Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

Anna-Karina B Maier; Nadine Reichhart; Johannes Gonnermann; Norbert Kociok; Aline I Riechardt; Enken Gundlach; Olaf Strauß; Antonia M Joussen

doi:10.1371/journal.pone.0245143

. 2021 Apr 9;16(4):e0245143. doi: 10.1371/journal.pone.0245143

Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

Anna-Karina B Maier ^1,^*,^#, Nadine Reichhart ^1,^#, Johannes Gonnermann ¹, Norbert Kociok ¹, Aline I Riechardt ¹, Enken Gundlach ¹, Olaf Strauß ¹, Antonia M Joussen ¹

Editor: Christina L Addison²

PMCID: PMC8034740 PMID: 33835999

Abstract

Tumor necrosis factor (TNF)α is an inflammatory cytokine likely to be involved in the process of corneal inflammation and neovascularization. In the present study we evaluate the role of the two receptors, TNF-receptor (TNF-R)p55 and TNF-Rp75, in the mouse model of suture-induced corneal neovascularization and lymphangiogenesis. Corneal neovascularization and lymphangiogenesis were induced by three 11–0 intrastromal corneal sutures in wild-type (WT) C57BL/6J mice and TNF-Rp55-deficient (TNF-Rp55d) and TNF-Rp75-deficient (TNF-Rp75d) mice. The mRNA expression of VEGF-A, VEGF-C, Lyve-1 and TNFα and its receptors was quantified by qPCR. The area covered with blood- or lymphatic vessels, respectively, was analyzed by immunohistochemistry of corneal flatmounts. Expression and localization of TNFα and its receptors was assessed by immunohistochemistry of sagittal sections and Western Blot. Both receptors are expressed in the murine cornea and are not differentially regulated by the genetic alteration. Both TNF-Rp55d and TNF-Rp75d mice showed a decrease in vascularized area compared to wild-type mice 14 days after suture treatment. After 21 days there were no differences detectable between the groups. The number of VEGF-A-expressing macrophages did not differ when comparing WT to TNF-Rp55d and TNF-Rp75d. The mRNA expression of lymphangiogenic markers VEGF-C or LYVE-1 does not increase after suture in all 3 groups and lymphangiogenesis showed a delayed effect only for TNF-Rp75d. TNFα mRNA and protein expression increased after suture treatment but showed no difference between the three groups. In the suture-induced mouse model, TNFα and its ligands TNF-Rp55 and TNF-Rp75 do not play a significant role in the pathogenesis of neovascularisation and lymphangiogenesis.

Introduction

Corneal neovascularization and lymphangiogenesis can be induced by various triggers including limbal insufficiency, inflammation, trauma or surgical manipulations [1,2]. This leads to reduced transparency of the cornea, loss of visual acuity and higher risk for graft rejection after corneal transplantation [1,3,4]. Cytokines and growth factors orchestrate the cells involved in the development of new blood and lymph vessels. Major regulators of both inflammation-driven neovascularization and lymphangiogenesis are growth factors of the vascular endothelial growth factor (VEGF) family (VEGF A, C and D) [1,5].

Tumour necrosis factor α (TNFα), a pro-inflammatory cytokine, is known as a key regulator in inflammatory processes and is produced by various cell types, including neutrophils, macrophages, lymphocytes and endothelial cells [6,7]. In the cornea, TNFα is involved in inflammatory and neovascular processes during corneal wound healing [2,8–10]. Its levels have been found increased in the corneal epithelium, stroma and endothelium in murine and in human corneas during ocular surface inflammation [11]. The role of TNFα in corneal angiogenesis, however, is controversially discussed: Saika et al. showed that alkali burn-induced corneal neovascularization was more severe in TNFα^-/-mice than in wild-type mice [10]. Furthermore, TNFα^-/- mice showed more prominent central stromal neovascularization, accompanied by increased expression of transforming growth factor (TGF)-β1 and VEGF-A compared with wild-type mice [2]. In contrast, other reports discussed, that TNFα plays a role in inducing corneal neovascularization. Cade et al. and Fujita et al. showed that TNFα inhibition reduced corneal neovascularization in different animal models [2,8]. Furthermore, it is suggested that TNFα induces VEGF-A expression in macrophages recruited to the injured cornea [7].

Besides neovascularization, inflammatory processes in the cornea are accompanied by lymphangiogenesis [12]. Many studies demonstrated that macrophages secreting VEGF-C/VEGF-D are involved in the development of lymph vessels [13,14]. Zhang et al. showed that TNFα can stimulate lymphangiogenesis by inducing VEGF-C production in macrophages via NF-κB [15]. In another publication by Ji et al. TNFα stimulated the expression of VEGF-C/VEGFR-3 on corneal dendritic cells and macrophages [16,17]. Moreover, the inhibition of TNFα reduced significantly corneal neovascularization and lymphangiogenesis in the mouse model of ocular surface scarring [18].

TNFα can bind to two different cell surface receptors, TNF-receptor (TNF-R) p55 and TNF-Rp75. In general, TNF-Rp55 activation creates a pro-inflammatory environment, whereas TNF-Rp75 also shows anti-inflammatory effects [19,20].

The exact role of the two receptors in the eye, is still under investigation. Concerning the cornea, Lu et al. demonstrated in the alkali-burn model that TNF-Rp55d exhibited impaired corneal neovascularization through reduced expression of VEGF-A and iNOS by infiltrating macrophages [7].

In the present study we assessed the role of TNF-Rp55 and TNF-Rp75 in the model of suture-induced inflammatory corneal neovascularization and lymphangiogenesis using TNF-Rp55 deficient mice (TNF-Rp55d) and TNF-Rp75 deficient mice (TNF-Rp75d). We compared blood- and lymph vessel growth as well as TNFα expression.

Material and methods

Human tissue

Human cornea tissue was obtained from two patients after perforating keratoplasty. In both cases the perforating keratoplasty was performed because of a graft failure after keratoplasty due to a traumatic scar. Both patients showed a significant neovascularization of the graft. Written informed consent was obtained from both patients and approved by the Charité-Universitätsmedizin Berlin. The study followed the principles of the Declaration of Helsinki.

Animals

All animal experiments adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by responsible University Animal Care and Use Committees, LAGESO (G 0326/12). Mice with deficient function of TNFR1 (TNF-Rp55d) (B6.129-Tnfrsf1a^tm1Mak/J, Jackson lab stock 002818) or TNFR2 (TNF-Rp75d) (B6.129S2-Tnfrsf1b^tm1Mwm/J, Jackson lab stock 002620) were used in the study. The mice harbor a null mutation of the respective TNFR leading to an altered gene product that lacks the molecular function of the wild-type gene. The proteins themselves are expressed.

The TNF-Rp55 mutation was created by disruption of the coding sequence of the TNF-Rp55 gene by insertion of a neo gene [21]. This resulted in the transcription and transduction of a non-functional TNF-Rp55 protein. A similar strategy was pursued by Erickson et al creating the TNF-Rp75d mice. A neomycin-resistance gene under control of the Pgk promoter20 was inserted in the second exon, which contains the signal peptide region of TNF-R2, resulting in the transcription and transduction of a non-functional TNF-Rp75 protein [22].

The genotype was determined by PCR analysis of genomic DNA prepared from tail or ear samples according to Rothe et al. [23]. Age matched C57BL/6J mice (Janvier, France) served as controls. A total number of 47 TNF-Rp55d mice, and 47 TNF-Rp75d mice and 48 wild-type mice were used for this study.

Animals were fed regular laboratory chow and water ad libitum. A 12-hour day–night cycle was maintained. After suture placement, the mice were regularly examined by animal keepers. All efforts were made to minimize discomfort of the animals.

Mouse model of suture-induced, inflammatory corneal neovascularization

Corneal neovascularization was induced according to a standard protocol [5,24,25]. The contra-lateral eye served as control.

In brief, mice were deeply anesthetized by injection of ketamine/xylazine. The central cornea was marked by a 2 mm trephine, gently placed at the central cornea. Three 11–0 sutures were placed intrastromally with 2 incursions extending over 120 degrees of corneal circumferences each. The outer point of suture placement was chosen as halfway between the limbus and the line outlined by the 2 mm trephine, the inner suture point was equidistant from the 2 mm trephine line to obtain standardized angiogenic response. 3, 8, 14 or 21 days after suture, mice were sacrificed by injection of ketamine/xylazine and subsequent cervical dislocation, and eyes were processed for further experiments.

Immunohistochemistry on sagittal sections and cornea whole-mounts

Whole-mounts

Eyes were enucleated and fixed in acetone for 8 minutes. The sclera was dissected with a circumferential incision parallel to the limbus, followed by removal of the lens and iris. Four radial cuts were made to allow flattening.

The whole-mount immunohistology protocol from [1] was slightly modified as follows: Corneas were blocked in 5% BSA in PBS with 10% goat serum and 0.1% Triton X-100 overnight. Then the corneas were incubated in primary antibody (Lyve-1 (1:500, Cat# DP3513P), Acris Antibodies, Germany) in 5% BSA in PBS for 3 days at 4°C. A Cy3-conjugated species appropriate secondary antibody (Jackson ImmunoResearch Laboratories, USA) was used applied overnight at 4°C in the same buffer. After PBS wash, corneas were incubated in FITC-conjugated CD31 (1:200) (Cat # 558738 BD Pharmingen, USA) overnight at 4°C and mounted flat on slides.

Images of the flatmounts were captured with an Axio Imager 2 (Zeiss, Germany). Pictures were digitalized using ZEN software (Zeiss). The areas covered with blood and lymph vessels were detected with an algorithm and calculated using the software ImageJ (NIH, USA); a ratio of vessel covered area to total area was calculated; prior to analysis, gray-value images of whole mount pictures were modified by several filters, and vessels were detected by threshold setting, including the bright vessels and excluding the dark background. Analysis was carried out in a masked fashion by two independent observers. The mean vascularized area of the control was set to 100%, and the vascularized areas of the other samples are given in relation to this value.

Sagittal sections

Enucleated mouse eyes and human corneas were fixed in 4% PFA overnight and embedded in paraffin. After sectioning, the samples were rehydrated and subjected to heat mediated antigen retrieval. After blocking the sections with 5% BSA in TBS for 1h at RT they were incubated in primary antibodies overnight at 4°C: anti-CD68 (1:100; Cat # M0876; DAKO, Denmark); anti-VEGF-A (1:200; Cat # ab46154; abcam, UK) anti-F4/80 (1:200; Cat # ab16911; abcam); anti-vWF (1:100; Cat # A0082; DAKO); anti-TNF-Rp55 (1:100; Cat # AP06465PU-N; Acris, USA); anti-TNF-Rp75 (1:100; Cat# AP15825PU-M; Acris, USA).

After three washing steps, species appropriate fluorescent secondary antibodies were applied for 1h at RT. Nuclei were stained with DAPI. Subsequently sections were mounted on glass slides and subjected to an Axio Imager 2 (Zeiss, Germany). Pictures were digitalized using ZEN software (Zeiss).

RNA Isolation and RT-PCR

Freshly isolated corneas were stored in RNAlater. The whole corneas were homogenized in lysis buffer (RNeasy Kit, Qiagen, Germany). RNA isolation and cDNA synthesis were performed according to the recommendations of the manufacturer (Qiagen).

