Abstract
This study was conducted to explore whether the renin C‐5312T, angiotensin II type 1 receptor A1166C, and angiotensin‐converting enzyme I/D polymorphisms were associated with ambulatory blood pressure (BP) and central hemodynamics in an untreated hypertensive population. A total of 471 participants with no previous treatment for raised BP were eligible for the study. Ambulatory and central BP were measured. DD carriers had the highest daytime systolic/diastolic BP, nighttime systolic BP, 24‐hour systolic BP, and 24‐hour diastolic BP values, whereas carriers of DD had higher central systolic BP and augmentation index compared with those with the II genotype. Multivariate regression analysis demonstrated that DD genotype was independently associated with 24‐hour systolic BP, 24‐hour diastolic BP, central systolic BP, and central augmentation index. There was an independent association of the angiotensin‐converting enzyme polymorphism with central and ambulatory BP in Chinese patients with hypertension.
1. INTRODUCTION
It is well known that the renin‐angiotensin system (RAS) plays a central role in salt and water homeostasis and maintenance of vascular tone. Genetic polymorphisms in RAS have performed an important function in the regulation of blood pressure (BP), linked closely to the incidence of hypertension and cardiovascular risk.1, 2 A series of studies have suggested that RAS gene polymorphisms—such as the C‐5312T single nucleotide polymorphism in rennin (REN), the A1166C single nucleotide polymorphism in angiotensin II type 1 receptor (AT1R), and the insertion/deletion (I/D) polymorphism in angiotensin‐converting enzyme (ACE)—are genetic risk factors for the development of hypertension and degeneration of arterial elasticity. A recent study has found that the T allele of C‐5312T single nucleotide polymorphism and the haplotype containing T was associated with elevated BP levels in healthy humans, and this association of renin 5312 C/T genotype with BP was independent of age and sex.3 Another longitudinal study showed that the C allele carrier in the A1166C polymorphism had a 35% more pronounced increase in aortic arterial stiffness over a 16‐year period than the AA allele patients, and this difference in pulse wave velocity was only observed after the age of 55 years.4 Likewise, a case control study indicated that the D allele of the ACE gene was probably associated with the development of left ventricular hypertrophy in patients with hypertension who developed heart failure.5 However, recent research conducted in India revealed that the ACE ID genotype increases the susceptibility to hypertension and is strongly associated with cardiovascular disorders in patients.6 Thus, consistent associations between RAS gene polymorphisms and hypertension have been difficult to demonstrate.
Essential hypertension, a major cardiovascular risk factor, is recognized as a multifactorial trait resulting from the interplay of environmental and genetic factors.7 In clinical routine practice, BP measurements are usually performed at the brachial artery using a cuff and sphygmomanometer. Currently, ambulatory BP monitoring has become an important tool in the evaluation and management of hypertension, especially given its ability to predict cardiovascular risk more accurately than office BP,8 and it is accepted as the preferred method for diagnosing hypertension. Central aortic pressures are pathophysiologically more relevant than peripheral pressures for the pathogenesis of cardiovascular disease.9 Moreover, antihypertensive drugs can exert differential effects on brachial and central pressure.10
As mentioned above, the genetic regions encoding the components of RAS are highly polymorphic. However, most previous studies investigating the association between RAS gene polymorphisms and hypertension have been limited to traditional office BP recordings. In the present study we assessed whether the REN C‐5312T, AT1R A1166C, and ACE I/D polymorphisms are associated with ambulatory BP and central hemodynamics in an untreated Chinese hypertensive population.
2. METHODS
2.1. Patients and design
Participants, aged 36 to 66 years, with hypertension defined by the 2010 Chinese guidelines for the management of hypertension (systolic BP ≥140 mm Hg and/or diastolic BP ≥90 mm Hg on at least two different visits)11 and with no previous treatment for raised BP were eligible for the study. Exclusion criteria were any secondary cause of hypertension, eg, primary aldosteronism, hypertension emergencies, serious arrhythmia such as high‐degree atrioventricular block and atrial fibrillation, peripheral arterial disease, heart failure, impaired renal function with plasma creatinine ≥150 μmol/L, and malignancy.
From 2010 to 2015, participants were recruited from the BP outpatient clinic and cardiovascular inpatient department at Shandong Provincial Hospital in the Jinan area. A total of 471 individuals were recruited into the study. Ambulatory BP monitoring was performed using a device for automatic measurement of BP. Central hemodynamics and parameters were assessed via pulse wave analysis of the radial artery using a commercially available radial artery tonometry device. The study was approved by the ethics committee of Shandong Provincial Hospital. Written consent was obtained from all participants.
