Therefore, this study aimed to analyze the relationship between hypertension and ACE I/D gene polymorphism in community‐dwelling older people and to identify associated factors that influence this relationship.
2. METHODS
All community‐dwelling older people (≥60 years) from Aiquara, Bahia, Brazil, were invited (home visit) to take part in this survey study. A total of 289 patients were screened; however, bedridden individuals and/or those with severe cognitive impairment (n = 20) were excluded. In addition, 11 participants did not consent to blood withdrawal, and 24 had technical problems with their blood samples, limiting gene polymorphism identification. Written informed consent was obtained from all participants, and all procedures were approved by the local ethics committee according to the Helsinki Declaration.
2.1. Data collection
Data collection was performed from January to July 2015 and involved three groups of variables: questionnaires, clinical assessment, and collection of biological samples. From the questionnaires, data recordings from sociodemographic characteristics including sex, age, lifestyle habits (smoking), self‐reported health status (previous diagnosis of diabetes mellitus [DM] and hypertension), and medications currently in use, were used in this study. The presence of hypertension and DM were defined based on self‐reported disease and/or the use of antihypertensive and antidiabetic medications.
The variables sex (men or women), current smoking habit (yes or no), and previous diagnosis of DM and hypertension (yes or no for each disease) were dichotomized. Racial classifications were stratified according to Azevêdo and colleagues18 owing to the racial admixture characteristics of the studied population. Physical activity level was obtained from the International Physical Activity Questionnaire (IPAQ) and data dichotomized according to the proposed cutpoint of ≥150 min/wk of moderate and vigorous activity (ie, ≥150 min/wk, sufficiently active; <150 min/wk, insufficiently active) according to the World Health Organization.19 Daily foods and beverages consumed were recorded through a 24‐hour recall, as recommended by Rutishauser,20 and the sodium content of each ingested food and beverage was calculated with NutWin version 1.6 software. The estimated daily sodium intake was dichotomized as normal (<2 g/d) or high (≤2 g/d) according to the World Health Organization recommendation for sodium intake (<2 g/d).6
After recording questionnaires during home visits, participants were scheduled to attend Aiquara Municipal Hospital, where they underwent a venous blood withdrawal (10 mL from the antecubital vein) and anthropometric assessment. Blood samples were used for DNA processing, as described hereafter, and height and body mass measures were used from anthropometric assessment in this study. Body mass index (BMI) was calculated and participants were classified as eutrophic or dystrophic, and included overweight and obesity I, II, and III, since no one was classified as underweight.21
Systolic BP and diastolic BP were assessed using oscillometric method with a validated automatic device (model HEM 742 Intellisense, Omron Healthcare, Inc.).22 The mean of two BP (systolic BP and diastolic BP) measures taken 5 minutes apart was used in the analyses.
2.2. Gene polymorphism identification
DNA extracted from blood samples was submitted for identification of ACE I/D polymorphism (rs4646994) using polymerase chain reaction amplification of the region of intron 16 of the gene for ACE to determine whether the Alu repeat sequences were present. This polymorphism is characterized by the presence (insertion) or absence (deletion) of a 287‐base pair Alu repeat within intron 16 of the gene. The presence of the deletion (D) allele has been associated with higher concentrations of circulating ACE.23
First, whole blood aliquots were submitted to DNA extraction using the QIAamp DNA Blood Mini Kit (QIAGEN Inc.) according to the procedure provided by the manufacturer. DNA sequences were amplified using primers flanking the polymorphic region (sense 5′CTG‐GAG‐ACC‐ACT‐CCC‐ATC‐CTT‐TCT3′ and antisense 5′GAT‐GTG‐GCC‐ATC‐ACA‐TTC‐GTC‐AGA‐T3′). Polymerase chain reaction profiling and genotyping of I/D polymorphisms were conducted as previously described.24 For each set of reactions, a negative control containing H2O instead of DNA was performed to check for contaminations, and random samples were reanalyzed to check whether results were identical for all samples.
To avoid the possibility of erroneous classification of ID heterozygotes as DD homozygotes,25 all DD samples were reamplified by a second primer pair specific for the inserted sequence (sense 5′‐TGGGACCACAGCGCCCGCCACTAC‐3′ and antisense 5′‐TCGCCAGCCCTCCCATGCCCATAA 3′).
The fragments resulting from the polymerase chain reactions were stained with bromophenol blue and red gel and then detected by conventional agarose gel (2%) electrophoresis. The fragments in each gel were visualized under UV light and the images were digitalized using a transluminator with the image capture software L‐Pix Image version 1.21 (Loccus Biotecnologia, Locus do Brazil, Cotia, SP, Brazil). Differences in the electrophoretic profile were used to genotype the patients (Figure 1).
Figure 1.
A 2% agarose gel representative of the angiotensin‐converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism. Left gel: DNA fragments with 597 bp (I) and 310 bp (D), indicating patients carrying II, ID, and DD genotypes. DNA ladder 50 bp (LD) and negative control (C−) are also presented. Right gel: Gel with the second primer pair specific for the inserted sequence (ie, 597 bp). DNA fragments with 597 bp confirmed (I+) and absent (I−)
2.3. Statistical analysis
After genotype analyses, patients were classified according to allele frequency: II, ID, or DD. Chi‐square test was used to determine whether observed genotype frequency was in Hardy‐Weinberg equilibrium.26
Considering the evidence of increased risk of hypertension in patients carrying the D allele,23 participants were grouped on the basis of D allele of ACE gene: those carrying the ID or DD genotype and those carrying the II genotype.