The mRNA levels for VEGF-A, VEGF-C, Lyve-1, TNFα, TNF-Rp55, TNF-Rp75 and the calibration gene GAPDH in the mouse corneas after sutures were analyzed by Real Time RT-PCR using the Rotor-Gene SYBR Green PCR Kit (Qiagen) on a Rotor-Gene Q (Qiagen). Primer sequences are listed in Table 1. mRNA expression of the genes of interest together with the calibration gene were analyzed simultaneously in triplet reactions. The analysis was repeated two to four times. To confirm amplification specificity the PCR products from each primer pair was subjected to a melting curve analysis (for details see data repository). Genomic DNA contamination was excluded by choosing primers hybridizing to different exons or spanning exon borders. Moreover, control amplification reactions that were performed with non-transcribed RNA as templates gave only background fluorescence. Quantification of the calibrated target genes was done with the Rotor-Gene Q software 2.2.3 (Qiagen) applying the comparative CT (threshold cycle, CT) as described (Morrison et al., 1998).

Table 1. Primer sequences.

Gene	Amplicon	Forward Sequence (5’ -> 3’)	Reverse Sequence (5’ -> 3’)
VEGF-A	201	`CAGCTATTGCCGTCCGATTGAGA`	`TGCTGGCTTTGGTGAGGTTTGAT`
VEGF-C	120	`AGCTGAGGTTTTTCTCTTGTGATTTAA`	`TGATCACAGTGAGCTTTACCAATTG`
Lyve-1	174	`AGGAGCCCTCTCCTTACTGC`	`ACCTGGAAGCCTGTCTCTGA`
TNFα	94	`GCCTCCCTCTCATCAGTTCTAT`	`TTTGCTACGACGTGGGCTA`
TNF-Rp55	154	`TGCGGTGCTGTTGCCCCTGGTTAT`	`CTTTCCAGCCTTCTCCTCTTTGA`
TNF-Rp75	228	`CCCTACAAACCGGAACCTGG`	`CACCTGGTCAGTGGTACAGG`
GAPDH	190	`TTGTGCAGTGCCAGCCTC`	`TTGCCGTGAGTGGAGTCATAC`

Open in a new tab

Western blot analysis of TNFα and its receptors

Mouse corneas were homogenized in lysis buffer containing 100mM Tris-HCl and SDS 1%. Lysates were separated by 12% SDS-PAGE and transferred to a PVDF membrane. After blocking in 5% non-fat dried milk powder in TBS/Tween 0.05% 1 h at room temperature, the membranes were incubated overnight at 4°C with primary antibody anti-TNFα (1:500; Cat # ABIN677318; antibodies-online Inc., USA), anti-TNF-Rp55 (1:100; Cat # AP06465PU-N; Acris) and anti-β-Actin (1:10000, Cat # ab8224, abcam), diluted in TBS/Tween 0.05%. Membranes were washed three times for 10 minutes in TBS/Tween 0.05% and then incubated with the appropriate anti-rabbit or anti-mouse IgG HRP-labelled antibody (1:5000) (GE Healthcare UK Limited, Buckinghamshire, UK) for 1 h at room temperature. Proteins were visualized via chemiluminescence reaction (Bio-Rad Laboratories, Hercules, CA, USA). Blots were digitalized using a ChemiDoc YRS Imager with the software QuantityOne (Bio-Rad, Laboratories,Germany) and densitometry was performed with ImageJ (NIH, USA).

Statistical analysis

All results are expressed as the mean ± standard error of the mean (SEM). After testing for normal distribution of the data (Kolmogorov-Smirnov-Test), the data were compared by unpaired or paired T-test in case of a normal distribution. Otherwise a non-parametric test (Whitney-Mann-U or Wilcoxon) was used. Differences were considered statistically significant when p values were less than 0.05.

Results

Expression of TNF-Rp55 and TNF-Rp75 in the cornea

Both TNFα receptors (TNF-Rp55 and TNFRp75) are expressed in the stroma of the human cornea. We also detected macrophages by CD68 staining, the receptors and macrophages, however, do not appear to co-localize (Fig 1A, S1 Fig).

Fig 1 — A: Sagittal sections of vascularized human cornea stained with antibodies against TNF-Rp55 and TNF-Rp75 (green), and CD68 (red). Nuclei are stained with DAPI. Images display the stroma of human cornea. **B, C:** Sagittal sections of wild-type murine cornea 14 days after suture intervention stained with antibodies against TNF-Rp55 and TNF-Rp75 (green), and F4/80 (red). Nuclei are stained with DAPI. Scale bar represents 50 μm. **D, E:** Differential mRNA expression of TNF-Rp55 (D) and TNF-Rp75 (E) in wild-type and *TNF-Rp55d* and *TNF-Rp75d* mice. Data are normalized to wild-type expression values (= 1); n = 6–9. **F, G:** Detection of TNF-Rp55 in representative western blot of corneal lysates from wild-type, *TNF-Rp55d* mice and *TNF-Rp75d* mice without or with suture intervention at day 14 (B). β-Actin served as loading control. Bar charts illustrates densitometric analysis of relative protein expression of soluble TNF-Rp55 /β-Actin (C); n = 3. The uncropped blots are shown in the data repository.

In the mouse model of suture induced neovascularisation, both receptors are expressed in the endothelium, in the epithelium, and in the corneal stroma both in the central area of the suture and at the limbus area of the cornea. Comparable to the human tissue, no co-localization was found between the receptors and the F4/80 positive macrophages (Fig 1B and 1C). mRNA expression of both receptors TNF-Rp55 and TNF-Rp75 can be detected in the wild-type as well as in the TNF-Rp55d and TNF-Rp75d mice. The mRNA expression of TNF-Rp55 in the TNF-Rp55d mice, however, is significantly reduced (Fig 1D and 1E). There is no evidence for differential regulation of TNF-Rp75 in TNF-Rp55d animals or vice versa, neither on mRNA nor on protein level (Fig 1D–1G, S1 Table).

Corneal neovascularization in TNF-Rp55d mice and TNF-Rp75d mice in the suture model

To investigate the effect of TNF-Rp55d mice and TNF-Rp75d mice on corneal neovascularization qPCR of VEGF-A, the major angiogenic factor, was performed. At day 3 after suture, wild-type mice, TNF-Rp55d mice and TNF-Rp75d mice showed significantly higher mRNA expression of VEGF-A compared to untreated littermates (level = 1). At day 8 after suture placement only TNF-Rp75d mice showed upregulation in VEGF-A mRNA expression. At day 14 there was no change in VEGF-A expression detectable anymore in wild-type and both TNF-Rpd mice after suture placement (Fig 2A, S1 Table).

Fig 2 — A: Differential mRNA expression of VEGF-A in wild-type and *TNF-Rp55d mice* and *TNF-Rp75d* mice 3 days, 8 days, and 14 days after suture. Data are normalized to VEGF-A expression values of the respective genotype without suture (= 1); n = 2–9. B: Exemplary corneal whole-mounts of wild-type and *TNF-Rp55d* mice and *TNF-Rp75d* mice 14 days after suture placement. Blood vessels are stained with an antibody against CD31. Arrows depict CD31 covered area. **C, D:** Quantification of vascularized area compared to total corneal area in wild-type, *TNF-Rp55d* mice and *TNF-Rp75d* mice 14 days (C, n = 7–8) and 21 days (D, n = 4) after suture placement.

To localize neovascularization in the cornea after suture placement, blood vessel staining of corneal flatmounts was performed and the percentage of blood covered cornea was calculated 14 days and 21 days after suture placement. CD31 staining was applied to detect blood vessel covered area. The percentage of vascularized area in both TNF-Rp55d and TNF-Rp75d was significantly smaller compared to wild-type 14 days after suture placement (n = 7–8; p<0.001). Comparing TNF-Rp55d mice and TNF-Rp75d mice, the area covered with blood vessels was significantly smaller in TNF-Rp75d mice (n = 7–8; p = 0.029) (Fig 2B and 2C). At day 21, no significant differences between the mutant and wild-type animals in terms of CD31 coverage were detectable anymore (Fig 2D). There are no differences detectable in the number of CD68/VEGF-A positive macrophages in the limbus or the scar area among the three groups after suture placement (S2 Fig).

Corneal lymphangiogenesis in TNF-Rp55d mice and TNF-Rp75d mice in the suture model

VEGF-C, a marker for lymphangiogenesis showed significant downregulation in the wild-type at day 14, whereas in TNF-Rp55d mice, VEGF-C was significantly downregulated at day 3. TNF-Rp75d mice did not show any significant changes in VEGF-C mRNA expression at the 3 distinct time points with or without suture placement (Fig 3A, S1 Table). In general, LYVE-1 mRNA expression did not change significantly in all the groups in the early phase (day3/8). Only at D14 the TNF-Rp75d mice showed significant upregulation of LYVE-1 after comparing untreated animals with sutured ones (Fig 3B, S1 Table). The area covered by lymphatic vessels (identified by LYVE-1 staining) was smaller in both genotypes, albeit only statistically significant for TNF-Rp75d mice compared to the wild-type after 14 days (n = 7–8; p = 0.014) (Fig 3D). Analogous to the blood vessel coverage, we also detected a significantly smaller percentage of LYVE-1 covered in TNF-Rp75d mice compared to TNF-Rp55d mice (Fig 3C and 3D).

Fig 3 — **A, B:** Differential mRNA expression of VEGF-C (A) or LYVE-1 (B) in wild-type and *TNF-Rp55d* mice and *TNF-Rp75d* mice 3 days, 8 days, and 14 days after suture. Data are normalized to VEGF-A expression values of the respective genotype without suture (= 1); n = 2–3. C: Corneal flatmounts of wild-type and *TNF-Rp55d* mice and *TNF-Rp75d* mice 14 days after suture placement. Lymphatic vessels are visualized by Lyve-1-antibody. D: Quantification of percentage of LYVE-1 positive area compared to total corneal area in wild-type and *TNF-Rp55d* mice, and *TNF-Rp75d* mice 14 days after suture placement. n = 7–8.

Influence of suture placement on TNF-α expression in wild-type, TNF-Rp75d and TNF-Rp55d

In wild-type animals suture placement led to a downregulation of TNFα mRNA expression at day 8 and 14 compared to control animals (Fig 4A). In TNF-Rp55d animals, this intervention caused a downregulation of TNFα expression at day 3 and day 14, but an upregulation at day 8. TNF-Rp75d mice showed an overall downregulation of TNFα mRNA expression upon suture placement until day 8 (Fig 4A, S1 Table).

Western Blot analysis at day 14 showed no significant changes in protein expression by suture placement in any of the genotypes (Fig 4B and 4C; S2 Table, S3 Fig).