2.2. Blood sampling and genotyping
Blood samples were taken for measurements of routine biochemistry, including serum creatinine, fasting blood glucose (FBG), total cholesterol (TC), and total triglycerides. These indicators were measured using an automated analyzer (DXC800, Beckman Coulter, Inc).
A volume of 2 mL of venous blood was collected from all patients in ethylene diamine tetraacetic acid tubes. After hemolysis with hypotonic solution, genomic DNA was isolated by phenol‐chloroform extraction. The genomic DNA was dissolved in TE buffer (Tris‐EDTA buffer) and stored at 4°C.
The REN C‐5312T was assayed by polymerase chain reaction (PCR)‐restriction fragment length polymorphism with DdeI digestion. Primers used were the following: sense oligo 5′‐CGTAGTGCCATTTTTAGGAAC‐ 3′ and antisense oligo 5′‐AACACCAAAGCAGGCTTAA‐3′. The program consisted of 40 cycles of denaturation at 94°C for 40 seconds, annealing at 52°C for 40 seconds, and extension at 72°C for 40 seconds followed by a final extension at 72°C for 5 minutes. PCR products were incubated with DdeI overnight at 37°C. The PCR products were loaded on 3.0% agarose gels. Alleles were designated C or T, indicating digestion by DdeI or not.
AT1R A1166C was assayed by PCR‐restriction fragment length polymorphism with DdeI digestion. Primers were the following: sense oligo 5′‐ATAATGTAAGCTCATCCACC‐3′ and antisense oligo 5′‐GAGATTGCATTTCTGTCGGT‐3′. PCR reaction conditions, restriction enzymes, and digestion conditions were previously reported by Katsuya and colleagues.12
The PCR method was used for ACE I/D polymorphism analysis. The primers were as follows: forward 5′‐CTGGAGACCACTCCCATCCTTTCT‐3′ and reverse 5′ ‐GATGTGGCCATCACATTCGTCAGAT‐3′. PCR amplified fragments of two different lengths generated two alleles: allele I (insertion, 490 bp) and allele D (deletion, 190 bp). Primer sequences and PCR reaction conditions were previously reported by Rigat and colleagues.13
2.3. Clinical evaluations
Physical assessment of patients included weight, height, and systolic BP (SBP) and diastolic BP (DBP) with mercury sphygmomanometers. BP was measured three times by trained and certified observers using a standardized mercuric‐column sphygmomanometer on the participant in a sitting position after 5 minutes of rest, and the time interval between successive pairs of BP measurements was 2 minutes. Ambulatory BP measurement devices (Spacelabs 90217, Spacelabs) were used to measure the brachial BP every 30 minutes for 24 hours. Nighttime BP was defined as the time between when the patient went to bed until the patient got out of bed the following morning.
After participants had rested for 15 minutes in the supine position, arterial waveforms at the radial (dominant arm) pulses were recorded by applanation tonometry, each during an 8‐second period using a high‐fidelity SPC‐301 micromanometer (Millar Instrument, Inc) interfaced with a computer using SphygmoCor, version 8.2 software (AtCor Medical Pty Ltd). We discarded recordings when the systolic or diastolic variability of consecutive waveforms exceeded 5% or when the amplitude of the pulse wave signal was less than 80 mV. We calibrated the pulse wave by the BP measured at the right arm immediately before the SphygmoCor recordings. Central SBP and DBP, pulse pressure, augmentation pressure, and augmentation index (AIx) were derived from the pulse waveform analysis. Pulse pressure was calculated as the difference between SBP and DBP. Augmentation pressure is the difference between the second and first systolic peak pressures, and the AIx is defined as the ratio of augmentation pressure to aortic pulse pressure. In addition, given that the AIx is influenced by heart rate, an AIx normalized for a heart rate of 75 beats per minute (AIx at 75) was derived. High‐quality recordings, defined as those with a within‐device quality index >90%, were derived from an algorithm that included average pulse height, pulse height variation, diastolic variation, and the maximum rate of rise of the peripheral waveform.
2.4. Statistical analysis
Data are presented as mean±SD or number of patients (percentage). Pearson's χ2 test was used to analyze discrete variables and to evaluate whether genotypes were in accordance with the Hardy‐Weinberg equilibrium. Student t tests or analysis of variance were used to compare continuous data among groups, while Bonferroni correction was used in comparing each two means for three. Analysis of covariance was used when adjustments were made for potentially confounding factors, such as age, sex, body mass index (BMI), smoking, creatinine, FBG, TC, triglycerides, and mean BP. Multivariate linear regression analysis was adopted to determine the independent correlationship between various RAS genotypes and ambulatory and central BP parameters. Two‐tailed P values <.05 were considered statistically significant. Statistical analyses were performed using SPSS version 18.0 (SPSS Inc).
