ClpC-Mediated Sporulation Regulation at Engulfment Stage in Bacillus anthracis

Abstract

Bacterial sporulation is a conserved process utilized by members of Bacillus genus and Clostridium in response to stress such as nutrient or temperature. Sporulation initiation is triggered by stress signals perceived by bacterial cell that leads to shutdown of metabolic pathways of bacterial cells. The mechanism of sporulation involves a complex network that is regulated at various checkpoints to form the viable bacterial spore. Engulfment is one such check point that drives the required cellular rearrangement necessary for the spore assembly and is mediated by bacterial proteolytic machinery that involves association of various Clp ATPases and ClpP protease. The present study highlights the importance of degradation of an anti-sigma factor F, SpoIIAB by ClpCP proteolytic machinery playing a crucial role in culmination of engulfment process during the sporulation in Bacillus anthracis.

Introduction

Bacillus genus under the phylum firmicutes comprises of rod shaped, spore forming Gram-positive bacteria. Most of the members of this genus are non-pathogenic and have a wide range of biotechnological and industrial applications such as hydrogen production and synthesis of anti-pathogenic molecules [1–8]. While, a few of them are known to cause disease in mammals and are studied to decipher the pathogenesis of spore forming bacteria. Anthrax is a bacterial disease caused by chain forming bacteria, Bacillus anthracis. This disease is often considered fatal and is initiated when the Bacillus anthracis spores gain access inside the host system [9, 10]. Bacillus anthracis has one single chromosome (5,227,293 bp) and two extracellular virulence plasmids—pXO1 (181,677 bp) and pXO2 (94,829 bp). Plasmid pXO1 encodes for anthrax toxin proteins (protective antigen, lethal factor and edema factor), while the capsule (poly-γ-D-glutamic acid) is encoded by pXO2. These virulence factors help the bacilli to evade the immune system response inside the host and helps in disease establishment [11]. To survive under unfavorable environmental conditions, vegetative cells undergo sporulation, the process of spore formation. Sporulation is a complex pathway regulated by various protein modifications and protein degradation that ultimately resets the bacillus machinery and leads to the formation of metabolically inert spores. The process of sporulation is initiated by the formation of an asymmetric polar septum resulting in two unequal sized cell compartments that are separated by a double membrane septum. The larger one (mother cell) nurtures the smaller one (forespore) which is subsequently engulfed by the mother cell and differentiated into a dormant spore. Engulfment is one of the most critical steps in sporulation and is marked by the breakdown of septal peptidoglycan by various cell wall hydrolases in a phagocytosis like manner. The cellular arrangement after engulfment results in spore assembly by the packaging of forespore in various protective layers known as spore coat. Finally, the mature dormant spore is released into the environment by the lysis of the mother cell [12–14].

Sporulation is an energy intensive and irreversible developmental process marked by protein degradation and efficient protein localization especially during the engulfment stage [14–16]. Spatiotemporal expression of some specific transcription factors is also a requisite for successful completion of sporulation. These transcription factors are four alternate RNA polymerase σ-factors which guide this developmental process to completion and are sequentially activated in the order: σF, σE, σG, and σK in the forespore and mother cell. During the initial stages of sporulation, after the completion of asymmetric septation, σF in forespore and σE in mother cell is activated which control the gene expression. This is followed by a molecular switch from σF to σG in forespore and σE to σK in mother cell that regulates post-engulfment processes in sporulation [17–19]. The complex network of gene regulation is achieved by tight intracellular signaling pathways between the two compartments, wherein protein degradation plays a vital role. This is achieved by a bipartite enzyme system comprising of a peptidase ClpP which interacts with one of the several ATPase subunits (ClpA, ClpC, ClpX, and ClpE) [16, 20] (Fig. 1). Among these, ClpX is found to be essential for the activation of sigma factor σH (Spo0H) which is required for the sporulation initiation in B. subtilis and is later degraded by ClpCP (ClpC and ClpP) proteolytic machinery after its role is accomplished [21–23]. ClpCP gets localized at the forespore polar foci, whereas ClpXP (ClpX and ClpP) localizes to the mother cell compartment which is important for the cell specific activation of sigma factors during sporulation events [16]. Additionally, a previous study by our group showed the functional relevance of ClpC in the physiology of B. anthracis by using a clpC deleted strain in the background of B. anthracis Sterne 34F2 (BAS-WT) strain [24]. We observed a highly defective sporulation efficiency (~ 40%) and germination efficiency (~ 9%) in the absence of ClpC which is indicative of its crucial role in sporulation in B. anthracis [24]. In view of this, we have further studied the role of ClpC protein during sporulation in B. anthracis. Our results indicate the involvement of ClpC protein in sporulation regulation at the engulfment stage by microscopic studies. We also observed higher protein expression of an anti-sigma factor SpoIIAB in the clpC deleted strain that is known to inhibit σF activation and its downstream genes involved during sporulation engulfment stage.