Discussion

Tumor necrosis factor (TNF)α and its two receptors, TNF-Rp55 and TNF-Rp75, are suspected to be involved in the process of inflammation and neovascularization in the cornea. Both receptors, TNF-Rp75 and TNF-Rp55 are expressed in the healthy cornea in humans and mice. In the present mouse study, suture intervention led to an increase in VEGF-A expression, whereas VEGF-C expression remained unchanged. TNF-Rp75d mice demonstrated more than TNF-Rp55d mice a subtle reduction of corneal neovascularization and lymphangiogenesis in the suture-induced inflammatory mouse model compared to wild-type mice only in the early phase after suture. After 21 days, there is no difference in the extent of area covered by blood vessels detectable anymore. There are no differences in the number of VEGF-A expressing macrophages when comparing TNF-Rp55d mice or TNF-Rp75d mice with wild-type controls. TNFα mRNA expression clearly increased after suture intervention but showed no differences among the different genotypes. Furthermore, there is no evidence that differential regulation of TNF-R expression accounts for the lack of effect in the mutant mice.

Taken together TNFα and thus its receptors TNF-Rp55 and TNF-Rp75 do not seem to play a direct nor crucial role in the pathophysiology in the mouse model of suture induced lymphangiogenesis and neovascularisation in the cornea.

Using another experimental paradigm, the mouse model of oxygen-induced retinopathy, our group detected only minor changes in the TNF-Rpd mice compared to wild-type controls. TNF-Rp55d and TNF-Rp75d mice presented a similar retinal development and vascularization under normoxic conditions without alterations in vascularization. Treatment with oxygen led to subtle reduction of vascularization in TNF-Rp55d mice on P17 and P20 [26].

We saw upregulation of VEGF-A mRNA expression in WT and TNF-Rp55d after suture intervention and subtle differences in the extent of blood vessel covered area at day 14 after suture in both TNF-Rp75d mice and TNF-Rp55d mice compared to wild-type. Using the alkali-burn model of corneal neovascularization, Lu et al showed that TNF-Rp55d mice presented reduced corneal neovascularization after 2 and 4 weeks compared to wild-type [7].

Additionally, Ferrari et al. showed that the inhibition of TNFα reduced significantly not only the corneal neovascularization, but also the lymphangiogenesis in the mouse model of ocular surface scarring [18]. Moreover, Zhang et al. demonstrated that TNFα is able to induce macrophages to produce VEGF-C, a lymphangiogenic factor, through NF-κB, further stimulating lymphangiogenesis [15]. Li et al. showed that TNFα stimulated the expression of VEGF-C/VEGFR-3 on corneal dendritic cells and macrophages [16,17]. In our study, the mRNA levels of VEGF-C and Lyve-1, the main cell surface receptor for hyaluronan, which mediated the proliferation, migration tube formation and signal transduction of lymphatic endothelial cells [27], did not show any significant changes before and after suture placement except a reduction of VEGF-C mRNA expression at day 3 after laser in the TNF-Rp55d mice. Regarding protein expression, we detected a smaller extent of lymph vessel covered area (LYVE-1 positive) in TNF-Rp75d mice compared to TNF-Rp55d and wild-type mice at day 14.

In the alkali-burn model TNFα mRNA expression increased in wild-type and TNF-Rp55d^- mice to similar extents, which is comparable to our findings in the suture model. However, the effect was weaker in our approach, and on the protein level, we could not observe any changes upon suture intervention [7].

Altogether our findings are very subtle and mild compared to the previous results from other groups in terms of neovascularisation, lymphangiogenesis and also infiltration of VEGF-A expressing macrophages. Lu et al. suggested that the reduced neovascularization of TNF-Rp55d mice is mediated by reduced expression of VEGF and iNOS by infiltrating macrophages [7]. In contrast, we did not find differences in the number of VEGF-A expressing macrophages among the three groups. We even did not find any substantial hint that TNFα or its receptors are crucial for the induction of suture induced (lymph-) angiogenesis. In our approach, though significant on the mRNA level, the protein expression of TNFα in animals after suture was not significantly higher than in animals that did not undergo suturing.

In contrast to the alkali burn model or the surface scratch model, the suture intervention presents a relatively weak trigger to mimic corneal neovascularisation and angiogenesis upon tissue damage. The other models create a severe damage that induces massive inflammation and wound healing responses. So, it is possible to detect effects of their respective intervention on the ability of macrophages to secrete VEGF-A or VEGF-C by upregulation of TNFα, fostering the (lymph-) angiogenic response.

In opposite to the other models, we did not find substantial increase in TNF-a protein that induces secretion of angiogenic and inflammatory molecules by macrophages [7].

In summary, we conclude that in the mouse models of suture induced neovascularisation and lymphangiogenesis, TNFα, and its ligands TNFRp55 and TNF-Rp75 do not play a direct role in the pathogenesis.

However, the fact, that the suture-induced model represents a low-grade-inflammation model and shows a rather weak phenotype compared to the other models of corneal angiogenesis, also harbours several advantages: First, suture placement is more reproducible than alkali-burn or surface scratch. Thus several studies applying the two latter methods might lead to very different results depending on the intensity of the noxious intervention.

Second, it is more suitable to analyze lymphangiogenesis and associated secretion of prolymphangiogenic cytokines [28]. The induced neovascularisation and lymphangiogenesis mimic the clinical scenario of high-risk situation for a corneal graft rejection after keratoplasty and thus it has more translational impact than the models with severe damage and reduced stimulation of the lymphangiogenesis. Suturing only cause localized epithelial loss and inflammatory infiltration between the suture and the limbus, but chemical burns deplete the whole epithelial layer of the central cornea and cause strong cellular infiltration of the whole cornea [29].

Supporting information

S1 Fig. Isotype controls for the secondary antibodies applied in Fig 1, 1B and 1C and S2 Fig, respectively.

A (left side) depicts epithelium and stromal part of the cornea, while A (right side) depicts stroma and endothelium. Scale bars represent 100μm (A) or 50μm (B).

(TIF)

Click here for additional data file.^{(20.1MB, tif)}

S2 Fig

Immunohistochemical staining of corneal sections of sutured wild-type, TNF-Rp55d, and TNF-Rp75d mice in the suture and the limbus area using antibodies against VEGF-A (green) and CD68 (red). Nuclei were stained with DAPI. Scale bar represents 50 μm.

(TIF)

Click here for additional data file.^{(17.9MB, tif)}

S3 Fig. Uncropped WB of TNFa (Fig 4).

A, B: Uncropped representative images of Western blots used for the densitometric analysis in Fig 4C. All uncropped Western blots are shown in the Data repository.

(TIF)

Click here for additional data file.^{(14.8MB, tif)}

S1 Table. Statistical analysis of the qPCR data.

(DOCX)

Click here for additional data file.^{(17.8KB, docx)}

S2 Table. Statistics of the densitometric analysis.

(DOCX)

Click here for additional data file.^{(12.6KB, docx)}

S1 Raw images

(PDF)

Click here for additional data file.^{(3.3MB, pdf)}

Acknowledgments

The authors thank Gabriele Fels and Karin Oberländer for their valuable assistance.

Data Availability

All relevant data are available on Zenodo (DOI: 10.5281/zenodo.4049178).