3. RESULTS
A total of 471 untreated patients were recruited to participate in the study, including 268 men and 203 women. Demographic characteristics are shown in Table 1. The mean age of the study population was 50.7±3.1 years. The mean 24‐hour SBP and DBP was 135.2±15.8 and 83.3±12.2 mm Hg, respectively. There were differences in BMI (P<.001), smoking rates (P=.003), and office DBP (P=.018) between men and women, separately.
Table 1.
Baseline clinical characteristics of the total population
| Men | Women | Student t/χ2 | Pvalue* | |
|---|---|---|---|---|
| No. (%) | 248 (52.6) | 223 (47.4) | 5.097 | .147 |
| Age, y | 54.5±12.9 | 50.9±11.4 | 1.077 | .342 |
| BMI, kg/m2 | 27.7±4.6 | 24.8±2.9 | 8.599 | .000 |
| Smoking, % | 34.0 | 19.2 | 6.983 | .003 |
| Alcohol, % | 20.8 | 13.5 | 2.066 | .356 |
| Diabetes mellitus, % | 23.1 | 15.1 | 1.198 | .552 |
| Creatinine, μmol/L | 63.4±15.2 | 68.1±18.2 | 0.931 | .396 |
| Triglycerides, mmol/L | 2.9±0.7 | 2.5±0.3 | 0.562 | .571 |
| TC, mmol/L | 4.5±0.7 | 4.7±0.9 | 0.380 | .685 |
| FBG, mmol/L | 5.96±2.74 | 5.36±0.71 | 0.472 | .653 |
| Office SBP, mm Hg | 140.6±17.2 | 138.6±16.5 | 0.798 | .451 |
| Office DBP, mm Hg | 90.1±14.0 | 83.3±12.4 | 4.112 | .018 |
*P<.05 is considered significant. Abbreviations: BMI, body mass index; DBP, diastolic blood pressure; FBG, fasting blood glucose; SBP, systolic blood pressure; TC, total cholesterol. Bold values indicate significance.
3.1. Comparison hemodynamics of REN C‐5312T polymorphism
The genotype distribution for the REN C‐5312T polymorphism was CC 37.4%, CT 47.6%, TT 13% (Hardy‐Weinberg, P=.57), with a frequency of the T allele of 38%. Hemodynamic characteristics according to these genotypes are shown in Table 2. Specifically, patients with the TT genotype had higher daytime SBP (P=.041) compared with carriers of the CC genotype, although this association disappeared (P=.063) after adjustment for potentially confounding factors. In addition, nighttime SBP levels were lower among patients carrying the CC and CT genotype, but the difference was not statistically significant.
Table 2.
Comparison of BP parameters according to REN C‐5312T polymorphism
| CC | CT | TT | F value | P value | Pvalue* | |
|---|---|---|---|---|---|---|
| No. (%) | 176 (37.4) | 234 (49.6) | 61 (13.0) | – | – | |
| Age, y | 54.5±12.9 | 50.9±11.4 | 52.3±12.4 | 1.732 | .363 | – |
| Day SBP, mm Hg | 130±11.3 | 134±14.1 | 132±18.4 | 1.637 | .452 | .561 |
| Day DBP, mm Hg | 77±10.8 | 80±12.4 | 82±15.4† | 3.031 | .041 | .063 |
| Day PP, mm Hg | 53±12.7 | 54±11.7 | 50±13.5 | 1.287 | .345 | .211 |
| Night SBP, mm Hg | 122±15.8 | 126±16.3 | 125±17.3 | 2.056 | .083 | .101 |
| Night DBP, mm Hg | 72±12.6 | 72±17.3 | 74±13.9 | 1.063 | .573 | .401 |
| Night PP, mm Hg | 50±14.4 | 53±15.8 | 51±14.7 | 0.962 | .686 | .613 |
| 24‐H SBP, mm Hg | 126±15.4 | 130±16.8 | 129±17.9 | 1.831 | .165 | .092 |
| 24‐H DBP, mm Hg | 75±12.3 | 76±15.5 | 78±14.1 | 1.386 | .241 | .302 |
| 24‐H PP, mm Hg | 51±11.0 | 53±16.4 | 51±15.3 | 0.975 | .681 | .429 |
| Central SBP, mm Hg | 118±11.3 | 121±14.6 | 125±12.4 | 1.887 | .101 | .161 |
| Central DBP, mm Hg | 66±10.4 | 69±12.2 | 70±11.8 | 1.547 | .503 | .428 |
| Central PP, mm Hg | 50±12.5 | 52±13.7 | 54±14.9 | 1.679 | .476 | .321 |
| Central AP, mm Hg | 9.4±5.8 | 10.3±6.0 | 10.5±6.3 | 1.762 | .356 | .473 |
| Central AIx | 19±13.0 | 20±11.8 | 20.2±15.1 | 1.610 | .435 | .241 |
| Central AIx (75) | 18±10.8 | 19±10.8 | 19.1±10.5 | 0.798 | .778 | .531 |
*Adjusted for age, sex, body mass index, smoking, alcohol, diabetes mellitus, creatinine, triglycerides, total cholesterol, and fasting blood glucose. † P<.05 compared with CC genotype after Bonferroni correction. Abbreviations: AP, augmented pressure; AIx, augmentation index; BP, blood pressure, DBP, diastolic blood pressure; PP, pulse pressure; SBP, systolic blood pressure. P<.05 is considered significant. Bold value indicates significance.