Fig. 1.

Schematic representation of sporulation stages and mode of action of ClpCP proteolytic machinery in the activation of σF during engulfment stage of sporulation. The different stages of sporulation are represented as: (I) vegetative stage; (II) chain shortening during stress; (III) polar septation; (IV) engulfment of forespore by mother cell; (V) maturation of spore inside mother cell; (VI) mother cell lysis; (VII) release of mature spore. Figure projected within dotted arrows represent the activation of σF in forespore during engulfment stage by proteolysis of anti-sigma factor SpoIIAB by ClpCP proteolytic machinery. SpoIIAB associates with σF at the onset of sporulation leading to its inactivation. Anti-anti-sigma factor SpoIIAA then binds to this complex releasing SpoIIAB and sets σF free. SpoIIAB gets degraded by the ClpCP proteolytic complex while free σF binds to RNA Polymerase and activates the σF regulon resulting in the expression of downstream genes involved in spore engulfment

Materials and Methods

Bacteria Strains and Growth Conditions

Bacillus anthracis Sterne 34F2 (BAS-WT) was used as the parent strain in this study. Strategy used for generation of clpC deletion strain (BAS-ΔclpC) and complement strain (BAS-ΔclpC::clpC) is described previously [24, 25] Strains for cloning (Escherichia coli DH5α) and recombinant protein expression (BL21-DE3) were procured from Invitrogen. 100 μg/ml of ampicillin and 25 μg/ml of kanamycin were used to supplement the media wherever required. All the strains were grown in Luria–Bertani (LB) broth (Difco, USA) supplemented with appropriate antibiotics at 37 °C at 200 rpm. For sporulation (described below), strains were grown in sporulation media at 30 °C (strain details provided in Table 1).

Table 1.

Strains used in the study

Name	Genotype	Resistance marker	References
DH5α	E. coli fhuA2, Δ(argF-lacZ)U169, phoA glnV44, Φ80, Δ(lacZ)M15, gyrA96, recA1, relA1, endA1, thi-1, hsdR17	–	Invitrogen
BL21(DE3)	E. coli B strain: F-, dcm, ompT, hsdS(rB- mB-), gal,λDE3(lacI lacUV5-T7 gene 1, ind1, sam7, nin5)	–	Invitrogen
BAS-WT	B. anthracis Sterne strain pXO1+, pXO2−	–	NIAID, NIH
BAS-$\mathrm{\Delta }$ clpC	B. anthracis Sterne::clpC−	–	[24]
BAS-$\mathrm{\Delta }$ clpC::clpC	B. anthracis Sterne::clpC− + pYS5-clpC	Kanamycin	[24]

Spore Preparation

The overnight grown cultures of BAS-WT, BAS-ΔclpC, and BAS- ΔclpC::clpC strains were used for sporulation initiation at staring OD (A600nm) of 0.05. Sporulation media comprises 8 g of LB broth per liter with a pH of 6.0. This is supplemented with 85.5 mM NaCl, 0.025 mM ZnSO₄, 0.6 mM CaCl₂, 0.3 mM MnSO₄, 0.8 mM MgSO₄, and 0.02 mM CuSO₄ [26].

Cultures were grown continuously for 72 h at 30 °C with constant shaking at 200 rpm. Following this, the spores were checked microscopically and harvested at following conditions: 4 °C, 12,000 g for 15 min. These spores were then washed thrice with 0.85% saline solution followed by resuspension in 1 ml 0.85% saline solution and was stored at − 20 °C till further processing.

Confocal Microscopy

FM4-64 (Thermo Fisher Scientific), a membrane staining dye was used to label the membrane and to study the course of sporulation in BAS-WT and BAS-ΔclpC strains using fluorescence. To achieve this AB gene frame (Fischer Scientific; 17 × 54 mm) was used to prepare the agarose pad supplemented with sporulation media on corning frosted glass slides (75 × 25 mm). For the preparation of agarose pads, low melting agarose (Sigma) at final concentration of 3% in sporulation media was evenly spread on the slides and dried for few minutes. 1 µl culture of BAS-WT and BAS-ΔclpC strains grown up till the mid-log phase were spread on the agarose pad, after diluting the cultures to an OD (A600nm) of 0.035. Agarose pads were supplemented with 1 μg/ml FM4-64 dye for staining the membranes. These agarose pads were kept at 30 °C and images were captured at 24 h, 48 h and 72 h using 63X oil immersion objective of Leica TCS SP8 confocal laser scanning microscope (By Leica Microsystems Europe) at CSIR- IGIB, Confocal facility [27].

Transmission Electron Microscopy

The ultrastructural details of spores of BAS-WT, BAS- ΔclpC, and BAS-ΔclpC::clpC strains were studied using transmission electron microscopy. Spore suspensions of these strains were pelleted at 12,000g, 4 °C followed by washing thrice with 100 mM sodium phosphate buffer (pH 7.4). Overnight primary fixation at 4 °C in Karnovsky’s fixative [100 mM sodium phosphate buffer of pH 7.4, 2% paraformaldehyde (Sigma) and 2.5% glutaraldehyde] was done and fixed spores were washed with sodium phosphate buffer to completely rinse off the residual fixative. Osmium tetroxide at a final concentration of 1% (20 min, 4 °C) was used for secondary fixation followed by sequential dehydration using acetone (Merck). Samples were then treated with absolute xylene (Merck) for clearing and removal of dehydrating agent. This was followed by infiltration and embedding of samples in the araldite resin mixture (TAAB, UK). Curing was done sequentially at 55 °C and 65 °C for 24 h and 48 h respectively for final bullet preparation. Grids were prepared by sectioning the bullets using Leica UC6 ultracut. These grids were then visualized using FEI Tecnai G2 Spirit at 200 kV (Manufacturer- FEI, New York) at SAIF-AIIMS TEM facility [24].

Phase Contrast Microscopy

BAS-WT and BAS-ΔclpC strains were grown in sporulating conditions and 1 ml sample was collected post 25 h. The cell pellet was washed thrice with 100 mM sodium phosphate buffer (pH 7.4) followed by resuspension in 100 µl buffer. Finally, images were captured using Zeiss Axio Imager Z2 Upright Microscope.

Protein Purification, Antibody Generation and Western Blot Analysis

For purification of SpoIIAB (BAS-3984) and GroEL (BAS-0253), primers specific to genes (listed in Table 2) were used to amplify the genes using BAS genomic DNA. The amplified products were cloned in pPROEXHTc vector (Invitrogen) and the resultant plasmid harboring the recombinant proteins with Hexa-His tag were transformed into BL21 (DE3) strain. Protein purification was done using Ni–NTA affinity chromaography and the purified proteins were run on the SDS-PAGE gel with appropriate protein markers (Biorad, Precision Plus Protein-#1610363; Abcam-ab116028) [28, 29]. The concentration of purified SpoIIAB and GroEL was estimated by Pierce BCA Protein Assay kit (Thermo Fisher Scientific). These purified proteins, were then used to generate polyclonal antibodies in mice. 30 µg purified protein sample was injected subcutaneously in 3 BALB/c mice after emulsification in complete Freund’s adjuvant (Sigma-Aldrich). Two booster doses of 15 µg protein emulsified in incomplete Freund’s adjuvant was given to each mouse. Final bleed was collected 14 days after the last injection, to get the serum. For further experiments, the antibody titer was calculated by indirect-ELISA. Briefly, the bacterial lysates were used as antigen and were loaded in 96-well plate after diluting in the coating buffer. The plate was kept for incubation at 4 °C overnight followed by PBST washing (thrice). Blocking buffer was then added in the wells and incubated for 1 h at RT and washing steps were repeated. After this, different antibody dilutions were used, followed by PBST washing and a second incubation was done using HRP conjugated secondary antibody. Finally, colour development was observed using OPD substrate to calculate the required antibody titre. The experiment was repeated thrice to confirm the antibody dilution and used accordingly in our study. The whole cell lysate preparation and western blot analysis were done according to the protocol described previously [24, 28]. The antibody titers used were 1:20,000 for GroEL and 1:15,000 for SpoIIAB. HRP conjugated secondary antibody (Cell Signaling Technology) against mice was used and finally the signal was detected using SuperSignal West Pico PLUS Chemiluminescent substrate (Thermo Fisher Scientific).

Table 2.

Primers and clones

Genes	Vectors	Restriction sites	Primers (5′–3′)a	References
spoIIAB (BAS3984)	pPROEXHTc	FP-BamH1	GGCATAAGGATCCGGATGAGAAATGAAATGAACC	This study
		RP-Xho1	CTATTCTCCCTCGAGTTAATTGCATAGAGCGTTAC
groEL (BAS0253)	pPROEXHTc	FP-BamH1	AATCCAAGGGGGTGGATCCTTATGGCAAAAG	This study
		RP-Xho1	TTAGGGCAAACTCGAGTTACATCATTCCGCCC

^aRestriction sites have been underlined

Results

Sporulation Kinetics of BAS-WT and BAS-ΔclpC Strain

Sporulation is an important developmental pathway in life cycle of B. anthracis and is tightly regulated by various cellular rearrangements. ClpC in association with ClpP protease protects the bacteria during stress by playing an indispensable role in maintaining the cellular protein quality [15, 30]. The role of ClpC during sporulation in B. anthracis was studied by our group wherein clpC deletion resulted in defective sporulation [23]. To study this at morphological level both BAS-WT and BAS-ΔclpC strain were grown on agarose pad supplemented with sporulation media and FM4-64 membrane staining dye till 72 h and images were captured after every 24 h. In the case of BAS-WT strain, sporulation initiation was observed at 48 h and complete sporulation was seen at the end of 72 h (Fig. 2, upper panel). While in the case of BAS-ΔclpC strain defective sporulation was observed even at 72 h time point (Fig. 2, lower panel). The spores were seen entrapped in the vegetative cells in the absence of ClpC protein which indicates the role of ClpC during sporulation events.

Fig. 2.

Confocal micrographs showing the time course of sporulation in BAS-WT and BAS-ΔclpC strains at different time points (24 h, 48 h, 72 h). Cells of both the strains were diluted to a primary OD (A600nm) of 0.035 and 1 μl of cell suspension was spread on the agarose pads supplemented with sporulation media and FM4-64 membrane staining dye. The agarose pads were incubated at 30 °C and were imaged by Leica SP8 confocal microscope at above mentioned time points. Magnification = ×63; scale bar 10 μm in all the images

Defects in Spore Formation in BAS-ΔclpC Strain

The ultrastructural details of a B. anthracis spore show multiple layers that acts as a barrier and protective shield necessary for its survival in harsh conditions. These layers comprise of a core wall, cortex, spore coat, and exosporium and are formed after forespore engulfment by the mother cell [31]. To gain further insight into the nature of defect as observed in our previous microscopic study, we prepared the samples of BAS-WT and BAS-ΔclpC strains and analyzed them by transmission electron microscopy (Fig. 3). BAS-WT spores showed the presence of all the layers (Fig. 3, upper panel, different layers denoted by black arrows) while defective spore ultrastructure was observed in BAS-ΔclpC spores wherein the forespore compartment was not engulfed by the mother cell compartment (Fig. 3, middle panel, engulfment defect denoted by red arrows). This shows that ClpC is essential for the completion of sporulation in B. anthracis and the absence of ClpC hinders the completion of sporulation process possibly at the engulfment stage.

Fig. 3.

Transmission electron micrographs depicting the ultrastructural details of spores formed by BAS-WT, BAS-ΔclpC, and BAS-ΔclpC::clpC strains. Sporulation was induced as described in the material and method section. BAS-WT spores show intact layers. However, BAS-ΔclpC spore images show a possible defect in engulfment, while this defect was rescued in BAS-ΔclpC::clpC strain. Black arrows represent the different layers of a mature spore: exosporium (ES), spore coat (SC), cortex (C), core wall (CW). MC mother cell, FS forespore. Red arrows denote the engulfment defect in BAS-ΔclpC strain. Magnification = ×15,000; the scale bar is represented on respective images

To corroborate this engulfment defect, we used the native complement strain of clpC (BAS-ΔclpC::clpC). The wild type copy of clpC gene was complemented into BAS-ΔclpC strain under the control of its native promoter using the pYS5 vector [24, 32]. For this purpose we subjected BAS-ΔclpC::clpC strain to sporulation under the same conditions as for BAS-WT and BAS-ΔclpC strains. The ultrastructural details of BAS-ΔclpC::clpC spores were analyzed by TEM and were found to be similar to BAS-WT spores (Fig. 3, lower panel, different layers denoted by black arrows). This confirms the direct role of ClpC in the regulation of sporulation in B. anthracis.

Fate of Sigma Factor F (σF) in BAS-ΔclpC Strain

σF is the first cell-specific sporulation transcription factor that initiates a signaling cascade resulting in compartmentalized gene expression, which is indispensable for sporulation in Bacillus. σF activation takes place in the forespore just after the formation of asymmetric septa. This, in turn, results in the activation of σE in the mother cell compartment, and together these two transcription factors control the expression of genes involved in the engulfment process and for forespore development during sporulation process [33]. The activation of σF follows a complex circuit which involves an anti-sigma factor protein, SpoIIAB [34, 35]. Association of σF with SpoIIAB inhibits its binding to RNA polymerase while the dissociation of these two is achieved by an anti-anti-sigma factor SpoIIAA which is further regulated by dephosphorylation mediated by a membrane associated phosphatase SpoIIE [36, 37]. The binding of SpoIIAA to SpoIIAB-σF complex sets σF free for binding to RNA polymerase (Fig. 1). Also, SpoIIAB proteolysis by ClpCP proteolytic machinery has been shown to be important for the activation of σF dependent gene expression in B. subtilis [38, 39].

Based on the above findings in B. subtilis and engulfment defects observed in our study, we studied the expression of SpoIIAB in BAS-WT and BAS-ΔclpC strains by using SpoIIAB specific antibody. For this, recombinant SpoIIAB protein was purified from E. coli (BL21 DE3) strain and the antibody was raised in mice as described in material and methods section. GroEL antibody was used as a loading control and prepared in the similar way (Fig. 4). Lysates prepared at the indicated time point, t = 25 h (Fig. 5a) showed a higher expression (~ 6 times) of SpoIIAB protein in BAS-ΔclpC strain as compared to BAS-WT strain (Fig. 5b, c). The higher level SpoIIAB in BAS-ΔclpC strain can possibly inactivate σF by binding and will not allow its interaction with RNA polymerase.

Fig. 4.

Purification and antibody generation against recombinant SpoIIAB and GroEL. a Upper panel shows recombinant SpoIIAB purified by Ni–NTA affinity chromatography resolved on a SDS-PAGE and lower panel shows immunoblot of SpoIIAB using purified recombinant SpoIIAB protein. b Upper panel shows recombinant GroEL purified by Ni–NTA affinity chromatography resolved on a SDS-PAGE and lower panel shows immunoblot of GroEL using purified recombinant GroEL protein

Fig. 5.

Expression levels of SpoIIAB in BAS-WT and BAS-ΔclpC strains. a Phase contrast images of sporulating BAS-WT and BAS-ΔclpC strains depicting the stage (t = 25 h) at which cells were harvested for lysate preparation to check the expression of SpoIIAB. The scale bar is represented on the respective image; Magnification = ×100. b Immunoblot representing the expression levels of SpoIIAB protein in both strains. Blots were then stripped and reprobed with anti-GroEL antibody. GroEL here acts as loading control. Representative image is from the one of four independent experiments. c Densitometric analysis of the immunoblots in panel b for the quantification of SpoIIAB expression in BAS-WT and BAS-ΔclpC strains. Each error bar denotes standard deviation where n = 4. Statistical significance was analysed using unpaired t-test and represented above the bars in the form of *. p value was reported to be 0.0008 and considered significant (p < 0.001 denotes***)

Discussion

Clp ATPases belong to AAA + superfamily of ATPases that are widely conserved in the bacterial system and are known to play an important role in various cellular processes like DNA replication, protein transport, transcription regulation, protein degradation and stress conditions [20, 39]. In the model organism B. subtilis, the role of Clp ATPases (ClpC, ClpX) and ClpP peptidase is extensively studied and reported to be crucial for the proteolysis of misfolded proteins during various stress conditions [15, 30, 40, 41]. However, in the pathogenic strain B. anthracis very little is known about the role of ClpC and thus needs to be explored more. One of the finding by our group showed the importance of ClpC protein in B. anthracis physiology by using a deletion mutant strain of this protein and found defective sporulation and germination efficiencies in the absence of ClpC protein [24]. Present study encompasses the mechanistic aspect of ClpC ATPase mediated proteolysis in regulation of the sporulation events.

Sporulation process includes septation, engulfment, spore maturation and finally mother cell lysis. To find out the specific stage at which sporulation pathway was arrested in BAS-ΔclpC strain, we monitored sporulation kinetics of the clpC deletion mutant strain and compared it to BAS-WT strain. Interestingly, we found this arrest happens possible after the asymmetric septation stage (24 h) in the BAS-ΔclpC strain (Fig. 2). To get a better insight of this, we studied the sporulating bacillus cells at ultrastructural level by transmission electron microscopy (Fig. 3). Samples were processed when complete sporulation was seen in BAS-WT strain and 0.85% saline was used to prevent vegetative cell membrane lysis. Interestingly, we observed engulfment defects in BAS-ΔclpC strain (Fig. 3, middle panel, engulfment defect denoted by red arrows) while BAS-WT spores were intact with presence of all the spore layers (Fig. 3, upper panel, different layers denoted by black arrows). Also, this defect was absent in the BAS-ΔclpC::clpC complement strain (expression of clpC under its own promoter) (Fig. 3, lower panel, different layers denoted by black arrows).

These observations suggest the direct role of ClpC protein during engulfment stage in sporulation pathway. As the activation and expression of σF is reported to be an essential requirement for the expression of engulfment proteins during sporulation [33, 38], we selected SpoIIAB protein as a candidate that binds to σF protein and thereby prevents its binding to RNA polymerase (Fig. 1). To study the expression level of SpoIIAB, we probed the lysates of BAS-WT and BAS-ΔclpC strain using SpoIIAB specific antibody. Quantitative analysis showed a significant difference in SpoIIAB protein level in BAS-WT as compared to BAS-ΔclpC strains. SpoIIAB protein level in BAS-ΔclpC strain was about 6 times higher than the BAS-WT strain (Fig. 5b, c). These results suggest the role of ClpC mediated proteolysis of SpoIIAB protein at engulfment stage during sporulation which possibly regulates the activation of σF and thus helps the developing spore maturation by providing the necessary protein machinery involved in the engulfment process during sporulation in B. anthracis.

Conclusion and Future Direction

Bacillus anthracis spores being the infectious entities in anthrax infection are of particular importance for studying the pathogenesis of anthrax disease. Forespore engulfment by mother cell compartment is a crucial step for the maturation of developing spore. Through this study we demonstrate the degradation of an anti-sigma factor SpoIIAB by ClpCP protease machinery playing a crucial role in the regulation of sporulation process in B. anthracis. Also, as the engulfment process itself requires multiple proteins that are regulated at various levels the involvement of other proteins like SpoIIQ, SpoIIIAH, SpoIID, SpoIIM, SpoIIP [33] cannot be overlooked and need to be studied in depth to corroborate this study and to enhance our current understanding on the mechanistic role of ClpC protein in the physiology of B. anthracis and other spore forming pathogenic bacteria.

Author Contributions

NK designed the study. NK, AG, ND, and NS performed the experiments. NK, AG and YS analyzed the results. ND, CCK, and ET helped in the preparation of manuscript. YS provided the necessary funds and facilities for the experiments.

Funding

Funding was provided by J.C. Bose Fellowship to YS and SERB Grant no. CRG/2018/000847/HS.

Declarations

Conflict of interest

The authors declare no conflict of interest.