Funding Statement

AKM: Financial support was provided for Anna-Karina B. Maier by the "Friedrich C. Luft" Clinical Scientist Pilot Program funded by Volkswagen Foundation and Charité Foundation and by the “Lydia Rabinowitsch-Stipendium” funded by Charité Universitätsmedizin Berlin. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Cursiefen C, Maruyama K, Jackson DG, Streilein JW, Kruse FE. Time course of angiogenesis and lymphangiogenesis after brief corneal inflammation. Cornea. 2006;25(4):443–7. 10.1097/01.ico.0000183485.85636.ff . [DOI] [PubMed] [Google Scholar]
2.Fujita S, Saika S, Kao WW, Fujita K, Miyamoto T, Ikeda K, et al. Endogenous TNFalpha suppression of neovascularization in corneal stroma in mice. Investigative ophthalmology & visual science. 2007;48(7):3051–5. 10.1167/iovs.06-1083 . [DOI] [PubMed] [Google Scholar]
3.Chang JH, Gabison EE, Kato T, Azar DT. Corneal neovascularization. Current opinion in ophthalmology. 2001;12(4):242–9. 10.1097/00055735-200108000-00002 . [DOI] [PubMed] [Google Scholar]
4.Cursiefen C, Seitz B, Dana MR, Streilein JW. [Angiogenesis and lymphangiogenesis in the cornea. Pathogenesis, clinical implications and treatment options]. Der Ophthalmologe: Zeitschrift der Deutschen Ophthalmologischen Gesellschaft. 2003;100(4):292–9. 10.1007/s00347-003-0798-y . [DOI] [PubMed] [Google Scholar]
5.Cursiefen C, Chen L, Borges LP, Jackson D, Cao J, Radziejewski C, et al. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. The Journal of clinical investigation. 2004;113(7):1040–50. 10.1172/JCI20465 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Baud V, Karin M. Signal transduction by tumor necrosis factor and its relatives. Trends in cell biology. 2001;11(9):372–7. 10.1016/s0962-8924(01)02064-5 . [DOI] [PubMed] [Google Scholar]
7.Lu P, Li L, Liu G, Baba T, Ishida Y, Nosaka M, et al. Critical role of TNF-alpha-induced macrophage VEGF and iNOS production in the experimental corneal neovascularization. Investigative ophthalmology & visual science. 2012;53(7):3516–26. 10.1167/iovs.10-5548 . [DOI] [PubMed] [Google Scholar]
8.Cade F, Paschalis EI, Regatieri CV, Vavvas DG, Dana R, Dohlman CH. Alkali burn to the eye: protection using TNF-alpha inhibition. Cornea. 2014;33(4):382–9. 10.1097/ICO.0000000000000071 . [DOI] [PubMed] [Google Scholar]
9.Ferrari G, Bignami F, Rama P. Tumor necrosis factor-alpha inhibitors as a treatment of corneal hemangiogenesis and lymphangiogenesis. Eye & contact lens. 2015;41(2):72–6. 10.1097/ICL.0000000000000071 . [DOI] [PubMed] [Google Scholar]
10.Saika S, Ikeda K, Yamanaka O, Flanders KC, Okada Y, Miyamoto T, et al. Loss of tumor necrosis factor alpha potentiates transforming growth factor beta-mediated pathogenic tissue response during wound healing. The American journal of pathology. 2006;168(6):1848–60. 10.2353/ajpath.2006.050980 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Yin Saika S. and yang in cytokine regulation of corneal wound healing: roles of TNF-alpha. Cornea. 2007;26(9 Suppl 1):S70–4. 10.1097/ICO.0b013e31812f6d14 . [DOI] [PubMed] [Google Scholar]
12.Maruyama K, Ii M, Cursiefen C, Jackson DG, Keino H, Tomita M, et al. Inflammation-induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. The Journal of clinical investigation. 2005;115(9):2363–72. Epub 2005/09/03. 10.1172/JCI23874 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Bock F, Onderka J, Dietrich T, Bachmann B, Pytowski B, Cursiefen C. Blockade of VEGFR3-signalling specifically inhibits lymphangiogenesis in inflammatory corneal neovascularisation. Graefe’s archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie. 2008;246(1):115–9. 10.1007/s00417-007-0683-5 . [DOI] [PubMed] [Google Scholar]
14.Cursiefen C, Ikeda S, Nishina PM, Smith RS, Ikeda A, Jackson D, et al. Spontaneous corneal hem- and lymphangiogenesis in mice with destrin-mutation depend on VEGFR3 signaling. The American journal of pathology. 2005;166(5):1367–77. 10.1016/S0002-9440(10)62355-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Zhang Q, Lu Y, Proulx ST, Guo R, Yao Z, Schwarz EM, et al. Increased lymphangiogenesis in joints of mice with inflammatory arthritis. Arthritis research & therapy. 2007;9(6):R118. 10.1186/ar2326 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Ji RC. Lymphatic endothelial cells, inflammatory lymphangiogenesis, and prospective players. Current medicinal chemistry. 2007;14(22):2359–68. 10.2174/092986707781745541 . [DOI] [PubMed] [Google Scholar]
17.Ji RC. Macrophages are important mediators of either tumor- or inflammation-induced lymphangiogenesis. Cellular and molecular life sciences: CMLS. 2012;69(6):897–914. 10.1007/s00018-011-0848-6 . [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Ferrari G, Bignami F, Giacomini C, Franchini S, Rama P. Safety and efficacy of topical infliximab in a mouse model of ocular surface scarring. Investigative ophthalmology & visual science. 2013;54(3):1680–8. 10.1167/iovs.12-10782 . [DOI] [PubMed] [Google Scholar]
19.Sedger LM, McDermott MF. TNF and TNF-receptors: From mediators of cell death and inflammation to therapeutic giants—past, present and future. Cytokine Growth Factor Rev. 2014;25(4):453–72. Epub 2014/08/30. 10.1016/j.cytogfr.2014.07.016 . [DOI] [PubMed] [Google Scholar]
20.Yang S, Xie C, Chen Y, Wang J, Chen X, Lu Z, et al. Differential roles of TNFalpha-TNFR1 and TNFalpha-TNFR2 in the differentiation and function of CD4(+)Foxp3(+) induced Treg cells in vitro and in vivo periphery in autoimmune diseases. Cell Death Dis. 2019;10(1):27. Epub 2019/01/12. 10.1038/s41419-018-1266-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Pfeffer K, Matsuyama T, Kundig TM, Wakeham A, Kishihara K, Shahinian A, et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell. 1993;73(3):457–67. Epub 1993/05/07. 10.1016/0092-8674(93)90134-c . [DOI] [PubMed] [Google Scholar]
22.Erickson SL, de Sauvage FJ, Kikly K, Carver-Moore K, Pitts-Meek S, Gillett N, et al. Decreased sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature. 1994;372(6506):560–3. Epub 1994/12/08. 10.1038/372560a0 . [DOI] [PubMed] [Google Scholar]
23.Rothe J, Lesslauer W, Lotscher H, Lang Y, Koebel P, Kontgen F, et al. Mice lacking the tumour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature. 1993;364(6440):798–802. 10.1038/364798a0 . [DOI] [PubMed] [Google Scholar]
24.Bock F, Onderka J, Dietrich T, Bachmann B, Kruse FE, Paschke M, et al. Bevacizumab as a potent inhibitor of inflammatory corneal angiogenesis and lymphangiogenesis. Investigative ophthalmology & visual science. 2007;48(6):2545–52. 10.1167/iovs.06-0570 . [DOI] [PubMed] [Google Scholar]
25.Hos D, Bock F, Dietrich T, Onderka J, Kruse FE, Thierauch KH, et al. Inflammatory corneal (lymph)angiogenesis is blocked by VEGFR-tyrosine kinase inhibitor ZK 261991, resulting in improved graft survival after corneal transplantation. Investigative ophthalmology & visual science. 2008;49(5):1836–42. 10.1167/iovs.07-1314 . [DOI] [PubMed] [Google Scholar]
26.Kociok N, Radetzky S, Krohne TU, Gavranic C, Joussen AM. Pathological but not physiological retinal neovascularization is altered in TNF-Rp55-receptor-deficient mice. Investigative ophthalmology & visual science. 2006;47(11):5057–65. 10.1167/iovs.06-0407 . [DOI] [PubMed] [Google Scholar]
27.Wu M, Du Y, Liu Y, He Y, Yang C, Wang W, et al. Low molecular weight hyaluronan induces lymphangiogenesis through LYVE-1-mediated signaling pathways. PloS one. 2014;9(3):e92857. 10.1371/journal.pone.0092857 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Giacomini C, Ferrari G, Bignami F, Rama P. Alkali burn versus suture-induced corneal neovascularization in C57BL/6 mice: an overview of two common animal models of corneal neovascularization. Exp Eye Res. 2014;121:1–4. Epub 2014/02/25. 10.1016/j.exer.2014.02.005 . [DOI] [PubMed] [Google Scholar]
29.Jia C, Zhu W, Ren S, Xi H, Li S, Wang Y. Comparison of genome-wide gene expression in suture- and alkali burn-induced murine corneal neovascularization. Molecular vision. 2011;17:2386–99. Epub 2011/09/17. [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0245143.r001

Decision Letter 0

Christina L Addison

17 Jul 2020

PONE-D-20-16932

Influence of the malfunction of the TNF-α receptors TNF-Rp55 or TNF-Rp75 on corneal neovascularization and lymphangiogenesis in the mouse

PLOS ONE

Dear Dr. Maier

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please see the descriptions provided by the reviewers below. They all appear to have raised issues with experimental controls and data quality which should be addressed.

Please submit your revised manuscript by 30 September 2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Christina L Addison, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (a) methods of sacrifice, (b) methods of anesthesia and/or analgesia, and (c) efforts to alleviate suffering.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, Maier et al. investigate the potential role of TNFRs 1 and 2 in corneal neovascularization and lymphangiogenesis. The authors find a decrease in the vascularized area in TNFR-deficient animals as well as well as downregulation of TNF itself in their model. However, they conclude that TNF as well as its receptors do not play a significant role in the pathogenesis of neovascularization and lymphangiogenesis. The authors should consider to moderate this statement and their interpretation.

FIGURE 1

The data in figure 1 would be more convincing if a negative control was included. Since the authors have access to the TNFR-deficient mice, these samples should be included to demonstrate specificity of their antibodies.

What was the reason for using two different antibodies (CD68 and F4/80) in these samples?

It is not clear why the TNFR-deficient mice would show TNFR gene expression. The authors should validate their RT primers and repeat these experiments.

Also, the western blot in figure 1F is inconclusive. Why is their no difference between wild type and knock out? Immunoblots for TNFR1 should also be included.

FIGURE 2

CD31 positive/blood vessel area should be highlighted/indicated in figures 2B and 3C

FIGURE 4

The data in figure 4 is inconclusive and is hard to interpret as is. The quality of the immunoblot is rather low. The authors could also consider evaluating the function of TNF using an in vitro system. This would further strengthen interpretation and conclusion.

Minor comments:

The title is confusing and should be revised. The authors study the effects of deficiency rather than malfunction.

The overall quality of the figure-PDF file is low. High resolution images and unified labels (font + size) should be provided with the revised manuscript.

Reviewer #2: It is pleasing to read the report by Dr. Maier and colleagues in which the group tested the relative efficacy of two TNF receptor deletions on vascularization following corneal injury; the reporting of minimal or negative results is not done often enough and this finding herein is important. The mouse experiments and data are sound, with no problems in their presentation, interpretation, or subsequent discussion. There is some concern with the human data: it is very hard from the way the imaging studies were performed to claim co-localization or lack thereof from any particular cell type (the imaging problem exists with the mouse tissue as well). Since this paper is not presenting a tissue-specific deletion of either Rp55 or Rp75, it's relative localization is not critically important to the findings. Being purposefully vague might be the safest route, claiming that protein is expressed and 'does not appear' to localize with macrophages... the epithelium is usually 'hot' for fluorescence so that claim is questionable and S3 and S4 are not convincing (and lack proper labels and legends).

Reviewer #3: In this manuscript, the authors characterized corneal neovascularization and lymphangiogenesis in the TNF-Rp55 or TNF-Rp75 KO mice. They concluded that in the suture-induced mouse model, TNFα and its ligands TNF-Rp55 and TNF-Rp75

do not play a significant role in corneal neovascularization and lymphangiogenesis. However, the data showed that a reduction of neovascularization in these KO mice compared with WT at day 14 and reduced lymphangiogenesis in TNF-Rp75 KO mice. This suggests that TNF signaling has a role in these two processes.

Other comments:

1. In most experiments, how many mice were used is unclear.

2. The authors only explored the expression of 3 genes that are related to neovascularization and lymphangiogenesis. Since many genes involve in regulation of neovascularization and lymphangiogenesis, the authors can't make a conclusion that TNFα and its ligands TNF-Rp55 and TNF-Rp75 do not play a significant role.

3. TNF-a is an important cytokine in regulating corneal inflammation, neovascularization and lymphangiogenesis. In this study, a suture-induced corneal neovascularization model was used to identify the effect of TNF-a in corneal neovascularization and lymphangiogenesis. The model is so mild, many of the immunological cells and cytokines were not found significantly changed in this model. So that’s possible that you can’t observe much effects of TNF-a in this situation. Also, the suture-induced corneal neovascularization is not suitable to mimic the clinical scenario of corneal graft rejection. As we know, the corneal graft rejection is reasoned by exogenous antigen stimulation, which is not similar to the suture induced corneal neovascularization.

4. A group of non-injured mice need to be added in each experiment. The authors should identify the expression of TNF-a has been increased in your models. Otherwise, there is no point to investigate the roles of TNF-a and its receptors in this model.

Reviewer #4: The authors show that TNFα and its receptors are not required for neovascularization and lymphangiogenesis in corneal suture model in mice. The data presented in Fig1 E, F and G indicates that the authors are working with mice where the TNFR receptors are not knocked and thus cannot make any claim on the role of TNFR in angiogenesis and lymphangiogenesis. I have to recommend rejecting the paper in its current form.

The following issues need to be addressed.

1. The quality of tissue in immunofluorescence images Fig1A and S3 and resolution of image is very poor and cannot be interpreted. It is unclear what region of the eye is shown in Fig1A although from result section it appears to be cornea. There is no indication of where TNFα receptor are localizing in the cornea. Please indicate where the receptors are localizing.

2. Fig 1B suffers from the same issue as Fig1 A. The tissue section is of extremely poor quality. The limbus region is suspect. Please show a phase image so one might see the iridiocorneal angle. The labels in B and C are confusing is label for C on left makes no sense to the reader. Should it not be cornea? If B and C are from the suture experiment (says Mouse+Suture on the right of panels) where are the controls or sham eyes?

3. Why is TNFR2 75KDa not reduced in the TNFR2 knockout mouse in Fig 1D? Please reword Line 223-227 “The mRNA expression of TNFRp55 in the TNF-RP55d mice, however, is significantly reduced (Fig.1D, E) and the functionality of the receptors is disturbed. There is no evidence for differential regulation ofthe other receptor in the TNF-Rpd animals, neither on mRNA nor on protein level (Fig.1D, E,F, G, S1 Table 1) as isis very confusing.

4. Fig 1F and G leads to question the entire premise of the paper- it seems TNFR1 protein is present in mutant hence the authors are working with essentially wt mice?? What is the state of the TNFR2 mutant mice? Does it still express TNFR2 protein? Please validate mice before doing the suture experiments. Please show a western blot showing the protein levels of TNFR1 and TNFR2 in wt and respective mutant mice.