3.2. Comparison hemodynamics of AT1R A1166C polymorphism
The number of AT1R AA, AC, and CC genotypes were 364, 106, and 1, respectively, resulting in a frequency of the minor AT1R C allele of 11% (Hardy‐Weinberg, 0.24). Because of the very low frequency of the 1166C allele, CC homozygous patients were combined with AC heterozygous patients in the analysis to increase the statistical power, as shown in Table 3. Consequently, there were no significant differences in ambulatory and central BP measurements for AA and AC/CC genotypes.
Table 3.
Comparison of BP parameters according to AT1R A1166C polymorphism
| AA | AC+CC | F value | P value | Pvalue* | |
|---|---|---|---|---|---|
| No. (%) | 364 (77.4) | 107 (23.6) | – | – | |
| Age, y | 52.5±16.1 | 50.9±13.2 | 0.832 | .742 | – |
| Day SBP, mm Hg | 131±18.3 | 133±15.4 | 0.915 | .631 | .524 |
| Day DBP, mm Hg | 82±13.8 | 81±13.9 | 1.051 | .547 | .623 |
| Day PP, mm Hg | 48±15.6 | 52±17.7 | 1.784 | .145 | .213 |
| Night SBP, mm Hg | 125±12.8 | 129±16.4 | 1.636 | .213 | .301 |
| Night DBP, mm Hg | 74±14.0 | 74±12.1 | 0.861 | .774 | .623 |
| Night PP, mm Hg | 51±13.3 | 55±18.2 | 1.689 | .286 | .319 |
| 24‐H SBP, mm Hg | 127±14.7 | 131±14.3 | 1.791 | .204 | .172 |
| 24‐H DBP, mm Hg | 78±12.7 | 77±17.5 | 0.899 | .614 | .731 |
| 24‐H PP, mm Hg | 49±11.0 | 54±16.4 | 1.932 | .281 | .192 |
| Central SBP, mm Hg | 123±16.3 | 125±13.7 | 0.825 | .735 | .691 |
| Central DBP, mm Hg | 64±11.6 | 64±12.8 | 0.878 | .603 | .582 |
| Central PP, mm Hg | 49±10.2 | 51±11.6 | 1.754 | .467 | .533 |
| Central AP, mm Hg | 11±4.8 | 10±6.2 | 0.899 | .665 | .539 |
| Central AIx | 18±12.8 | 19±12.3 | 2.243 | .154 | .212 |
| Central AIx (75) | 16±13.3 | 18±11.0 | 2.865 | .081 | .067 |
*Adjusted for age, sex, body mass index, smoking, alcohol, diabetes mellitus, creatinine, triglycerides, total cholesterol, and fasting blood glucose. Abbreviations: AP, augmented pressure; AIx, augmentation index; BP, blood pressure; DBP, diastolic blood pressure; PP, pulse pressure; SBP, systolic blood pressure. P<.05 is considered significant.
3.3. Comparison hemodynamics of ACE I/D polymorphism
The genotype distribution for the ACE I/D polymorphism was II 30.1%, ID 40%, and DD 29.9% (Hardy‐Weinberg, P=.67), respectively. The frequency of the ACE I allele was 50.1%. As shown in Table 4, among three genotypes, DD carriers had the highest daytime systolic BP (P=.006), daytime diastolic BP (P=.041), nighttime systolic BP (P=.008), 24‐hour systolic BP (P=.07), and 24‐hour diastolic BP (P=.043), whereas carriers of the DD had higher central systolic BP (P=.003) and AIx (P=.006) compared with those with the II genotype. These differences remained statistically significant after adjustment for age, sex, BMI, smoking, alcohol, diabetes mellitus, creatinine, triglycerides, TC, and FBG.