Statistical analysis was performed in two steps based on the dependent variables: genotype (ie, II vs DD/ID) and diagnosis of hypertension (ie, hypertension vs normotension). In addition, with the aim of verifying hypertension control among the patients with hypertension, a third step was conducted considering only patients with hypertension according to BP state (ie, good BP control [<140/90 mm Hg] vs poor BP control [≥140/90 mm Hg]), as recommended by the Brazilian Society of Cardiology.5
In order to identify differences in proportions distributed between groups of each dependent variable (ie, genotype, diagnosis of hypertension, and BP state), chi‐square test was used. Sex, race, BMI, smoking habit, hypertension, DM, physical activity level, estimated sodium intake, and antihypertensive medications were studied as independent variables.
Considering the results obtained in the third step of statistical procedures, two other steps were conducted, including only patients with hypertension (n = 137) stratified according to the ACE I/D polymorphism as: patients with hypertension carrying the D allele or II genotype (ie, the fourth step), and including only patients with hypertension with poor BP control (n = 54), also stratified according to the ACE I/D polymorphism (ie, the fifth step) as: patients with hypertension with poor BP control carrying the D allele or II genotype (ie, the fifth step). For the fourth and fifth steps, logistic regression technique was applied aiming to calculate estimates of the odds ratio (OR) and its confidence intervals (CIs) for hypertension and for poor BP control among patients with hypertension carrying the D allele or II genotype from ACE I/D gene polymorphism, according to estimated daily sodium intake (ie, the independent variable).
A power analysis was performed using G*POWER software to evaluate whether we were able to find a meaningful reliability with our results from the logistic regression.27 We performed a post hoc power analysis to compute statistical power (1‐β) using the sample sizes and achieved ORs in each logistic regression analyses,27 described above as the fourth and fifth steps, and with an α level of 0.05.
For all other statistical analyses, an α level was set as 5% and procedures were performed using IBM SPSS version 21.0 (IBM).
3. RESULTS
A total of 234 elderly patients (138 [59%] women; 96 [41%] men) participated in this study, with a mean age of 71.8 ± 7.8 years. The prevalence of hypertension in the studied population was 59.3% (n = 137). Hypertension was more prevalent (P ≤ .05) in patients with DM or dystrophy, as presented in Table 1. A total of 79% of elderly patients with DM also had hypertension, while 64.8% of elderly patients with hypertension exhibited overweight (25.0–29.9 BMI) or obesity, classified as grade 1 (30.0–34.9 BMI), 2 (35.0–39.9 BMI), or 3 (≥40 BMI).
Table 1.
Characterization of the studied community‐dwelling elderly patients according to hypertension diagnosis
| Variables | Normotension | Hypertension | P value |
|---|---|---|---|
| No. (%) | No. (%) | ||
| Sex | |||
| Women | 52 (55.3) | 86 (62.8) | .256 |
| Men | 42 (44.7) | 51 (37.2) | |
| Racial classification | |||
| White | 15 (16.3) | 17 (13.2) | .814 |
| Light mulatto | 20 (21.7) | 23 (17.8) | |
| Medium mulatto | 33 (35.9) | 55 (42.6) | |
| Dark mulatto | 14 (15.2) | 18 (14.0) | |
| Black | 10 (10.9) | 16 (12.4) | |
| Smoking habit | |||
| Yes | 11 (12.2) | 11 (8.8) | .414 |
| No | 79 (87.8) | 114 (91.2) | |
| Diabetes mellitusa | |||
| Yes | 10 (10.6) | 38 (27.7) | .002 |
| No | 84 (89.4) | 99 (72.3) | |
| Body mass indexa | |||
| Eutrophic | 39 (48.1) | 42 (34.4) | .05 |
| Dystrophic | 42 (51.9) | 80 (65.6) | |
| Physical activity levelb | |||
| Sufficiently active | 48 (53.9) | 73 (57.5) | .605 |
| Insufficiently active | 41 (46.1) | 54 (42.5) | |
| Sodium intakec | |||
| Normal | 72 (80.0) | 102 (75.6) | .435 |
| High | 18 (20.0) | 33 (24.4) | |
Data from Aiquara, Bahia, Brazil (2015).
Significant difference in distribution between groups (ie, those with normotension and those with hypertension).
Physical activity level was dichotomized as sufficiently active (≥150 min/wk) or insufficiently active (<150 min/wk).
Estimated daily sodium intake was dichotomized as normal (<2 g/d) or high (≤2 g/d).
ACE I/D genotype distribution in the studied population was: II 18.4% (n = 43), ID 47% (n = 110), and DD 34.6% (n = 81). The chi‐square analysis indicated that the genotype frequencies of patients were in Hardy‐Weinberg equilibrium (P > .05), following the expected genotype distribution for this population, and in line with the distribution expected for a miscegenated population.28
Table 2 shows the characteristics of the studied population according to defined genotypes (ie, II vs ID/DD). There was no significant difference in distribution of race classification, smoking habit, DM diagnosis, BMI, and physical activity level between the genotype groups. Among the 137 elderly patients with hypertension, the prevalence of hypertension in the II genotype carriers was 62.8%, while for elderly patients carrying the D allele (ie, ID/DD) it was 58.5%. It is notable that there was no significant difference in distribution of elderly patients with hypertension between genotypes; however, a significantly greater (P = .003) proportion of elderly patients carrying the II genotype (39.5%) exhibited an estimated daily sodium intake above the recommended level (<2 g/d), when compared with the proportion of elderly patients carrying the D allele (18.7%).
Table 2.
Characterization of studied community‐dwelling elderly patients according to ACE I/D genotypes (II vs ID/DD)
| Variables | II | ID/DD | P value |
|---|---|---|---|
| No. (%) | No. (%) | ||
| Sex | |||
| Women | 24 (55.8) | 114 (59.7) | .641 |
| Men | 19 (44.2) | 77 (40.3) | |
| Hypertension | |||
| Yes | 27 (62.8) | 110 (58.5) | .606 |
| No | 16 (37.2) | 78 (41.5) | |
| Racial classification | |||
| White | 5 (11.9) | 27 (15.0) | .849 |
| Light mulatto | 9 (21.4) | 34 (18.9) | |
| Medium mulatto | 16 (38.1) | 73 (40.6) | |
| Dark mulatto | 8 (19.0) | 24 (13.3) | |
| Black | 4 (9.5) | 22 (12.2) | |
| Smoking habit | |||
| Yes | 5 (12.5) | 17 (9.7) | .570 |
| No | 35 (87.5) | 158 (90.3) | |
| Diabetes mellitus | |||
| Yes | 11 (25.6) | 37 (19.7) | .570 |
| No | 32 (74.4) | 151 (80.3) | |
| Body mass index | |||
| Eutrophic | 15 (39.5) | 66 (43.1) | .838 |
| Dystrophic | 23 (60.5) | 87 (56.9) | |
| Physical activity levelb | |||
| Sufficiently active | 24 (58.5) | 99 (55.9) | .762 |
| Insufficiently active | 17 (41.5) | 78 (44.1) | |
| Sodium intakea,c | |||
| Normal | 26 (60.5) | 148 (81.3) | .003 |
| High | 17 (39.5) | 34 (18.7) | |
ACE, angiotensin‐converting enzyme; D, deletion, I, insertion.
Data from Aiquara, Bahia, Brazil (2015).
Significant difference in distribution between groups (ie, those with II vs those with ID/DD).
Physical activity level was dichotomized as sufficiently active (≥150 min/wk) or insufficiently active (<150 min/wk) .
Estimated daily sodium intake was dichotomized as normal (<2 g/d) or high (≤2 g/d).
The mean estimated daily sodium intake of the studied population was 1.84 g, with a minimum and maximum of 0.09 and 11.30 g, respectively. However, the mean estimated daily sodium intake among elderly patients carrying the II genotype was 2.57 g, with a minimum and maximum of 0.15 and 8.64 g, respectively, while for elderly patients carrying the D allele was 1.67 g, with a minimum and maximum of 0.09 and 11.20 g, respectively (Figure 2A).
Figure 2.
Distribution of estimated daily sodium intake from elderly patients carrying the II genotype or D allele from angiotensin‐converting enzyme (ACE) insertion/deletion gene polymorphism. (A) Distribution including all studied elderly patients. (B) Distribution including only elderly patients with hypertension. (C) Distribution including only elderly patients with hypertension with poor blood pressure control
Regarding the use of cardiovascular drugs (ie, number of used drugs), there was no significant difference between studied genotypes and, when stratified by antihypertensive classes, there was also no significant difference between genotypes, as shown in Table 3.
Table 3.
Characterization of cardiovascular drugs used by elderly patients according to ACE I/D genotypes (II vs ID/DD)
| Variables | II | ID/DD | P value |
|---|---|---|---|
| No. (%) | No. (%) | ||
| No. of used cardiovascular drugs | |||
| 0 | 17 (42.5) | 74 (43.0) | .743 |
| 1 | 12 (30.0) | 41 (23.8) | |
| 2 | 7 (17.5) | 39 (22.7) | |
| 3 | 4 (10.0) | 14 (8.1) | |
| 4 | 0 (0) | 4 (8.1) | |
| Thiazide diuretics | |||
| Yes | 5 (12.5) | 37 (21.5) | .198 |
| No | 35 (87.5) | 135 (78.5) | |
| Loop diuretics | |||
| Yes | 2 (5.0) | 14 (8.1) | .742 |
| No | 38 (95.0) | 158 (91.9) | |
| Potassium‐sparing diuretics | |||
| Yes | 0 (0) | 9 (5.2) | .213 |
| No | 40 (100) | 163 (94.8) | |
| ACE inhibitors | |||
| Yes | 7 (17.5) | 28 (16.2) | .840 |
| No | 33 (82.5) | 145 (83.8) | |
| β‐Blockers | |||
| Yes | 7 (17.5) | 26 (15.1) | .708 |
| No | 33 (82.5) | 146 (84.9) | |
| ATR1 blockers | |||
| Yes | 9 (22.5) | 39 (22.7) | .981 |
| No | 31 (77.5) | 133 (77.3) | |
| Calcium channel blockers | |||
| Yes | 7 (17.5) | 21 (12.4) | .397 |
| No | 33 (82.5) | 148 (87.6) | |
ACE, angiotensin‐converting enzyme; ATR1, angiotensin II type 1 receptor; D, deletion, I, insertion.
Data from Aiquara, Bahia, Brazil (2015).
Considering the unexpectedly high proportion of elderly patients with hypertension carrying the ACE II genotype and the significant association between this genotype and the high estimated daily sodium intake, we conducted an analysis including only individuals with hypertension, to examine possible interactions between ACE gene polymorphism and BP control in elderly patients with hypertension (n = 137).
The BP from elderly patients with hypertension was categorized as good BP control (<140/90 mm Hg) or poor BP control (≥140/90 mm Hg), and was used as an indicator of BP control in this population (ie, elderly patients with hypertension). We observed a significant association between BP control and studied genotypes, with a higher percentage having poor BP control (63%) among elderly patients with hypertension carrying the II genotype. A significantly (P = .007) greater proportion of II genotype carriers, specifically, 44.4% of these patients, exhibited an estimated daily sodium intake above recommended values (Table 4 and Figure 2B,C).
Table 4.
Characterization of elderly patients with hypertension according to ACE I/D genotypes (II vs ID/DD)
| Variables | II | ID/DD | P value |
|---|---|---|---|
| No. (%) | No. (%) | ||
| Sex | |||
| Women | 16 (59.3) | 70 (63.6) | .673 |
| Men | 11 (40.7) | 40 (36.4) | |
| Blood pressure controla | |||
| Poor (≥140/90 mm Hg) | 17 (63.0) | 37 (36.6) | .014 |
| Good (<140/90 mm Hg) | 10 (37.0) | 64 (63.4) | |
| Racial classification | |||
| White | 4 (15.4) | 13 (12.6) | .940 |
| Light mulatto | 5 (19.2) | 18 (17.5) | |
| Medium mulatto | 11 (42.3) | 44 (42.7) | |
| Dark mulatto | 4 (15.4) | 14 (13.6) | |
| Black | 2 (7.7) | 14 (13.6) | |
| Smoking habit | |||
| Yes | 4 (16.0) | 7 (7.0) | .228 |
| No | 21 (84.0) | 93 (93.0) | |
| Diabetes mellitus | |||
| Yes | 9 (33.3) | 29 (26.4) | .469 |
| No | 18 (66.7) | 81 (73.6) | |
| Body mass index | |||
| Eutrophic | 8 (30.8) | 34 (35.4) | .658 |
| Dystrophic | 18 (69.2) | 62 (64.6) | |
| Physical activity levelb | |||
| Sufficiently active | 17 (68.0) | 56 (54.9) | .235 |
| Insufficiently active | 8 (32.0) | 46 (45.1) | |
| Sodium intakea,c | |||
| Normal | 15 (55.6) | 87 (80.6) | .007 |
| High | 12 (44.4) | 21 (19.4) | |
ACE, angiotensin‐converting enzyme; D, deletion, I, insertion.
Data from Aiquara, Bahia, Brazil (2015).
Significant difference in distribution between groups (ie, II vs ID/DD).
Physical activity level was dichotomized as sufficiently active (≥150 min/wk) or Insufficiently active (<150 min/wk).
Estimated daily sodium intake was dichotomized as normal (<2 g/d) or high (≤2 g/d).
We found no differences between use of antihypertensive drugs, and ACE gene genotypes in the studied elderly patients with hypertension showed similar distributions for use of different classes of antihypertensive drugs (Table 5).
Table 5.
Use of cardiovascular drugs by elderly patients with hypertension according to ACE I/D genotypes (II vs ID/DD)
| Variables | II | ID/DD | P value |
|---|---|---|---|
| No. (%) | No. (%) | ||
| No. of used cardiovascular drugs | |||
| 0 | 4 (15.4) | 10 (10.5) | .721 |
| 1 | 12 (46.2) | 36 (37.9) | |
| 2 | 7 (26.9) | 34 (35.8) | |
| 3 | 3 (11.5) | 12 (12.6) | |
| 4 | 0 (0.0) | 3 (3.2) | |
| Thiazide diuretics | |||
| Yes | 5 (19.2) | 32 (33.7) | .156 |
| No | 21 (80.8) | 63 (66.3) | |
| Loop diuretics | |||
| Yes | 1 (3.8) | 11 (11.6) | .458 |
| No | 25 (96.2) | 84 (88.4) | |
| Potassium‐sparing diuretics | |||
| Yes | 0 (0.0) | 6 (6.3) | .339 |
| No | 26 (100.0) | 89 (93.7) | |
| ACE inhibitors | |||
| Yes | 7 (26.9) | 26 (27.4) | .964 |
| No | 19 (73.1) | 69 (72.6) | |
| β‐Blockers | |||
| Yes | 6 (23.1) | 21 (22.1) | .919 |
| No | 20 (76.9) | 74 (77.9) | |
| ATR1 blockers | |||
| Yes | 9 (34.6) | 34 (35.8) | .912 |
| No | 17 (65.4) | 61 (64.2) | |
| Calcium channel blockers | |||
| Yes | 6 (23.1) | 20 (21.7) | .884 |
| No | 20 (76.9) | 72 (78.3) | |
ACE, angiotensin‐converting enzyme; ATR1, angiotensin II type 1 receptor; D, deletion, I, insertion.
Data from Aiquara, Bahia, Brazil (2015).
The results from the logistic regression, including only elderly patients with hypertension and as a dependent variable the elderly patients with hypertension (n = 137) classified as elderly patients with hypertension carrying the D allele or II genotype, and the daily sodium intake (normal or high) as an independent variable, indicated that those carrying the II genotype and exhibiting a high sodium intake habit have an OR of 3.31 (95% CI, 1.35–8.12) for hypertension. The power analysis, with an α of 0.05 and a sample size of 137, indicated a power of 0.80. Then, based on our results, there was an 80% chance of correctly rejecting the null hypothesis that a high estimated daily sodium intake is not associated with hypertension in older adults carrying the II genotype.
Additionally, the results from the logistic regression, including only elderly patients with hypertension with poor BP control (n = 54) and as a dependent variable the elderly patients with hypertension classified as D allele or II genotype carriers with poor BP control, and the daily sodium intake (normal or high) as an independent variable, indicated that a high sodium intake habit resulted in an OR of 5.81 (95% CI, 1.60–21.17) to poor BP control among elderly patients with hypertension carrying the II genotype. The power analysis, with an α of 0.05 and a sample size of 54 patients, indicated a power of 0.65. Then, based on our results, there was a 65% chance of correctly rejecting the null hypothesis that a high estimated daily sodium intake is not associated with hypertension in older adults carrying the II genotype.
4. DISCUSSION
Our main study finding was that ACE D allele was not significantly associated with hypertension in the studied community‐dwelling elderly patients, but II genotype carriers exhibited a greater prevalence of high estimated daily sodium intake, leading them to be prone to hypertension. Among elderly patients with hypertension, ACE II genotype carriers exhibited poor BP control, despite the similar use of antihypertensive drugs, compared with D allele carriers (ie, ID/DD genotypes), but a higher estimated daily sodium intake.
These study results provide further evidence about the high prevalence of hypertension among elderly patients. It has been proposed that >50% of Brazilian elderly patients should have hypertension,5, 29 and our results identified that 59.3% of the studied population had hypertension. In addition, the significant association between hypertension and obesity and diagnosis of DM was observed, confirming findings from previous studies.12, 30 However, the reported association between hypertension and female sex, as well as race (mulattos and blacks) and smoking habit, were not observed in the studied population, which is different from previous studies.31, 32
DM is a metabolic disorder that leads to vascular and kidney dysfunctions, culminating in a greater risk of developing hypertension. Likewise, obesity is characterized by increased production of proinflammatory cytokines with cardiovascular action, predisposing obese individuals to increased peripheral vascular resistance and alterations of the large vessel walls associated with the atherosclerosis process.33, 34
Previous studies commonly included young adult populations to investigate this topic13, 14, 35 and have found a significant association between ACE I/D gene polymorphism and hypertension, but our results did not confirm this association in the studied elderly population. Notwithstanding, recent studies including older adult populations have shown a greater prevalence of ID and DD genotypes (ie, presence of the D allele) among patients with hypertension.35, 36
Indeed, the presence of the D allele is associated with high plasma concentrations of ACE,37 leading to an increased peripheral vascular resistance, loss of arterial elasticity, and elevated BP.14 Although most studies have observed the association between the D allele and hypertension, especially involving young and middle‐aged individuals,38, 39 some studies have not confirmed this association.12, 40 In addition, the study by Almada and colleagues41 involving 241 older Brazilian adults also did not observe a higher prevalence of D allele carriers among patients with hypertension.
The diversity of results may be related to methodological aspects among studies, as well as ethnic or regional aspects, as evidenced in the study by Li,42 which showed different results in diverse regions of China. Another aspect is the absence of integrated analysis of genetic polymorphisms and environmental and/or behavioral factors such as daily sodium intake.
Although our results did not find a significant association between ACE gene I/D polymorphism and hypertension in the population, it is possible to hypothesize that the interaction between genetic and behavioral factors such as sodium intake could influence the development of hypertension in older adults. Moreover, our results on BP control among elderly patients with hypertension reinforce the proposed hypothesis.
The association between high daily sodium intake and hypertension is known and considered an important factor in the genesis of hypertension.43 Notwithstanding, the reduction or adequacy of daily sodium intake is recommended as a primary intervention for patients with hypertension,5, 6 owing to the evidence that nutritional adequacy leads to reduction in BP levels.44
The fact that the magnitude of BP increase or decrease differs among the population to changes in sodium load has led to the search for genes related to sodium sensitivity.45, 46 In this context, ACE I/D gene polymorphism is reported to be related to sodium sensitivity,10 with II and ID genotypes carriers considered more sensitive to the hypertensive effects of a high sodium intake habit.47
Although classical studies show that the ACE activity level and susceptibility to hypertension follows the order DD > ID > II,48, 49 the mechanisms by which ACE I/D gene polymorphism contribute to a BP rise followed by high sodium intake (ie, sodium sensitivity) remain unclear.50 However, since sodium‐sensitive patients exhibit greater suppression of renin‐angiotensin‐aldosterone system when exposed to sodium intake, it is plausible that II genotype carriers, who have lower levels of plasmatic ACE, may have a reduced suppressive response after a plasmatic sodium increase, indicating inefficiency of an important regulatory mechanism of renin‐angiotensin‐aldosterone system, when exposed to a high sodium diet.10
Interestingly, we did not find a significant difference in the distribution of antihypertensive drugs used by elderly patients with hypertension carrying the studied genotypes (ie, II vs ID/DD), indicating a similar pharmacological therapy, despite greater proportion of II genotype carriers with poor BP control. However, II genotype carriers exhibited significantly higher estimated daily sodium intake, suggesting that the interaction between II genotype and high‐sodium diet (ie, >2 g/d) increases the predisposition of hypertension in elderly patients, as well as impairs BP control in pharmacologically treated elderly patients with hypertension. Indeed, our results suggest that pharmacologically treated elderly patients with hypertension carrying the II genotype have an OR of 5.81 (95% CI, 1.60–21.17) to poor BP control when adopting a high‐sodium intake habit.
Different methodological approaches among studies, especially age groups involved, classification criteria of hypertension, ethnicity, and absence of an integrated analysis between genetic and environmental/behavioral factors associated with hypertension, are limiting factors for the comparison of results among studies designed to investigate the association between genetic composition and hypertension. In this way, our results point out the importance of an integrated analysis of genetic and environmental/behavioral variables to understand the genesis of hypertension, as well as BP control in medicated patients with hypertension.
5. STUDY LIMITATIONS
It is important to state that the adherence to medication was not measured in our study, which constitutes a limitation, since it could impact our findings.51 However, all elderly patients with hypertension were placed in a Brazilian health program designed to periodically monitor the patients with hypertension, which led, even if in a limited way, to some control of medication use. Additionally, despite it being a survey study including community‐dwelling older individuals (≥60 years) from a Northeast Brazilian small city, the sample size may have limited the statistical inference regarding BP control among patients with hypertension, since the sample was reduced to 54 patients with poor BP control. This may have led to a small power (0.65), despite the high OR (5.81), to poor BP control when adopting a high‐sodium intake habit, among pharmacologically treated elderly patients with hypertension carrying the II genotype, which is another limitation to our study. However, the sample size (n = 137) did not impair the statistical inference of association between elderly patients with hypertension carrying the II genotype and a high‐sodium intake habit, since this analysis achieved a power of 0.80.
6. CONCLUSIONS
Our results confirm the high prevalence of hypertension among elderly patients and bring provide new evidence regarding the interaction of genetic and environmental/behavioral factors in the genesis of hypertension among elderly patients, as well as in BP control in medicated elderly patients with hypertension. More specifically, our data indicate that elderly patients carrying the II genotype, from the ACE I/D gene polymorphism, should maintain rigorous control of sodium intake, because of its predisposition to sodium sensitivity, leading these elderly patients to hypertension and poor BP control, even with antihypertensive drug treatment, which is especially important to guide healthcare practice. Further studies should extend this analysis, adding more gene polymorphisms, especially from the renin‐angiotensin‐aldosterone system, and more environmental/behavioral variables (ie, related to lifestyle), such as the daily intake of lipids and other nutrients.
CONFLICT OF INTEREST
The authors have no conflicts of interest to declare.
Freire IV, Casotti CA, Ribeiro ÍJS, Silva JRD, Barbosa AAL, Pereira R. Daily sodium intake influences the relationship between angiotensin‐converting enzyme gene insertion/deletion polymorphism and hypertension in older adults. J Clin Hypertens. 2018;20:541–550. 10.1111/jch.13224
REFERENCES
- 1. He W, Goodkind D, Kowal P. An aging world: 2015. Washington, DC: U.S. Government Publishing Office; 2016. [Google Scholar]
- 2. Wagner KH, Brath H. A global view on the development of non communicable diseases. Prev Med. 2012;54 suppl:S38‐S41. [DOI] [PubMed] [Google Scholar]
- 3. WHO . Global status report on noncommunicable diseases 2014. Geneva, Switzerland: World Health Organization; 2014. [Google Scholar]
- 4. Malta DC, Moura L, Prado RR, Escalante JC, Schmidt MI, Duncan BB. Mortalidade por doenças crônicas não transmissíveis no Brasil e suas regiões, 2000 a 2011. Epidemiologia e Serviços de Saúde 2014;23:599‐608. [Google Scholar]
- 5. Sociedade Brasileira de Cardiologia; Sociedade Brasileira de Hipertensão; Sociedade Brasileira de Nefrologia . VI Brazilian guidelines for hypertension. Vol 107. Rio de Janeiro: Arquivos Brasileiros de Cardiologia; 2016. [PubMed] [Google Scholar]
- 6. WHO . Guideline: sodium intake for adults and children. Geneva, Switzerland: World Health Organization; 2012. [PubMed] [Google Scholar]
- 7. Baldo MP, Rodrigues SL, Mill JG. High salt intake as a multifaceted cardiovascular disease: new support from cellular and molecular evidence. Heart Fail Rev. 2015;20:461‐474. [DOI] [PubMed] [Google Scholar]
- 8. Drenjančević‐Perić I, Jelaković B, Lombard JH, Kunert MP, Kibel A, Gros M. High‐salt diet and hypertension: focus on the renin‐angiotensin system. Kidney Blood Press Res. 2011;34:1‐11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Montgomery H, Clarkson P, Barnard M, et al. Angiotensin‐converting‐enzyme gene insertion/deletion polymorphism and response to physical training. Lancet. 1999;353:541‐545. [DOI] [PubMed] [Google Scholar]
- 10. Poch E, González D, Giner V, Bragulat E, Coca A, de La Sierra A. Molecular basis of salt sensitivity in human hypertension. Evaluation of renin‐angiotensin‐aldosterone system gene polymorphisms. Hypertension. 2001;38:1204‐1209. [DOI] [PubMed] [Google Scholar]
- 11. Basgut B, Whidden MA, Kirichenko N, et al. Effect of high‐salt diet on age‐related high blood pressure and hypothalamic Redox signaling. Pharmacology. 2017;100:105‐114. [DOI] [PubMed] [Google Scholar]
- 12. Cheung BMY, Li C. Diabetes and hypertension: is there a common metabolic pathway? Curr Atheroscler Rep. 2012;14:160‐166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Heidari F, Vasudevan R, Mohd Ali SZ, et al. Association of insertion/deletion polymorphism of angiotensin‐converting enzyme gene among Malay male hypertensive subjects in response to ACE inhibitors. J Renin Angiotensin Aldosterone Syst. 2014;16:872‐879. [DOI] [PubMed] [Google Scholar]
- 14. Borah PK, Shankarishan P, Hazarika NC, Mahanta J. Hypertension subtypes and angiotensin converting enzyme (ACE) gene polymorphism in Indian population. J Assoc Physicians India. 2012;60:15‐17. [PubMed] [Google Scholar]
- 15. Meroufel DN, Médiène‐Benchekor S, Dumont J, Benhamamouch S, Amouyel P, Brousseau T. A study on the polymorphisms of the renin‐angiotensin system pathway genes for their effect on blood pressure levels in males from Algeria. J Renin Angiotensin Aldosterone Syst. 2014;15:1‐6. [DOI] [PubMed] [Google Scholar]
- 16. Martínez E, Puras A, Escribano J, et al. Angiotensin‐converting enzyme (ACE) gene polymorphisms, serum ACE activity and blood pressure in a Spanish‐Mediterranean population. J Hum Hypertens. 2000;14:131‐135. [DOI] [PubMed] [Google Scholar]
- 17. Nakayama H, Nishida K, Otsu K. Macromolecular degradation systems and cardiovascular aging. Circ Res. 2016;118:1577‐1592. [DOI] [PubMed] [Google Scholar]
- 18. Azevêdo ES, Fortuna CM, Silva KM, et al. Spread and diversity of human populations in Bahia, Brazil. Hum Biol. 1982;54:329‐341. [PubMed] [Google Scholar]
- 19. WHO . Global recommendations on physical activity for health. Geneva, Switzerland: World Health Organization; 2010. [PubMed] [Google Scholar]
- 20. Rutishauser IH. Dietary intake measurements. Public Health Nutr. 2005;8:1100‐1107. [DOI] [PubMed] [Google Scholar]
- 21. WHO . Obesity: preventing and managing the global epidemic. Report of a WHO consultation. World Health Organ Tech Rep Ser. 2000;894:i‐xii, 1‐253. [PubMed] [Google Scholar]
- 22. Christofaro DGD, Fernandes RA, Gerage AM, Alves MJ, Polito MD, de Oliveira AR. Validação do monitor de medida de pressão arterial Omron HEM 742 em adolescentes. Arq Bras Cardiol. 2009;92:10‐15. [DOI] [PubMed] [Google Scholar]
- 23. Sayed‐Tabatabaei FA, Oostra BA, Isaacs A, Van Duijn CM, Witteman JC. ACE polymorphisms. Circ Res. 2006;98:1123‐1133. [DOI] [PubMed] [Google Scholar]
- 24. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res. 1992;20:1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Shanmugam V, Sell KW, Saha BK. Mistyping ACE heterozygotes. PCR Methods Appl. 1993;3:120‐121. [DOI] [PubMed] [Google Scholar]
- 26. Crow JF, Antonarakis JP, Rossiter JP, et al. Hardy, Weinberg and language impediments. Genetics. 1999;152:821‐825. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Faul F, Erdfelder E, Buchner A, Lang AG. Statistical power analyses using G*Power 3.1: tests for correlation and regression analyses. Behav Res Methods. 2009;41:1149‐1160. [DOI] [PubMed] [Google Scholar]
- 28. Barley J, Blackwood A, Carter ND, et al. Angiotensin converting enzyme insertion/deletion polymorphism: association with ethnic origin. J Hypertens. 1994;12:955‐957. [PubMed] [Google Scholar]
- 29. Malta DC, dos Santos NB, Perillo RD, et al. Prevalence of high blood pressure measured in the Brazilian population, National Health Survey, 2013. Sao Paulo Med J. 2016;134:163‐170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Ferrannini E, Cushman WC. Diabetes and hypertension: the bad companions. Lancet. 2012;380:601‐610. [DOI] [PubMed] [Google Scholar]
- 31. Kountz DS. Hypertension in black patients: an update. Postgrad Med. March 2015. [DOI] [PubMed]
- 32. de Oliva Costa EF, Santana YS, de Abreu Santos AT, Martins LA, de Melo EV, de Andrade TM. Sintomas depressivos entre internos de medicina em uma universidade pública brasileira. Rev Assoc Med Bras. 2012;58:53‐59. [PubMed] [Google Scholar]
- 33. Jia G, Aroor AR, DeMarco VG, Martinez‐Lemus LA, Meininger GA, Sowers JR. Vascular stiffness in insulin resistance and obesity. Front Physiol. 2015;6:231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Rodríguez‐Hernández H, Simental‐Mendía LE, Rodríguez‐Ramírez G, Reyes‐Romero MA. Obesity and inflammation: epidemiology, risk factors, and markers of inflammation. Int J Endocrinol. 2013;2013:678159]. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. He Q, Fan C, Yu M, et al. Associations of ACE gene insertion/deletion polymorphism, ACE activity, and ACE mRNA expression with hypertension in a Chinese population. PLoS One. 2013;8:e75870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Zhou YF, Yan H, Hou XP, et al. Association study of angiotensin converting enzyme gene polymorphism with elderly diabetic hypertension and lipids levels. Lipids Health Dis. 2013;12:187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Tsantes AE, Kopterides P, Bonovas S, et al. Effect of angiotensin converting enzyme gene I/D polymorphism and its expression on clinical outcome in acute respiratory distress syndrome. Minerva Anestesiol. 2013;79:861‐870. [PubMed] [Google Scholar]
- 38. Freitas SR, Cabello PH, Moura‐Neto RS, et al. Analysis of renin‐angiotensin‐aldosterone system gene polymorphisms in resistant hypertension. Brazilian J Med Biol Res. 2007;40:309‐316. [DOI] [PubMed] [Google Scholar]
- 39. Freitas SR, Cabello PH, Moura‐Neto RS, et al. Analysis of renin‐angiotensin‐aldosterone system gene polymorphisms in resistant hypertension. Brazilian J Med Biol Res. 2007;40:309‐316. [DOI] [PubMed] [Google Scholar]
- 40. Rasyid H, Bakri S, Yusuf I. Angiotensin‐converting enzyme gene polymorphisms, blood pressure and pulse pressure in subjects with essential hypertension in a South Sulawesi. Acta Med Indones. 2012;44:280‐283. [PubMed] [Google Scholar]
- 41. Almada BV, Braun V, Nassur BA, Ferreira TS, Paula F, Morelato RL. Association of hypertension with polymorphism of angiotensin converting enzyme in elderly persons. Rev Soc Bras Clín Méd. 2010;8:320‐322. [Google Scholar]
- 42. Li Y. Angiotensin‐converting enzyme gene insertion/deletion polymorphism and essential hypertension in the Chinese population: a meta‐analysis including 21,058 participants. Intern Med J. 2012;42:439‐444. [DOI] [PubMed] [Google Scholar]
- 43. Ravi S, Bermudez OI, Harivanzan V, et al. Sodium intake, blood pressure, and dietary sources of sodium in an adult South Indian population. Ann Glob Heal. 2016;82:234‐242. [DOI] [PubMed] [Google Scholar]
- 44. Juraschek SP, Woodward M, Sacks FM, Carey VJ, Miller ER, Appel LJ. Time course of change in blood pressure from the DASH diet and sodium reduction. Circulation. 2017;70:923‐929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Armando I, Villar VA, Jose PA. Genomics and pharmacogenomics of salt‐sensitive hypertension. Curr Hypertens Rev. 2015;11:49‐56. [PubMed] [Google Scholar]
- 46. Miyamoto K, Iwakuma M, Nakayama T. Effect of genetic information regarding salt‐sensitive hypertension on the intent to maintain a reduced salt diet: implications for health communication in Japan. J Clin Hypertens (Greenwich). 2017;19:270‐279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Krishnan R, Sekar D, Karunanithy S, Subramanium S. Association of angiotensin converting enzyme gene insertion/deletion polymorphism with essential hypertension in south Indian population. Genes Dis. 2016;3:159‐163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Rigat B, Hubert C, Alhenc‐Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I‐converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343‐1346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Tiret L, Rigat B, Visvikis S, et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I‐converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992;51:197‐205. [PMC free article] [PubMed] [Google Scholar]
- 50. Hiraga H, Oshima T, Watanabe M, et al. Angiotensin I‐converting enzyme gene polymorphism and salt sensitivity in essential hypertension. Hypertension. 1996;27:569‐572. [DOI] [PubMed] [Google Scholar]
- 51. Moraes CF, Souza ER, Souza VC, et al. A common polymorphism in the renin angiotensin system is associated with differential outcome of antihypertensive pharmacotherapy prescribed to Brazilian older women. Clin Chim Acta. 2008;396:70‐75. [DOI] [PubMed] [Google Scholar]