5. Also need to this experiment with the double knockout mice given TNFα knockout seems to exacerbate neovascularization (Fujita 2007).

6. The figures all seem to be of poor resolution making it really hard to zoom in on panels to see detail.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Apr 9;16(4):e0245143. doi: 10.1371/journal.pone.0245143.r002

Author response to Decision Letter 0

26 Sep 2020

We thank the editorial board to give us the opportunity to improve our paper substantially according to the academic editor and reviewers’ comments.

We answer the academic editor and reviewer’s concerns point by point as follows.

Journal requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Answer: We revised the manuscript according to the PLOS ONE`s style requirements.

Answer: We included the details on (a) methods of sacrifice, (b) methods of anesthesia and/or analgesia, and (c) efforts to alleviate suffering.

“After suture placement, the mice were regularly examined by animal keepers. All efforts were made to minimize discomfort of the animals.”

“In brief, mice were deeply anesthetized by injection of ketamine/xylazine.”

“3, 8, 14 or 21 days after suture, mice were sacrificed by injection of ketamine/xylazine and subsequent cervical dislocation, and eyes were processed for further experiments.”

Answer: All data are available at the open access database Zenodo using the following link (https://doi.org/10.5281/zenodo.4049178)

Answer: We added Figure S3 Fig depicting 2 representative uncropped blots. Furthermore, all blot data are available at a public data repository (https://doi.org/10.5281/zenodo.4049178).

S3 Fig

Answer: Data of melting curve analysis are available at a public data repository (https://doi.org/10.5281/zenodo.4049178).

Reviewer #1:

Q1: In this study, Maier et al. investigate the potential role of TNFRs 1 and 2 in corneal neovascularization and lymphangiogenesis. The authors find a decrease in the vascularized area in TNFR-deficient animals as well as well as downregulation of TNF itself in their model. However, they conclude that TNF as well as its receptors do not play a significant role in the pathogenesis of neovascularization and lymphangiogenesis. The authors should consider moderating this statement and their interpretation.

Answer: We investigated the role of TNFα in the suture model at two levels: differential TNFα gene expression and aberration of TNF receptor function. TNFα expression remained unchanged after suture placement. Suture placement led to differential regulation of TNFα at the mRNA level, no significant changes were detectable in protein levels, though. No differences were detectable in TNFα comparing WT to mutants. Indeed, the reviewer is right that we found differences in vascularization (determined by CD31 coverage). The differences, however, were very subtle and only detectable at 1 time point (D14). The animal model should show that TNFα -signaling might play a role by increasing TNFα -sensitivity of participating cells at constant TNFα levels. Again, these data cannot provide evidence for a significant role of TNFα- signaling in the suture model.

Fig1

Q2: The data in figure 1 would be more convincing if a negative control was included. Since the authors have access to the TNFR-deficient mice, these samples should be included to demonstrate specificity of their antibodies.

Answer: We agree with the reviewer that we did not show a control for immunohistochemistry by using specimen from TNFR deficient tissue. For that we would have to use TNFR KO mice, lacking the expression of the respective gene by transgenic knocked down. In our case, however, we use KI models leading to lack of function of the respective proteins. Here, TNF-Rp55 and TNF-Rp75 are produced but their functional activity was switched off by the transgene. For more details how the KI mutations were created see answer to Q4. An isotype control, depicting the background staining of the secondary antibody, is included to the supplement (S1 Fig). We added arrows and text to ease the understanding of the figure

Q3: What was the reason for using two different antibodies (CD68 and F4/80) in these samples?

Answer: We used CD68 predominantly for human samples to detect macrophages and F4/80 in murine samples since they are more convincing to identify all macrophages in mice [1]. Unfortunately, F4/80 is only detectable in rodents.

Q4: It is not clear why the TNFR-deficient mice would show TNFR gene expression. The authors should validate their RT primers and repeat these experiments.

Answer: This is a misunderstanding of our model. We have to apologize that the current description was not clear enough. Thus, we now clarify the nature of the mutant mice, their genetic background and the functional consequences more precise. As already stated above, the TNFR deficiency is a functional one. The mice harbor a null mutation of the respective TNFR leading to an altered gene product that lacks the molecular function of the wild-type gene. The non-functional proteins themselves are expressed, however. The TNF-Rp55 null mutations were created by disruption of the coding sequence of the TNF-Rp55 gene at base pair 535 (corresponding to the cDNA sequence) by insertion of a neo gene [2]. This resulted in the transcription and transduction of a non-functional TNF-Rp55 protein. Pfeffer et al validated the mutation by an experiment that showed the inability of spleen cells of the TNF-Rp55-/- mice to bind TNF-a

A similar strategy was pursued by Erickson et al creating the TNF-Rp75-/- mice [3]. In TNF-Rp75-/- mice challenged by LPS (that leads to shedding of the extracellular domain of TNF-Rp75), no soluble TNF-Rp75 could be detected in the serum.

We added the following sentence in the methods part to explain precisely the KI Model (p.5 Line 116ff:

“The mice harbor a null mutation of the respective TNFR leading to an altered gene product that lacks the molecular function of the wild-type gene. The non-functional proteins themselves are expressed. The TNF-Rp55 mutation was created by disruption of the coding sequence of the TNF-Rp55 gene by insertion of a neo gene (21). This resulted in the transcription and transduction of a non-functional TNF-Rp55 protein. A similar strategy was pursued by Erickson et al creating the TNF-Rp75d mice. A neomycin-resistance gene under control of the Pgk promoter20 was inserted in the second exon, which contains the signal peptide region of TNF-R2, resulting in the transcription and transduction of a non-functional TNF-Rp75 protein (22)”

Q5: Also, the western blot in figure 1F is inconclusive. Why is there no difference between wild type and knock out? Immunoblots for TNFR1 should also be included.

We validated the role of the TNFα signaling at the level of the TNFα -receptors. Figure 1F is an immunoblot showing the protein expression of TNF-Rp55 in TNF-Rp55d, TNF-Rp75d mice and wild-type littermates. As shown in bar chart 1G, there is no difference in protein expression of TNF-Rp55 among the groups. Especially TNF-Rp55 is not upregulated in the TNFrp-55d mice. Thus, we have convincing evidence, for the lack of compensatory upregulation of the TNFα-receptors expression in the KI-animals.

Fig2

Q6: CD31 positive/blood vessel area should be highlighted/indicated in figures 2B and 3C

Answer: We indicated the CD31/Lyve-1 covered area by arrows

Fig2 and Fig3

Q7: The data in figure 4 is inconclusive and is hard to interpret as is. The quality of the immunoblot is rather low. The authors could also consider evaluating the function of TNF using an in vitro system. This would further strengthen interpretation and conclusion.

Answer: We tried to evaluate the role of TNFα signaling in suture induced neovascularization and lymphangiogenesis at several levels. We analyzed gene expression and protein expression of TNFα and its receptors in wild-type and TNF-Rp55d or TNF-Rp75d mice respectively and could not find reliable evidence. Thus, taken our results from animal experiments, in vitro experiments would not add valuable data to the manuscript. More complex signaling cascades that involve many different cell types and structures, an environment that is impossible to mimic in vitro might help to explain the pathogenesis of suture induced alterations in the animals.

The protein concentration of TNF-α in the cornea is very low, also compared to other, mainly structural proteins that are expressed abundantly in the cornea. We provide an uncropped, unedited version of the original blot (see S3Fig). Unfortunately we are not able to substantially improve the quality of the signal. Even precipitation of TNFα did not improve the visibility of the TNF-α band.

Minor comments:

Q8: The title is confusing and should be revised. The authors study the effects of deficiency rather than malfunction.

Answer: We changed the title to “Effects of TNFα receptors TNF-Rp55 or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse.

Q9: The overall quality of the figure-PDF file is low. High resolution images and unified labels (font + size) should be provided with the revised manuscript.

Answer: The reviewer is right; the images in the current version are of poor quality/resolution. We significantly improved the resolution of the images and unified all the labels. We think that the current version is more appropriate now.

Answer: We thank the reviewer for his interest in the manuscript and we are thankful for the comments to improve the manuscript. We know that the results of co-localization analysis on sagittal sections have to be handled carefully. We agree with the Reviewer to state our conclusion more vaguely. Thus, we rephrased the sentence on p.9 line 228f. It is less speculative now by only stating “We also detected macrophages by CD68 staining, the receptors and macrophages, however, do not appear to co-localize.”

We renewed the negative controls by more convincing ones and added labels to S1 Fig (S3)/S2 Fig (S4) to ease the understanding at a glance.

Answer: Indeed, the reviewer is right that we found differences in vascularization and lymphangiogenesis (determined by CD31 or LYVE-1 coverage). The differences, however, were very subtle and only detectable at 1 time point (D14). These subtle differences might be statistically significant but not biologically relevant: The exact values for CD31 coverage on day 14 are: WT 15.6% ± 2.6%, TNF-Rp55d 12.4% ± 2.6% and TNF-Rp75d 9.6% ± 0.8%; for LYVE-1 coverage WT 9.7% ± 1.3%, TNF-Rp55d 8.4% ± 1.9%, TNF-Rp75d 7.2% ± 2.2%. The animal model should show that TNFα -signaling might play a role by increasing TNFα -sensitivity of participating cells at constant TNFα levels. Again, these data cannot provide evidence for a significant role of TNFα- signaling in the suture model.

Other comments:

Q1: In most experiments, how many mice were used is unclear.

Answer: we provide numbers for all individual figures now in the figure legend and the supplement (S1 Table/S2 Table for WB and PCR) as well as an overview of the total amount of animals in the methods part. We added this sentence (p5. Lines 127-128): “A total number of 47 TNF-Rp55d mice, and 47 TNF-Rp75d mice and 48 wild-type mice were used for this study.”

Q2: The authors only explored the expression of 3 genes that are related to neovascularization and lymphangiogenesis. Since many genes involve in regulation of neovascularization and lymphangiogenesis, the authors can't make a conclusion that TNFα and its ligands TNF-Rp55 and TNF-Rp75 do not play a significant role.

Answer: The reviewer is right that we only focused on few markers of neovascularization and lymphangiogenesis. The scope of the study, however, was to assess the differences in standard markers for neovascularization and lymphangiogenesis comparing to different KI models and WT before and after suture placement. We consider VEGF-A/VEGF-C and LYVE-1 as very robust and established markers for these 2 events. A detailed analysis of plenty of different angiogenesis markers like angiopoietin-1 angiopoietin-2, Tie-1, or endothelial cell adhesion molecules like VE-cadherin, PECAM-1, or several integrins would be out of the scope of the manuscript [4]. Furthermore, the take home message of the paper might not benefit from this extension of the analysis due to several problems, e.g. different time-points of regulation and low expression levels that we already suffered from with our rather robust read-out. Taken together, we did not find differential expression of TNFα after suture placement nor any conclusive effects at the level of the TNF-receptors, respectively.