Table 4.
Comparison of BP parameters according to ACE I/D polymorphism
| II | ID | DD | F value | P value | Pvalue* | |
|---|---|---|---|---|---|---|
| No. (%) | 142 (30.1) | 188 (40.0) | 141 (29.9) | – | – | |
| Age, y | 51.6±13.4 | 52.7±13.8 | 54.1±15.2 | 0.903 | .529 | – |
| Day SBP, mm Hg | 126±13.3 | 131±15.4 | 136±17.2† | 6.701 | .002 | .006 |
| Day DBP, mm Hg | 77±12.6 | 82±13.9 | 84±13.1† | 4.367 | .034 | .041 |
| Day PP, mm Hg | 49±13.6 | 49±14.1 | 52±15.4 | 1.643 | .421 | .513 |
| Night SBP, mm Hg | 121±12.1 | 124±16.4 | 130±14.4† | 5.743 | .005 | .008 |
| Night DBP, mm Hg | 73±13.5 | 75±14.6 | 78±12.9 | 2.879 | .052 | .063 |
| Night PP, mm Hg | 48±14.0 | 50±15.2 | 51±13.8 | 2.108 | .168 | .231 |
| 24‐H SBP, mm Hg | 124±14.1 | 128±13.4 | 133±12.7† | 6.397 | .003 | .007 |
| 24‐H DBP, mm Hg | 75±12.9 | 78±15.5 | 81±14.9† | 4.312 | .039 | .043 |
| 24‐H PP, mm Hg | 48±11.2 | 49±14.6 | 52±14.7 | 0.875 | .781 | .832 |
| Central SBP, mm Hg | 116±16.3 | 121±13.7 | 127±13.4† | 6.701 | .002 | .006 |
| Central DBP, mm Hg | 63±10.6 | 67±12.4 | 68±11.6 | 2.546 | .074 | .082 |
| Central PP, mm Hg | 53±12.2 | 55±14.6 | 58±15.1 | 2.104 | .167 | .233 |
| Central AP, mm Hg | 10±4.1 | 11±6.0 | 13±5.8 | 2.089 | .195 | .276 |
| Central AIx | 17±10.3 | 19±12.3 | 22±13.7† | 6.987 | .001 | .003 |
| Central AIx (75) | 16±12.3 | 17±14.1 | 20±15.2† | 6.078 | .004 | .006 |
*Adjusted for age, sex, body mass index, smoking, alcohol, diabetes mellitus, creatinine, triglycerides, total cholesterol, and fasting blood glucose. † P<.05 compared with II genotype after Bonferroni correction; Abbreviations: AP, augmented pressure; AIx, augmentation index; BP, blood pressure; DBP, diastolic blood pressure; PP, pulse pressure; SBP, systolic blood pressure. P<.05 is considered significant. Bold values indicate significance.
3.4. Multivariate linear regression analysis for ACE I/D polymorphism and BP measurement
Finally, a stepwise multivariate regression analysis was performed. We selected the variables that showed P values <.05. Age, sex, BMI, smoking, alcohol, creatinine, triglycerides, TC, FBG, mean BP, and ACE I/D variant (DD) were set into the model; however, only age, sex, FBG, mean BP, and ACE I/D variant (DD) were used as independent determinants in this order. As illustrated in Table 5, ACE DD genotype was independently associated with 24‐hour SBP, 24‐hour DBP, central SBP, and central AIx (the standardized coefficients were 0.115, 0.083, 0.131, and 0.073, respectively). However, such independent correlation did not appear in the II or ID genotypes. The association between 24‐hour SBP, 24‐hour DBP, and different genotypes was controlled for age, sex, BMI, smoking, alcohol, creatinine, triglycerides, TC, and FBG, whereas the relationship between central SBP, central Aix, and genotypes was controlled for age, sex, BMI, smoking, alcohol, creatinine, triglycerides, TC, FBG, heart rate, and mean BP.
Table 5.
Multiple regression analysis for ACE I/D polymorphism and BP variables
| DD genotype | Unstandardized coefficient | Standardized coefficient | P value* |
|---|---|---|---|
| 24‐H SBP, mm Hga | 0.082 | 0.115 | .001 |
| 24‐H DBP, mm Hga | 0.109 | 0.083 | .020 |
| Central SBP, mm Hgb | 0.045 | 0.131 | .001 |
| Central AIx (75)b | 0.033 | 0.073 | .033 |
*P<.05 is considered significant.
Adjusted for age, sex, body mass index, smoking, alcohol, creatinine, triglycerides, total cholesterol, and fasting blood glucose.
Adjusted for age, sex, body mass index, smoking, alcohol, diabetes mellitus, creatinine, triglycerides, total cholesterol, fasting blood glucose, heart rate, and mean blood pressure. Abbreviations: ACE, angiotensin‐converting enzyme; AIx, augmentation index; BP, blood pressure; DBP, diastolic blood pressure; SBP, systolic blood pressure.
4. DISCUSSION
The present study investigated the impact of polymorphisms affecting the major genes participating in the RAS on BP values in a representative sample of a Chinese untreated hypertensive population. The results of the present study revealed that a genetic variant of the ACE gene I/D independently affect ambulatory BP and central hemodynamics.
As the rate‐limiting step in RAS, renin plays an important role in regulation of BP. Alterations in renin activity have been associated with BP and responsiveness to antihypertensive treatment. Fuchs and colleagues14 revealed that variant genetic renin gene 5312T increases renin gene transcription level of 45% in comparison with genotype 5312C. Another investigation exploring whether variations in the enhancer region of the REN gene were involved in regulating renal expression of renin showed that tissue expression levels of REN were significantly higher in T allele homozygotes than in heterozygotes and C allele homozygotes.15 Although direct measurement of renin levels was not obtained, our data suggest that the TT genotype had higher daytime SBP compared with the CC genotype. A study by Moore and coworkers16 reported that REN‐5312T allele carriers displayed a higher daytime and nighttime SBP/DBP than CC homozygotes for ambulatory BP, which is in accordance with the present study. However, this association between TT genotype and ambulatory BP did not exist after adjustment for potential confounders. When central BP and AIx were compared, no significant differences were noted in the three genotypes. To our knowledge, this is the first study to investigate the associations among REN C‐5312T polymorphisms and central BP in Chinese patients with hypertension. A specific molecular mechanism between genetic control and renin expression is not fully understood, although one possibility is that the genetic variant C‐5312T has changed the binding pattern of transcription factors to renin enhancer.16 These transcription factors, including NRF‐2, Sp1, and AP‐1, are identified in the process of renin expression.17
The I/D allelic variant (intronic deletion of a 287 bp Alu sequence repetitive element, D allele) is one of the most intensively investigated genetic polymorphisms in the field of hypertension and cardiovascular disease research. In a meta‐analysis of a Chinese population including 21 058 participants, the D allele was significantly linked with hypertension susceptibility.18 In the present study, patients carrying the DD genotype had higher daytime, nighttime, 24‐hour BP, central SBP, and AIx than carriers of the II genotype, with differences seen when controlling for some influences such as age, sex, BMI, smoking, and alcohol (Table 4). Further multivariate regression analysis indicated an association between the DD genotype of the ACE I/D polymorphism and increased BP. While there have been arguments about these results, several authors support this conclusion. A study by Cosenso‐Martin and colleagues19 demonstrated that the presence of the D allele appears to be associated with higher mean 24‐hour and daytime SBP in patients with hypertension. Bautista and associates20 reported that SBP and DBP were 4.58 and 3.32 mm Hg higher in DD homozygous individuals than in carriers of the I allele, and the DD genotype appears to be an independent risk factor for development of hypertension.
One of the important findings of these results is that the ACE I/D polymorphism could make an important impact on central BP. The patients with the II genotype showed lower central SBP than DD carriers. Emerging evidence suggests that central pressure is better related to future cardiovascular events than is brachial pressure. Among genetic polymorphisms of different components of RAS, the I/D polymorphism of the ACE gene is shown to be associated with a wide range of cardiovascular complications.21 In spite of few studies on the relationship between RAS gene polymorphism and central BP, it has been concluded that modifying central hemodynamics seems to be a possible mode of action of ACE I/D polymorphism mediating the onset of clinical cardiovascular events. The present study showed an association between the ACE I/D polymorphism and aortic AIx, with DD carriers having higher arterial stiffness than II carriers. Previous studies have shown that the D allele was positively related to arterial stiffness in both the general population22 and patients with hypertension.23 Balkestein and colleagues22 found that an ACE D allele may have a more pronounced effect on extracellular matrix synthesis as a result of higher local levels of angiotensin II.22 This would result in a decreased distensibility of the femoral artery in persons with ACE DD genotype.
In the present study, peripheral BP and central BP values were not significantly different among the AT1R +1166A/C single nucleotide polymorphism. The differences in allele frequency among different ethnic groups are larger, and the same between patients with hypertension and normotension.20, 21, 24 Several studies have found that among different ethnic groups, locations, and sexes, the A1166c polymorphism may play different roles for essential hypertension.25, 26 It is worth noting that phenotype‐genotype relationships strongly depend on host factors such as sex, obesity, and lifestyle, in particular salt intake, as reflected by the 24‐hour urinary excretion of sodium.27 However, the mechanism responsible for the association of hypertension risk with A1166C polymorphism remains unclear. A possible explanation for this is that the A1166C polymorphism affects the binding between AT1R and angiotensin II, thereby affecting the ability of angiotensin II to act as a vasoconstrictor and increase BP.28
5. STUDY LIMITATIONS
Some limitations of this study should be mentioned. First, the size of the sample was small, partly because it is difficult to select patients with untreated hypertension without other concomitant diseases. Second, in our study, only three RAS genetic variants were assayed, which contain a group of promising candidate genes involved in essential hypertension28, 29 and play a key role in BP regulation, especially for central BP. Last, the cross‐sectional study design is another limitation of the present study. Further surveys with a larger sample size and through the whole gene will be valuable for confirming these results and finding the functional mutations that could potentially link these positive associations.
6. CONCLUSIONS
This study investigated the influence of RAS gene polymorphisms on ambulatory BP and central hemodynamics in a population of patients with untreated hypertension. It has been shown that the presence of the DD genotype of the ACE I/D polymorphism is correlated with higher 24‐hour BP, daytime BP, nighttime BP, central SBP, and AIx. There is an independent association of the ACE I/D polymorphism with central and ambulatory BP in Chinese patients.
CONFLICT OF INTEREST
The authors have no conflicts of interest to declare.
Han W, Sun N, Chen L, et al. Relationship of renin‐angiotensin system polymorphisms with ambulatory and central blood pressure in patients with hypertension. J Clin Hypertens. 2017;19:1081–1087. 10.1111/jch.13061
Funding information
This study was supported by the Youth Fund of Shandong Academy of Medical Sciences (No. 2015‐41).
REFERENCES
- 1. Yang CH, Lin YD, Wu SJ, et al. High order gene‐gene interactions in eight single nucleotide polymorphisms of renin‐angiotensin system genes for hypertension association study. Biomed Res Int. 2015;2015:454091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Hara M, Sakata Y, Nakatani D, et al. Renin‐angiotensin‐aldosterone system polymorphisms and 5‐year mortality in survivors of acute myocardial infarction: a report from the Osaka Acute Coronary Insufficiency Study. Int Heart J. 2014;55:190‐196. [DOI] [PubMed] [Google Scholar]
- 3. Moore N, Dicker P, O'Brien JK, et al. Renin gene polymorphisms and haplotypes, blood pressure, and responses to renin‐angiotensin system inhibition. Hypertension. 2007;50:340‐347. [DOI] [PubMed] [Google Scholar]
- 4. Benetos A, Giron A, Joly L, et al. Influence of the AGTR1 A1166C genotype on the progression of arterial stiffness: a 16‐year longitudinal study. Am J Hypertens. 2013;26:1421‐1427. [DOI] [PubMed] [Google Scholar]
- 5. Bahramali E, Rajabi M, Jamshidi J, et al. Association of ACE gene D polymorphism with left ventricular hypertrophy in patients with diastolic heart failure: a case‐control study. BMJ Open. 2016;6:e010282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Singh M, Singh AK, Singh S, et al. Angiotensin‐converting enzyme gene I/D polymorphism increases the susceptibility to hypertension and additive diseases: a study on North Indian patients. Clin Exp Hypertens. 2016;38:305‐311. [DOI] [PubMed] [Google Scholar]
- 7. Singh M, Singh AK, Pandey P, et al. Molecular genetics of essential hypertension. Clin Exp Hypertens. 2016;38:268‐277. [DOI] [PubMed] [Google Scholar]
- 8. Salles GF, Reboldi G, Fagard RH, et al. Prognostic effect of the nocturnal blood pressure fall in hypertensive patients: the ambulatory blood pressure collaboration in patients with hypertension (ABC‐H) meta‐analysis. Hypertension. 2016;67:693‐700. [DOI] [PubMed] [Google Scholar]
- 9. McEniery CM, Cockcroft JR, Roman MJ, et al. Central blood pressure: current evidence and clinical importance. Eur Heart J. 2014;35:1719‐1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Williams B, Lacy PS, Thom SM, et al. Differential impact of blood pressure‐lowering drugs on central aortic pressure and clinical outcomes: principal results of the Conduit Artery Function Evaluation (CAFE) study. Circulation. 2006;113:1213‐1225. [DOI] [PubMed] [Google Scholar]
- 11. Liu LS, Writing Group of 2010 Chinese Guidelines for the Management of Hypertension . Chinese guidelines for the management of hypertension. Zhonghua Xin Xue Guan Bing Za Zhi. 2010;2011:579‐615. [PubMed] [Google Scholar]
- 12. Katsuya T, Koike G, Yee TW, et al. Association of angiotensinogen gene T235 variant with increased risk of coronary heart disease. Lancet. 1995;345:1600‐1603. [DOI] [PubMed] [Google Scholar]
- 13. Rigat B, Hubert C, Corvol P, et al. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res. 1992;20:1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Fuchs S, Philippe J, Germain S, et al. Functionality of two new polymorphisms in the human renin gene enhancer region. J Hypertens. 2002;20:2391‐2398. [DOI] [PubMed] [Google Scholar]
- 15. Makino Y, Konoshita T, Omori A, et al. A genetic variant in the distal enhancer region of the human renin gene affects renin expression. PLoS One. 2015;10:e0137469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Moore N, Dicker P, O'Brien JK, et al. Renin gene polymorphisms and haplotypes, blood pressure, and responses to renin‐angiotensin system inhibition. Hypertension. 2007;50:340‐347. [DOI] [PubMed] [Google Scholar]
- 17. Rohman MS, Dewi Satiti IA, Widodo N, et al. Genetic variants of C‐5312T REN increased renin levels and diastolic blood pressure response to angiotensin receptor blockers. Int J Hypertens. 2015;2015:930631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Li Y. Angiotensin‐converting enzyme gene insertion/deletion polymorphism and essential hypertension in the Chinese population: a meta‐analysis including 21,058 participants. Intern Med J. 2012;42:439‐444. [DOI] [PubMed] [Google Scholar]
- 19. Cosenso‐Martin LN, Vaz‐de‐Melo RO, Pereira LR, et al. Angiotensin‐converting enzyme insertion/deletion polymorphism, 24‐h blood pressure profile and left ventricular hypertrophy in hypertensive individuals: a cross‐sectional study. Eur J Med Res. 2015;20:74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Bautista LE, Vargas CI, Oróstegui M, et al. Population‐based case‐control study of renin‐angiotensin system genes polymorphisms and hypertension among Hispanics. Hypertens Res. 2008;31:401‐408. [DOI] [PubMed] [Google Scholar]
- 21. You FJ, Shen DM. Association between angiotensin‐converting enzyme insertion/deletion polymorphisms and the risk of heart disease: an updated meta‐analysis. Genet Mol Res. 2016;15:15017194. [DOI] [PubMed] [Google Scholar]
- 22. Balkestein EJ, Staessen JA, Wang JG, et al. Carotid and femoral artery stiffness in relation to three candidate genes in a white population. Hypertension. 2001;38:1190‐1197. [DOI] [PubMed] [Google Scholar]
- 23. Benetos A, Gautier S, Ricard S, et al. Influence of angiotensin‐converting enzyme and angiotensin II type 1 receptor gene polymorphisms on aortic stiffness in normotensive and hypertensive patients. Circulation. 1996;94:698‐703. [DOI] [PubMed] [Google Scholar]
- 24. Liu Y, Zhuoma C, Shan G, et al. A1166C polymorphism of the angiotensin II type 1 receptor gene and essential hypertension in Han Tibetan and Yi populations. Hypertens Res. 2002;25:515‐521. [DOI] [PubMed] [Google Scholar]
- 25. Zuo Y, Long A. Meta‐analysis of relationship between angiotensin II type 1 receptor gene A1166C polymorphism and susceptibility to essential hypertension. J Evid Based Med. 2008;8:349‐352. [Google Scholar]
- 26. Dhanachandra Singh Kh, Jajodia A, Kaur H, et al. Gender specific association of RAS gene polymorphism with essential hypertension: a case‐control study. Biomed Res Int. 2014;2014:538053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kuznetsova T, Staessen JA, Brand E, et al. Sodium excretion as a modulator of genetic associations with cardiovascular phenotypes in the European Project on Genes in Hypertension. J Hypertens. 2006;24:235‐242. [DOI] [PubMed] [Google Scholar]
- 28. Yang YL, Mo YP, He YS, et al. Correlation between renin‐angiotensin system gene polymorphisms and essential hypertension in the Chinese Yi ethnic group. J Renin Angiotensin Aldosterone Syst. 2015;16:975‐981. [DOI] [PubMed] [Google Scholar]
- 29. Zhang H, Mo XB, Xu T, et al. Novel genes affecting blood pressure detected via gene‐based association analysis. G3 (Bethesda). 2015;5:1035‐1042. [DOI] [PMC free article] [PubMed] [Google Scholar]