Q3: TNF-a is an important cytokine in regulating corneal inflammation, neovascularization and lymphangiogenesis. In this study, a suture-induced corneal neovascularization model was used to identify the effect of TNF-a in corneal neovascularization and lymphangiogenesis. The model is so mild, many of the immunological cells and cytokines were not found significantly changed in this model. So that’s possible that you can’t observe much effects of TNF-a in this situation. Also, the suture-induced corneal neovascularization is not suitable to mimic the clinical scenario of corneal graft rejection. As we know, the corneal graft rejection is reasoned by exogenous antigen stimulation, which is not similar to the suture induced corneal neovascularization.

Answer: Indeed the reviewer is right that the suture-induced corneal neovascularization is not the ideal mouse-model to analyze corneal graft rejection, but it mimics the clinical scenario of a high-risk situation for a corneal graft rejection after keratoplasty. Compared to the alkali burn induced corneal neovascularization, the suture-induced model has a number of advantages especially studying the corneal lymphangiogenesis and associated prolymphangiogenic cytokines [5]. First, the sutures are more reproducible than the alkali burns on the cornea. Suturing only causes localized epithelial loss and inflammatory infiltration between the suture and the limbus, but chemical burns deplete the whole epithelial layer of the central cornea and cause strong cellular infiltration of the whole cornea [6]. Therefore, the suture-induced model mimics the clinical scenario of mild corneal lesions better than the alkali burn induced model. Fortunately, chemical burns in patients have become less common.

We clarified this in the discussion part, deleted the chapter about corneal graft rejection and added the following paragraph (p13, lines 363ff).

“Second, it is more suitable to analyse lymphangiogenesis and associated secretion of prolymphangiogenic cytokines [5]. The induced neovascularisation and lymphangiogenesis mimic the clinical scenario of high-risk situation for a corneal graft rejection after keratoplasty and thus it has more translational impact than the models with severe damage and reduced stimulation of the lymphangiogenesis. Suturing only cause localized epithelial loss and inflammatory infiltration between the suture and the limbus, but chemical burns deplete the whole epithelial layer of the central cornea and cause strong cellular infiltration of the whole cornea [6].”

Q4: A group of non-injured mice need to be added in each experiment. The authors should identify the expression of TNF-a has been increased in your models. Otherwise, there is no point to investigate the roles of TNF-a and its receptors in this model.

Answer: The reviewer rises two important questions: the lack of an appropriate control and the absence of a significant TNFα increase upon suture placement.

We have an inert control: only one eye was sutured, the counter-eye served as control. We added a sentence in the method part to highlight the presence of an appropriate control (p6 lines 133f.). The fact that TNFα was not significantly increased in our model does not question our conclusions. First, it might be an issue of the perfect time point that we did not find increased TNFα protein expression. We only checked Day 14 after suture placement. Theoretically, the receptor could also become more sensitive to TNFα at the same concentration by time. We checked not only for TNFα expression, but also TNFα receptor expression as well as function. Thus, we can safely state that TNFα does not play a role in this model. The TNFα increase alone is not necessary or sufficient.

Reviewer #4: The authors show that TNF-α and its receptors are not required for neovascularization and lymphangiogenesis in corneal suture model in mice. The data presented in Fig1 E, F and G indicates that the authors are working with mice where the TNFR receptors are not knocked and thus cannot make any claim on the role of TNFR in angiogenesis and lymphangiogenesis. I have to recommend rejecting the paper in its current form.

The following issues need to be addressed.

Q1: The quality of tissue in immunofluorescence images Fig1A and S3 and resolution of image is very poor and cannot be interpreted. It is unclear what region of the eye is shown in Fig1A although from result section it appears to be cornea. There is no indication of where TNFα receptor are localizing in the cornea. Please indicate where the receptors are localizing.

Answer: We agree with the reviewer that the resolution of the images was very bad in the draft of our manuscript. We addressed this issue and we now provide significantly better images in S1 Fig (S3) and S2 Fig (S4). We added arrows to depict structures/ staining and we added several remarks in the figure legends to improve understanding.

Q2: Fig 1B suffers from the same issue as Fig1 A. The tissue section is of extremely poor quality. The limbus region is suspect. Please show a phase image so one might see the iridiocorneal angle. The labels in B and C are confusing is label for C on left makes no sense to the reader. Should it not be cornea? If B and C are from the suture experiment (says Mouse + Suture on the right of panels) where are the controls or sham eyes?

Answer: We agree with the reviewer that the images in Fig1B are lacking the iridiocorneal angle. We display a bigger detail of the images now showing the iridiocorneal to ensure the localization of the section (at the limbus corneae). Furthermore, we are very sorry for the confusion induced by the labelling. All images in Fig1B and C are from WT mice that were sutured. Fig1B illustrates expression of F4/80 and TNFRp55 (left) and TNFrp75 (right) in the limbus area whereas Fig1C shows the expression of F4/80 and TNFRp55 (left) and TNFRp75 (right) in the suture area. We improved the labelling and the figure legends to ease the understanding for the reader here.

Q3: Why is TNFR2 75KDa not reduced in the TNFR2 knockout mouse in Fig 1D? Please reword Line 223-227 “The mRNA expression of TNFRp55 in the TNF-RP55d mice, however, is significantly reduced (Fig.1D, E) and the functionality of the receptors is disturbed. There is no evidence for differential regulation of the other receptor in the TNF-Rpd animals, neither on mRNA nor on protein level (Fig.1D, E,F, G, S1 Table 1) as is very confusing.

Answer: As explained above the mutation in TNFR deficient mice does not lead to a lack of expression, thus, mRNA expression of TNFR2 does not have to be reduced in TNF-Rp75d mice. The explanation is as follows: As already stated above, the TNFR deficiency is a functional one. The mice harbor a null mutation of the respective TNFR leading to an altered gene product that lacks the molecular function of the wild-type gene. The non-functional proteins themselves, however, are expressed. The TNF-Rp55 null mutations were created by disruption of the coding sequence of the TNF-Rp55 gene at base pair 535 (corresponding to the cDNA sequence) by insertion of a neo gene [2]. This resulted in the transcription and transduction of a non-functional TNF-Rp55 protein. Pfeffer et al validated the mutation by an experiment that showed the inability of spleen cells of the TNF-Rp55-/- mice to bind TNFα. Erickson et al, creating the TNF-Rp75-/- mice, pursued a similar strategy [3]. In TNF-Rp75-/- mice challenged by LPS (that leads to shedding of the extracellular domain of TNF-Rp75), no soluble TNF-Rp75 could be detected in the serum. Furthermore, we rephrased the sentence p.9 lines 234-237 accordingly:” The mRNA expression of TNFRp55 in the TNF-RP55d mice, however, is significantly reduced (Fig1D, E). There is no evidence for differential regulation of TNF-Rp75 in TNF-Rp55d animals or vice versa, neither on mRNA nor on protein level (Fig1D, E, F, G, S1 Table)

Q4: Fig 1F and G leads to question the entire premise of the paper- it seems TNFR1 protein is present in mutant hence the authors are working with essentially wt mice?? What is the state of the TNFR2 mutant mice? Does it still express TNFR2 protein? Please validate mice before doing the suture experiments. Please show a western blot showing the protein levels of TNFR1 and TNFR2 in wt and respective mutant mice.

Answer: The reviewer rises several important questions. First, the expression of TNF-Rp55 in TNF-Rp55d mice. As already stated in the answer to Q4 (Reviewer1), the mice harbor null-mutations of the respective genes leading to a malfunction of the receptors and not a lack of expression. Second, the reviewer asks for WB analysis of TNFR1 and TNFR2 expression in the different KI-models/WT mice. Figure 1F depicts an immunoblot showing the protein expression of TNF-Rp55 in TNF-Rp55d mice, TNF-Rp75d mice and wild-type littermates. As shown in bar chart 1G there is no difference in protein expression of TNF-Rp55 among the groups. Unfortunately, we cannot provide a WB of TNF-Rp75 since the antibody did not show a proper signal in WB in several trials.

Q5: Also need to this experiment with the double knockout mice given TNFα knockout seems to exacerbate neovascularization (Fujita 2007).

Answer: Thank you for the recommendation. The TNFα knockout mouse model is a completely different approach compared to our KI models. To evaluate our hypothesis, we however, decided to investigate initially whether one receptor is upregulated when the other is deficient. However, TNF-Rp55 is not upregulated in the TNF-Rp75d mice. Thus, we have convincing evidence, for the lack of compensatory upregulation of the TNFα-receptors expression in the KI-animals on both gene expression and protein expression level. Additionally, TNFα expression remained unchanged after suture placement. Suture placement led to differential regulation of TNFα at the mRNA level, no significant changes were detectable in protein levels, though. No differences were detectable in TNFα comparing WT to mutants. Therefore, we do not expect any influence of TNFα in a double KI or KO model.

Q6: The figures all seem to be of poor resolution making it hard to zoom in on panels to see detail.

Answer: As already stated above, we substantially improved the resolution of all images and headings.

REFERENCES

1. Khazen W, M'Bika J P, Tomkiewicz C, Benelli C, Chany C, Achour A, et al. Expression of macrophage-selective markers in human and rodent adipocytes. FEBS Lett. 2005;579(25):5631-4. Epub 2005/10/11. doi: 10.1016/j.febslet.2005.09.032. PubMed PMID: 16213494.

2. Pfeffer K, Matsuyama T, Kundig TM, Wakeham A, Kishihara K, Shahinian A, et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell. 1993;73(3):457-67. Epub 1993/05/07. doi: 10.1016/0092-8674(93)90134-c. PubMed PMID: 8387893.

3. Erickson SL, de Sauvage FJ, Kikly K, Carver-Moore K, Pitts-Meek S, Gillett N, et al. Decreased sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature. 1994;372(6506):560-3. Epub 1994/12/08. doi: 10.1038/372560a0. PubMed PMID: 7990930.

4. Shih SC, Robinson GS, Perruzzi CA, Calvo A, Desai K, Green JE, et al. Molecular profiling of angiogenesis markers. The American journal of pathology. 2002;161(1):35-41. Epub 2002/07/11. doi: 10.1016/S0002-9440(10)64154-5. PubMed PMID: 12107087; PubMed Central PMCID: PMCPMC1850687.

5. Giacomini C, Ferrari G, Bignami F, Rama P. Alkali burn versus suture-induced corneal neovascularization in C57BL/6 mice: an overview of two common animal models of corneal neovascularization. Exp Eye Res. 2014;121:1-4. Epub 2014/02/25. doi: 10.1016/j.exer.2014.02.005. PubMed PMID: 24560796.

6. Jia C, Zhu W, Ren S, Xi H, Li S, Wang Y. Comparison of genome-wide gene expression in suture- and alkali burn-induced murine corneal neovascularization. Molecular vision. 2011;17:2386-99. Epub 2011/09/17. PubMed PMID: 21921991; PubMed Central PMCID: PMCPMC3171500.

Attachment

Submitted filename: Revision_TNFa_AnswerRevisionNRfinal.docx

Click here for additional data file.^{(54.8KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0245143.r003

Decision Letter 1

Christina L Addison

23 Oct 2020

PONE-D-20-16932R1

Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

PLOS ONE

Dear Dr. Maier

Please pay particular attention to the quality of images and results presented as requested by reviewers. Additionally, discrepancies with published literature should be discussed in the manuscript as requested by reviewers.

Please submit your revised manuscript by December 22, 2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Christina L Addison, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

Reviewer #3: All comments have been addressed

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #1: The authors have improved the manuscript and addressed some of my concerns. However, there are fundamental discrepancies with previous literature that need to be explained prior to publication in PLOS ONE.

B6.129-Tnfrsf1atm1Mak/J, Jackson lab stock 002818 and B6.129S2-Tnfrsf1btm1Mwm/J, Jackson lab stock 002620 are targeted knockout animal strains and do not express TNFRp55 or TNFRp75 respectively.

These are conventional/“traditional” knockout mouse models that were generated in the Mid 90’s using a neomycin resistance gene flanked by homology arms to disrupt gene expression. Although the authors are correct that, in these studies, specific functional assays were used to confirm that the respective genes were no longer functional, this approach leads to a knockout of the targeted gene and not to a mutant form of the targeted gene.

In particular, while the authors indicate that the targeted approach by Pfeffer et al. leads to “the transcription and transduction of a non-functional TNF-Rp55 protein”, Pfeffer et al. generated mice that lack expression of TNFRp55. Similarly, Erickson et al. created mice that do not express TNFRp75. These 2 mouse lines are well-established null/knockout/deficient mouse models that have been utilized extensively. In addition, the knockout strategy is well-described in these two published studies.

With this in mind, the following questions still need to be addressed in a revised manuscript.

Q2: The data in figure 1 would be more convincing if a negative control was included. Since

the authors have access to the TNFR-deficient mice, these samples should be included to

demonstrate specificity of their antibodies.

Q4: It is not clear why the TNFR-deficient mice would show TNFR gene expression. The

authors should validate their RT primers and repeat these experiments.

Q5: Also, the western blot in figure 1F is inconclusive. Why is there no difference between wild type and knock out? Immunoblots for TNFR1 should also be included.

Reviewer #2: Not sure why the labels on the images indicate the fluorphore as opposed to the antigen targeting - please correct.

Adding the negative control to Figure 1, instead of only in a supplement, would still be advisable, but not absolutely necessary.

Reviewer #3: (No Response)

Reviewer #4: The authors have tried to address all the comments to the best of their abilities. However I still have several concerns:

1. My primary issue is the quality of the immunofluorescence data. The quality of the mouse eye sections (they look battered) are still quite terrible and in good conscience cannot allow this to be published . The VEGFA stain is quite peculiar. A schematic to show the location of the suture would be helpful with the limbus and parts of the eye clearly labeled so one may interpret authors images.

2. Please show data points for all graphs.

3. The images on the pdf are still terrible. The quality of the fig page improves when dowloaded. It is quite onerous for the reviewer to download each image (especially under the current pandemic situation and working from home). I don't know why the supplementary images are not part of the document. Please do so in the next iteration.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

PLoS One. 2021 Apr 9;16(4):e0245143. doi: 10.1371/journal.pone.0245143.r004

Author response to Decision Letter 1

20 Dec 2020

We thank the editorial board to give us the opportunity to improve our paper substantially according to the reviewers’ comments.

We answer the reviewer’s concerns point by point as follows.

Q1: B6.129-Tnfrsf1atm1Mak/J, Jackson lab stock 002818 and B6.129S2-Tnfrsf1btm1Mwm/J, Jackson lab stock 002620 are targeted knockout animal strains and do not express TNFRp55 or TNFRp75 respectively.

With this in mind, the following questions still need to be addressed in a revised manuscript.

We thank the reviewer for his thoroughness concerning the knock-in models. We still think there is a massive misunderstanding. We want to emphasize that B6.129-Tnfrsf1atm1Mak/J, Jackson lab stock 002818 and B6.129S2-Tnfrsf1btm1Mwm/J, Jackson lab stock 002620 lead to the transcription /translation of a truncated protein without proper function and are not KO-mutations in the sense that no mRNA and no protein at all are produced.

It is well known that the classic knockout models produced in the 90s are sometimes not full knockouts in a sense that the mRNA is truncated behind the neomycin cassette and the protein’s length corresponds with nucleotide sequence before the neomycin cassette. In some cases, mRNAS from more distal parts of the gene are produced and lead to a protein that represents a C-terminal part of the protein. Normally in the papers that introduce the model demonstrate the knockout most of the time by mRNA techniques for nucleotide sequences close to neomycin cassette. Thus, we checked this possibility in our study.

As the referee brought up this point in the sense to use TNFRp55d mice as antibody control for the anti-TNFR1 antibody we focus here in our response onto this mouse strain. The evidence comes from our PCR experiments where we show TNFRp55 expression in TNFRp55d mice, when using a primer that binds to nucleotide position 934-957 (F)/1085-1065 (R).

According to the information from Jackson about this strain, the neo cassette is inserted at nucleotide position 535. Using a primer pair that binds to nucleotide 500-520 (F) and 714-733 R or 481-501 (F) and 695-715 R, respectively did not lead to a specific amplification product in TNFRp55d mice, whereas in WT and TNFRp75d it did.

Figure1: mRNA expression of TNFRp55 in WT, TNFrp55d and TNFRp75d. Amplification product size: 234bp (left), 235bp (middle). GAPDH (190bp, right) Served as housekeeping gene. WT P17 O2 retina served as a murine control.

Along with this the immunogen for generating the antibody, we used for IHC and WB (CAT#: AP06465PU-N), Origene is a synthetic peptide, corresponding to the amino acids 370-420 of the human TNF-R1, and corresponding to the C-terminal end of the antibody. Therefore, we cannot use the TNFRp55d mice as an antibody control.

Thus, we conclude, that it is very likely that TNFRp55 is expressed as a truncated and non-functional protein in B6.129-Tnfrsf1atm1Mak/J.

We base this conclusion both on our experimental evidence and the data from Pfeffer and Erickson.

Our results presented in the manuscript are further substantiated by the new evidence derived from specific mRNA expression in TNFRp55d using primers beyond the neo-cassette and the use of C-terminal amino acids as immunogen.

All the following questions (Q2-Q5) address the same issue: the expression of TNFRp55 in TNFRp55d mice. Thus, for answering the questions we refer to the answer to Q1.

Q2: The data in figure 1 would be more convincing if a negative control was included. Since

the authors have access to the TNFR-deficient mice, these samples should be included to

demonstrate specificity of their antibodies.

Not feasible due to truncated protein and antibody binding at the C-terminal end.

Q4: It is not clear why the TNFR-deficient mice would show TNFR gene expression. The

authors should validate their RT primers and repeat these experiments.

TNF primers validated see above.

Q5: Also, the western blot in figure 1F is inconclusive. Why is there no difference between wild type and knock out? Immunoblots for TNFR1 should also be included.

See above; immunoblot for TNFR1. The western blot shows therefore the truncated protein in the TNFR1-KO, the full protein in the TNFR2 und WT probe. It shows that the TNFR2 knockout does not lead to a compensatory upregulation of the TNFR1.

Reviewer #2: Not sure why the labels on the images indicate the fluorophore as opposed to the antigen targeting - please correct.

Adding the negative control to Figure 1, instead of only in a supplement, would still be advisable, but not absolutely necessary.

Answer: We thank the reviewer for his suggestion. However, we think this is a misunderstanding. Negative control, in this case, means that we incubated the section only with the secondary antibody, omitting the primary antibody, in order to show false positive staining of the secondary antibody. This is the reason why we indicated the fluorophore and not the antigen.

As can be seen in the answer to Reviewer 1, it is impossible to have a TNFR1 negative control using the TNFRp55d mice, since they still express a truncated and non-functional TNFR1 protein, that can be detected by the antibody that binds to an amino acid sequence at the C-terminus.

Reviewer #3: (No Response)

Reviewer #4: The authors have tried to address all the comments to the best of their abilities. However, I still have several concerns:

Q1. My primary issue is the quality of the immunofluorescence data. The quality of the mouse eye sections (they look battered) are still quite terrible and in good conscience cannot allow this to be published. The VEGFA stain is quite peculiar. A schematic to show the location of the suture would be helpful with the limbus and parts of the eye clearly labeled so one may interpret authors images.

Answer: The quality of the mouse section depends on the processing of the sections. Embedding in paraffin, sectioning, rehydrating and especially the heat mediated antigen retrieval can lead to separations between the different corneal layers, which are very thin in the mouse cornea. Nonetheless, the various corneal layers, epithelium, stroma and endothelium, can be differentiated and are displayed very well in our figures. Indeed, the labeling is not sufficient; therefore we named the anatomic structures and marked the position of the sutures in our Figure 1, Supp. Figure 1 and 4. The limbus region is of particular interest due to the outgrowth of blood and lymph vessels into the cornea to the sutures.

Q2. Please show data points for all graphs.

Answer: We agree with the reviewer about the importance of showing all data that is included in the experiments to ensure and improve scientific transparency and reproducibility. In our opinion, however, including all data points in the individual graphs would lead to graphs that are very confusing and difficult to interpret. All data points and all raw data analyzed for this manuscript are available at the open access database Zenodo using the following link (https://doi.org/10.5281/zenodo.4049178). If Reviewer 3 is still convinced that the manuscript might profit from adding all data points, we can change the graphs accordingly.

Q3. The images on the pdf are still terrible. The quality of the fig page improves when downloaded. It is quite onerous for the reviewer to download each image (especially under the current pandemic situation and working from home). I don't know why the supplementary images are not part of the document. Please do so in the next iteration.

Answer: We are very sorry for the bad quality of the pdf generated by the submission website. Unfortunately, we are not able to change this. When you download the images, they are in an adequate resolution and quality.

The journal`s guidelines for submissions said to submit the supplement separately. We followed this suggestion. We add the images to the rebuttal letter to ease the review process.

Attachment

Submitted filename: TNFa_rebuttal2_finalNR.docx

Click here for additional data file.^{(7.1MB, docx)}

PLoS One. doi: 10.1371/journal.pone.0245143.r005

Decision Letter 2

Christina L Addison

23 Dec 2020

Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

PONE-D-20-16932R2

Dear Dr. Maier

Thank you very much for your careful consideration of the reviewer's concerns. We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

I would however advise you to carefully scrutinize image quality in the PLoS One system after uploading as indeed the quality of the labels of certain figures render them illegible, and the fluorescent images of those you attached are of much greater quality than those generated in the PDF of the manuscript following upload to the PLoS One Editorial Management system. As such I would contact the journal directly to ensure the image quality in your final manuscript that is to be uploaded online meets your standards and is not impaired by document transfers or resolution issues.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Christina L Addison, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0245143.r006

Acceptance letter

Christina L Addison

20 Jan 2021

PONE-D-20-16932R2

Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

Dear Dr. Maier:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Christina L Addison

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Isotype controls for the secondary antibodies applied in Fig 1, 1B and 1C and S2 Fig, respectively.

A (left side) depicts epithelium and stromal part of the cornea, while A (right side) depicts stroma and endothelium. Scale bars represent 100μm (A) or 50μm (B).

(TIF)

Click here for additional data file.^{(20.1MB, tif)}

S2 Fig

(TIF)

Click here for additional data file.^{(17.9MB, tif)}

S3 Fig. Uncropped WB of TNFa (Fig 4).

A, B: Uncropped representative images of Western blots used for the densitometric analysis in Fig 4C. All uncropped Western blots are shown in the Data repository.

(TIF)

Click here for additional data file.^{(14.8MB, tif)}

S1 Table. Statistical analysis of the qPCR data.

(DOCX)

Click here for additional data file.^{(17.8KB, docx)}

S2 Table. Statistics of the densitometric analysis.

(DOCX)

Click here for additional data file.^{(12.6KB, docx)}

S1 Raw images

(PDF)

Click here for additional data file.^{(3.3MB, pdf)}

Attachment

Submitted filename: Revision_TNFa_AnswerRevisionNRfinal.docx

Click here for additional data file.^{(54.8KB, docx)}

Attachment

Submitted filename: TNFa_rebuttal2_finalNR.docx

Click here for additional data file.^{(7.1MB, docx)}

Data Availability Statement

All relevant data are available on Zenodo (DOI: 10.5281/zenodo.4049178).

[pone.0245143.ref001] 1.Cursiefen C, Maruyama K, Jackson DG, Streilein JW, Kruse FE. Time course of angiogenesis and lymphangiogenesis after brief corneal inflammation. Cornea. 2006;25(4):443–7. 10.1097/01.ico.0000183485.85636.ff . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref002] 2.Fujita S, Saika S, Kao WW, Fujita K, Miyamoto T, Ikeda K, et al. Endogenous TNFalpha suppression of neovascularization in corneal stroma in mice. Investigative ophthalmology & visual science. 2007;48(7):3051–5. 10.1167/iovs.06-1083 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref003] 3.Chang JH, Gabison EE, Kato T, Azar DT. Corneal neovascularization. Current opinion in ophthalmology. 2001;12(4):242–9. 10.1097/00055735-200108000-00002 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref004] 4.Cursiefen C, Seitz B, Dana MR, Streilein JW. [Angiogenesis and lymphangiogenesis in the cornea. Pathogenesis, clinical implications and treatment options]. Der Ophthalmologe: Zeitschrift der Deutschen Ophthalmologischen Gesellschaft. 2003;100(4):292–9. 10.1007/s00347-003-0798-y . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref005] 5.Cursiefen C, Chen L, Borges LP, Jackson D, Cao J, Radziejewski C, et al. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. The Journal of clinical investigation. 2004;113(7):1040–50. 10.1172/JCI20465 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref006] 6.Baud V, Karin M. Signal transduction by tumor necrosis factor and its relatives. Trends in cell biology. 2001;11(9):372–7. 10.1016/s0962-8924(01)02064-5 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref007] 7.Lu P, Li L, Liu G, Baba T, Ishida Y, Nosaka M, et al. Critical role of TNF-alpha-induced macrophage VEGF and iNOS production in the experimental corneal neovascularization. Investigative ophthalmology & visual science. 2012;53(7):3516–26. 10.1167/iovs.10-5548 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref008] 8.Cade F, Paschalis EI, Regatieri CV, Vavvas DG, Dana R, Dohlman CH. Alkali burn to the eye: protection using TNF-alpha inhibition. Cornea. 2014;33(4):382–9. 10.1097/ICO.0000000000000071 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref009] 9.Ferrari G, Bignami F, Rama P. Tumor necrosis factor-alpha inhibitors as a treatment of corneal hemangiogenesis and lymphangiogenesis. Eye & contact lens. 2015;41(2):72–6. 10.1097/ICL.0000000000000071 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref010] 10.Saika S, Ikeda K, Yamanaka O, Flanders KC, Okada Y, Miyamoto T, et al. Loss of tumor necrosis factor alpha potentiates transforming growth factor beta-mediated pathogenic tissue response during wound healing. The American journal of pathology. 2006;168(6):1848–60. 10.2353/ajpath.2006.050980 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref011] 11.Yin Saika S. and yang in cytokine regulation of corneal wound healing: roles of TNF-alpha. Cornea. 2007;26(9 Suppl 1):S70–4. 10.1097/ICO.0b013e31812f6d14 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref012] 12.Maruyama K, Ii M, Cursiefen C, Jackson DG, Keino H, Tomita M, et al. Inflammation-induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. The Journal of clinical investigation. 2005;115(9):2363–72. Epub 2005/09/03. 10.1172/JCI23874 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref013] 13.Bock F, Onderka J, Dietrich T, Bachmann B, Pytowski B, Cursiefen C. Blockade of VEGFR3-signalling specifically inhibits lymphangiogenesis in inflammatory corneal neovascularisation. Graefe’s archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie. 2008;246(1):115–9. 10.1007/s00417-007-0683-5 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref014] 14.Cursiefen C, Ikeda S, Nishina PM, Smith RS, Ikeda A, Jackson D, et al. Spontaneous corneal hem- and lymphangiogenesis in mice with destrin-mutation depend on VEGFR3 signaling. The American journal of pathology. 2005;166(5):1367–77. 10.1016/S0002-9440(10)62355-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref015] 15.Zhang Q, Lu Y, Proulx ST, Guo R, Yao Z, Schwarz EM, et al. Increased lymphangiogenesis in joints of mice with inflammatory arthritis. Arthritis research & therapy. 2007;9(6):R118. 10.1186/ar2326 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref016] 16.Ji RC. Lymphatic endothelial cells, inflammatory lymphangiogenesis, and prospective players. Current medicinal chemistry. 2007;14(22):2359–68. 10.2174/092986707781745541 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref017] 17.Ji RC. Macrophages are important mediators of either tumor- or inflammation-induced lymphangiogenesis. Cellular and molecular life sciences: CMLS. 2012;69(6):897–914. 10.1007/s00018-011-0848-6 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref018] 18.Ferrari G, Bignami F, Giacomini C, Franchini S, Rama P. Safety and efficacy of topical infliximab in a mouse model of ocular surface scarring. Investigative ophthalmology & visual science. 2013;54(3):1680–8. 10.1167/iovs.12-10782 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref019] 19.Sedger LM, McDermott MF. TNF and TNF-receptors: From mediators of cell death and inflammation to therapeutic giants—past, present and future. Cytokine Growth Factor Rev. 2014;25(4):453–72. Epub 2014/08/30. 10.1016/j.cytogfr.2014.07.016 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref020] 20.Yang S, Xie C, Chen Y, Wang J, Chen X, Lu Z, et al. Differential roles of TNFalpha-TNFR1 and TNFalpha-TNFR2 in the differentiation and function of CD4(+)Foxp3(+) induced Treg cells in vitro and in vivo periphery in autoimmune diseases. Cell Death Dis. 2019;10(1):27. Epub 2019/01/12. 10.1038/s41419-018-1266-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref021] 21.Pfeffer K, Matsuyama T, Kundig TM, Wakeham A, Kishihara K, Shahinian A, et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell. 1993;73(3):457–67. Epub 1993/05/07. 10.1016/0092-8674(93)90134-c . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref022] 22.Erickson SL, de Sauvage FJ, Kikly K, Carver-Moore K, Pitts-Meek S, Gillett N, et al. Decreased sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature. 1994;372(6506):560–3. Epub 1994/12/08. 10.1038/372560a0 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref023] 23.Rothe J, Lesslauer W, Lotscher H, Lang Y, Koebel P, Kontgen F, et al. Mice lacking the tumour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature. 1993;364(6440):798–802. 10.1038/364798a0 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref024] 24.Bock F, Onderka J, Dietrich T, Bachmann B, Kruse FE, Paschke M, et al. Bevacizumab as a potent inhibitor of inflammatory corneal angiogenesis and lymphangiogenesis. Investigative ophthalmology & visual science. 2007;48(6):2545–52. 10.1167/iovs.06-0570 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref025] 25.Hos D, Bock F, Dietrich T, Onderka J, Kruse FE, Thierauch KH, et al. Inflammatory corneal (lymph)angiogenesis is blocked by VEGFR-tyrosine kinase inhibitor ZK 261991, resulting in improved graft survival after corneal transplantation. Investigative ophthalmology & visual science. 2008;49(5):1836–42. 10.1167/iovs.07-1314 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref026] 26.Kociok N, Radetzky S, Krohne TU, Gavranic C, Joussen AM. Pathological but not physiological retinal neovascularization is altered in TNF-Rp55-receptor-deficient mice. Investigative ophthalmology & visual science. 2006;47(11):5057–65. 10.1167/iovs.06-0407 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref027] 27.Wu M, Du Y, Liu Y, He Y, Yang C, Wang W, et al. Low molecular weight hyaluronan induces lymphangiogenesis through LYVE-1-mediated signaling pathways. PloS one. 2014;9(3):e92857. 10.1371/journal.pone.0092857 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0245143.ref028] 28.Giacomini C, Ferrari G, Bignami F, Rama P. Alkali burn versus suture-induced corneal neovascularization in C57BL/6 mice: an overview of two common animal models of corneal neovascularization. Exp Eye Res. 2014;121:1–4. Epub 2014/02/25. 10.1016/j.exer.2014.02.005 . [DOI] [PubMed] [Google Scholar]

[pone.0245143.ref029] 29.Jia C, Zhu W, Ren S, Xi H, Li S, Wang Y. Comparison of genome-wide gene expression in suture- and alkali burn-induced murine corneal neovascularization. Molecular vision. 2011;17:2386–99. Epub 2011/09/17. [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Effects of TNFα receptor TNF-Rp55- or TNF-Rp75- deficiency on corneal neovascularization and lymphangiogenesis in the mouse

Anna-Karina B Maier

Nadine Reichhart

Johannes Gonnermann

Norbert Kociok

Aline I Riechardt

Enken Gundlach

Olaf Strauß

Antonia M Joussen

Roles

Abstract

Introduction

Material and methods

Human tissue

Animals

Mouse model of suture-induced, inflammatory corneal neovascularization

Immunohistochemistry on sagittal sections and cornea whole-mounts

Whole-mounts

Sagittal sections

RNA Isolation and RT-PCR

Table 1. Primer sequences.

Western blot analysis of TNFα and its receptors

Statistical analysis

Results

Expression of TNF-Rp55 and TNF-Rp75 in the cornea

Fig 1. TNF-Rp55 and TNF-Rp75 expression in human and in murine cornea.

Corneal neovascularization in TNF-Rp55d mice and TNF-Rp75d mice in the suture model

Fig 2. Corneal neovascularization in TNF-Rp55d mice and TNF-Rp75d mice in the suture model.

Corneal lymphangiogenesis in TNF-Rp55d mice and TNF-Rp75d mice in the suture model

Fig 3. Corneal lymphangiogenesis in TNF-Rp55d mice and TNF-Rp75d mice in the suture model.

Influence of suture placement on TNF-α expression in wild-type, TNF-Rp75d and TNF-Rp55d

Fig 4. Influence of suture placement on TNFα expression.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Christina L Addison

Roles

Author response to Decision Letter 0

Decision Letter 1

Christina L Addison

Roles

Author response to Decision Letter 1

Decision Letter 2

Christina L Addison

Roles

Acceptance letter

Christina L Addison

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases