Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 May 1.
Published in final edited form as: Neuroscience. 2021 Mar 6;461:11–22. doi: 10.1016/j.neuroscience.2021.02.032

Characterization of proinflammatory markers in the ventral tegmental area across mouse models of chronic stress

Vedrana Bali 1,2, Sarah C Simmons 2, Claire E Manning 2, Marie A Doyle 2, Minerva Rodriguez 2, Ali R Stark 2, Shantée N Ayala Rosario 2, AJ Robison 1,2, Michelle S Mazei-Robison 1,2,*
PMCID: PMC8043994  NIHMSID: NIHMS1683444  PMID: 33689861

Abstract

Despite the high prevalence of major depressive disorder (MDD), understanding of the biological underpinnings remains limited. Rodent models suggest that changes in activity and output of dopamine (DA) neurons in the ventral tegmental area (VTA) are important for depressive-like phenotypes. Additionally, brain inflammatory processes are thought to contribute to MDD pathology and inflammation in the VTA has been linked to changes in VTA DA neuronal activity. Thus, we sought to determine whether there is increased inflammatory signaling in the VTA following forms of chronic stress that induce depressive-like symptoms. First, we subjected male mice to either physical or vicarious chronic social defeat stress (CSDS), paradigms known to induce long-term depressive-like behavior and changes in VTA signaling. Second, we subjected male and female mice to subchronic variable stress (SCVS), a paradigm that induces depressive-like behavior only in female mice. We then isolated mRNA from the VTA and assessed proinflammatory gene regulation via RT-PCR. Our results show that physical, but not vicarious, CSDS increases interleukin 1β (IL-1β) mRNA expression and this inversely correlates with social interaction score. In contrast, IL-1β expression was unchanged in male or female mice following SCVS. No significant increases in VTA ionized calcium binding adapter molecule 1 (Iba1) and glial fibrillary acidic protein (GFAP) immunochemistry were detected following CSDS that would be indicative of a robust inflammatory response. In conclusion, we show that chronic stressors distinctively alter expression of proinflammatory genes in the VTA and changes may depend on the severity and time-course of the stress exposure.

Keywords: Ventral tegmental area, inflammation, chronic stress, gene expression

Introduction

Major depressive disorder (MDD) is a prevalent psychiatric disorder affecting more than 150 million people worldwide (Global Burden of Disease Collaborators, 2018). The most commonly used therapeutic approach is pharmacotherapy with antidepressant drugs. Typical antidepressants primarily target the serotonin and/or norepinephrine neurotransmitter systems and take weeks to achieve full therapeutic efficacy. Unfortunately, a large proportion of MDD subjects are resistant to pharmacological treatment (Souery et al., 2006), and while stimulation-based treatments such as transcranial magnetic stimulation and electroconvulsive therapy help some, it is clear that improved antidepressants are needed. The development of new antidepressants will likely depend on improved understanding of the varied biological contributors to MDD etiology.

Growing evidence supports a link between depression and inflammatory processes (Miller and Raison, 2016;Pfau et al., 2018). It has been estimated that ~1/3 of MDD patients have increased levels of circulating pro-inflammatory biomarkers, even in the absence of other coexisting inflammatory pathology (Krishnadas and Cavanagh, 2012;Raison and Miller, 2011) and that patients suffering from underlying inflammatory conditions such as autoimmune disorders tend to develop depressive symptoms more often than general population or healthy controls (Benros et al., 2013). This linkage is supported by a recent meta-analysis study that found a number of inflammatory markers are increased in depressed subjects compared to controls, suggestive of a proinflammatory state (Osimo et al., 2020). Moreover, this relationship has also been shown in animal models, where altered immune signaling has been linked to stress susceptibility (Tsyglakova et al., 2019). For example, interleukin 6 (IL-6) levels are chronically increased in mice that are susceptible to chronic social defeat stress (CSDS) and reducing peripheral IL-6 promotes stress resilience (Hodes et al., 2014). CSDS, a stress paradigm that produces persistent behavioral changes sensitive to antidepressant treatment (Berton et al., 2006), has also been shown to induce changes in inflammatory signaling in the brain (Zhu et al., 2019). CSDS is known to increase the activity of dopamine (DA) neurons in the ventral tegmental area (VTA) (Krishnan et al., 2007), and changes in VTA DA neuronal activity are both necessary and sufficient for stress-induced behavioral changes in experimental mice (Chaudhury et al., 2013). Importantly, a variety of stressors including chronic mild stress (Rincon-Cortes and Grace, 2017;Tye et al., 2013), cold stress (Valenti et al., 2012), restraint stress (Anstrom and Woodward, 2005), and episodic social stress (Anstrom et al., 2009) alter VTA DA neuronal activity and contribute to behavioral changes (reviewed in (Douma and de Kloet, 2020)) suggesting a general role for VTA DA neurons in stress responses. Moreover, there is evidence for crosstalk between pro-inflammatory signaling and brain circuits involved in motivated behavior. For example, pain-induced neuroinflammation in the VTA has been linked to decreased DA output in the nucleus accumbens and DA-dependent reward behavior (Taylor et al., 2015). However, it is unclear whether preclinical animal models of stress, such as CSDS, induce inflammatory processes in the VTA.

Here, we examined markers of inflammation (interleukin 1 beta, IL-1β; tumor necrosis factor alpha, TNFα; interleukin 6, IL-6) in the VTA in three commonly used mouse stress models, physical and vicarious CSDS and subchronic variable stress (SCVS). We found that stress-induced changes in VTA proinflammatory cytokine marker expression varied depending on the stress paradigm and the time after the last stress. Notably, we found that VTA IL-1β levels are increased following physical CSDS, while TNFα levels are decreased 1 day, but not 5 days, following SCVS. Together, our data suggest that repeated stress exposure can induce changes in proinflammatory marker expression in the VTA, however, changes are not universal but are stressor-dependent.

Experimental Procedures

Animals

Adult male and female C57BL/6J mice (8–9 weeks old, Jackson Laboratory) and retired CD-1 breeders (Charles River) were used. Mice were allowed >7 days to habituate to the animal facility prior to the start of experiments. Animals were housed at 22–25°C on a 12-hour light-dark cycle with food and water available ad libitum. All experiments were approved by Michigan State University Institutional Animal Care and Use Committee (IACUC) and carried out in accordance with the guidelines from the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

Chronic Social Defeat Stress (CSDS)

Physical (Golden et al., 2011) or vicarious (Sial et al., 2016) CSDS was performed as previously described (Cooper et al., 2017). Briefly, male C57BL/6J mice were subjected to either a brief (5–10 min) daily physical encounter in the home-cage of a territorial CD-1 retired breeder pre-screened for aggressive behavior (physical CSDS) or placed on the opposite side of the Plexiglass partition during the physical encounter allowing the animal to witness this encounter (vicarious CSDS). Encounters were followed by sensory contact with the aggressor CD-1 (physical) or a novel CD-1 (vicarious) for the next 24 hours utilizing a perforated Plexiglass partition. Non-stress controls were handled daily and housed with a novel C57BL/6J separated by a perforated Plexiglass divider. Following the 10th defeat episode, mice were singly housed.

Social Interaction (SI) Test

SI testing was performed as previously described (Cooper, et al., 2017). Animals were placed in a 42 × 42 cm arena with a mesh cylinder at one end and locomotor activity was quantified using video tracking software (TopScan, CleverSys). Experimental animals were allowed 2.5 minutes to explore and habituate to the arena (target absent). Next, a novel target mouse (CD-1) was placed into the mesh cage and the experimental animal was allowed to freely move around the arena for another 2.5 minutes (target present). Time spent within an 8 cm radius of the mesh cylinder (the interaction zone) was recorded for both sessions. SI ratio was calculated as the time spent in the interaction zone with the target animal present divided by the time spent in the interaction zone with the target absent.

Subchronic Variable Stress (SCVS)

SCVS was performed according to previously published protocols (Williams et al., 2020). Briefly, group housed male and female mice were exposed to one stressor every day for six consecutive days during the light phase under white light. Stressors were administered in the following order: 1) group foot shock (5 mice) of 100 random foot shocks at 0.45 mA over one hour, 2) one-hour tail suspension, and 3) one-hour restraint stress; the sequence was then repeated for a total of six days of stress exposure. Mice were singly housed following SCVS during sucrose preference testing.

Sucrose Preference

A two-bottle choice test was performed in the home-cage where mice had ad libitum access to both bottles (Williams, et al., 2020). The first day both bottles contained water, which allowed animals to habituate to the bottles. On the following day, one bottle was replaced with a 1% sucrose solution. Mice were then allowed to drink freely from the bottles over two days. Each day, bottles were weighed, intake was recorded, and bottle position was alternated.

Real-time PCR (RT-PCR)

RNA purification from VTA samples was completed as previously described (Cooper, et al., 2017). Briefly, animals were euthanized 1, 2, or 5 days following the last stress. VTA was microdissected (14-gauge midline punch) and RNA was isolated via Trizol extraction and MicroRNeasy kit (Qiagen) following the manufacturer’s instructions. Purified RNA was then reverse-transcribed into cDNA following the manufacturer’s guidelines (Applied Biosystems). Candidate transcript levels were assessed by RT-PCR (CFX connect, BioRad) using SYBR green and specific primers (primers are listed 5’−3’; GAPDH: Forward-AGGTCGGTGTGAACGGATTTG, Reverse- TGTAGACCATGTAGTTGAGGTCA; IL-1β: F-GCACTACAGGCTCCGAGATGAAC, R- TTGTCGTTGCTTGGTTCTCCTTGT; TNF-α: F-GGAACTGGCAGAAGAGGCACTC, R- GCAGGAATGAGAAGAGGCTGAGAC; IL-6: F-TCACAGAGGATACCACTCCCA, R- GCAAGTGCATCATCGTTGTTC; GFAP: F-GGGCGAAGAAAACCGCATC, R- TTAATGACCTCACCATCCCGC; IL-10: F-GCTGCCTGCTCTTACTGACT, R- CTGGGAAGTGGGTGCAGTTA). IL-10 expression was not reliably detected in VTA samples, so this marker was not included in the final analyses. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as a normalization control using the ΔΔCt method. All reactions were performed in triplicate.

Immunohistochemistry

One-hour following SI testing, mice underwent transcardial perfusion with 4% PBS-buffered paraformaldehyde under chloral hydrate anesthesia and brains were removed, post-fixed in 4% paraformaldehyde for 24 hours, then cryo-preserved in 30% sucrose-PBS (Cooper, et al., 2017). Brains were sectioned (35 μm) on a freezing microtome and sections containing VTA were used for immunohistochemistry following published procedures (Simmons et al., 2019). Briefly, sections were blocked in PBS-T (0.3% Triton X-100) with 3% (wt/vol) normal donkey serum (NDS; Jackson Immunoresearch, catalog 017-000-121). Sections were incubated overnight at room temperature in primary antibody solutions: anti-tyrosine hydroxylase (TH, Sigma, T1299, mouse monoclonal,1:5000) to label DA neurons and define VTA boundaries and either anti-ionized calcium binding adapter molecule 1 (Iba1, Wako, 019–19741, rabbit polyclonal 1:1000) to label microglia or anti-glial fibrillary acidic protein (GFAP, Abcam, ab7260, rabbit polyclonal, 1:2000) to label astrocytes. Following washes, sections were incubated with fluorescently-labeled secondary antibodies (Alexafluor 488-anti-mouse and Cy3-conjugated anti-rabbit, 1:500; Jackson ImmunoResearch) and sections were mounted, dehydrated, and cover slipped. Images were captured using 10X objective on a Nikon Eclipse Ni-U Microscope with NIS Elements Acquisition and Analysis Software. For all immunohistochemistry experiments, samples were coded, measurements were only taken within VTA boundaries using TH signal (dotted line example in Figure 2A), and data collection and analysis were conducted by separate investigators. The right and left hemispheres of one VTA section (schematic illustration, Figure 3A) were imaged for analysis. Average Iba1 and Gfap intensity was assessed using ImageJ software. Iba1- and Gfap-positive cells were counted by blinded observer and divided by total area of analysis (mm2), data were then normalized to non-stress controls. For Iba1 morphology analysis, confocal z-stack images of VTA (one in each hemisphere, as shown in Figure 3) were taken using Olympus Fluoview FV1000 (version 4.2) and a digital color camera (Olympus DP72) with a 40x objective (Michigan State University Center for Advanced Microscopy). Images were then stacked using FIJI (imageJ.net/Fiji) software and a maximum intensity projection of the Iba1 positive channel was generated for further analysis. Iba1 morphology was quantified following published protocols using Image J (Young and Morrison, 2018). Briefly, the default setting FFT bandpass filter was applied to remove noise. Images were then converted to grayscale followed by application of the unsharp mask to increase the contrast and noise despeckling to eliminate single-pixel background fluorescence. The resulting images were converted to a binary image followed by additional noise despeckling and removal of outliers before being skeletonized (Figure 3B). Processes not in contact with somas were removed manually using the overlay with the original maximum intensity image. The AnalyzeSkeleton plugin (imagej.net/AnalyzeSkeleton) was applied to all skeletonized images and the number of endpoints and process length were recorded for each cell. Individual cell data were averaged for each mouse, with a total of 16–29 cells analyzed per mouse and 4–7 mice analyzed per treatment condition.

Figure 2. VTA microglial activity, as measured by Iba1 expression, is not altered following physical or vicarious CSDS.

Figure 2.

Open in a new tab

A. Representative images of ionized calcium binding adaptor molecule 1 (Iba1, red) and tyrosine hydroxylase (TH, green) labeling in the VTA of control and vicarious and physical CSDS stress mice. TH signal was used to define VTA boundaries (dotted line). B. The number of Iba1-positive cells in the VTA is not altered 1 day after CSDS, n=9–11 mice/group. C. Intensity of Iba1 labeling in the VTA is not altered following CSDS, n=9–11 mice/group. D. No correlation was observed between the number of Iba1-positive cells in the VTA and social interaction (SI) score, n=29 mice.

Fig. 3. Microglia morphology is not altered following physical or vicarious CSDS.

Fig. 3.

Open in a new tab

(A) Schematic illustration of a brain section containing VTA (highlighted in pink) and representative images of ionized calcium binding adaptor molecule 1 (Iba1, red) and tyrosine hydroxylase (TH, green) labeling in the VTA. (B) Magnified (40×) representative image of Iba1 staining (depicted by the boxed area from panel A) used for skeleton analysis of microglia morphology, corresponding skeleton analysis of Iba1-positive cells, and overlay of Iba1 staining and skeleton analysis. The average number of microglia endpoints per cell (C) and summed microglial branch length (D) per cell were not altered (E). following CSDS, n = 4–7 mice/group, 16–29 cells quantified/mouse.

Statistical Analyses

Data are represented as mean ± standard error of the mean (SEM). Statistical analyses were completed using GraphPad Prism 8 software. One-way analysis of variance (ANOVA) was used analyze differences between CSDS treatment groups followed by post-hoc Tukey testing, when appropriate. Two-way ANOVA was used to analyze effects of sex and stress in SCVS experiments, followed by a post-hoc Sidak’s test, when appropriate. A Pearson r test was used for correlation analysis. Statistical significance was defined as p < 0.05.

Results

Chronic physical stress increases IL-1β expression in the VTA

Following established CSDS procedures (Golden, et al., 2011;Sial, et al., 2016), male mice were subjected to either physical or vicarious stress (PS or VS) for 10 days (Figure 1B). Social interaction was assessed one day following the last episode of stress. Both VS and PS groups demonstrated a significant decrease in social interaction (SI) ratio compared to control mice (Figure 1A, one-way ANOVA, F(2,68)=22.48, p=3.2×10−8, post-hoc Tukey’s test, VS-CON: p=0.044 and PS-CON: p=2.1×10−8).

Figure 1. Chronic physical social defeat stress increases IL-1β gene expression in the VTA.

Figure 1.

Open in a new tab

A. Mice that experience vicarious or physical stress exhibit social avoidance compared to non-stress controls in social interaction (SI) testing, n=23–24 mice/group, *p<0.05, ***p<0.0001 compared to non-stress controls. B. Physical (PS) and vicarious (VS) chronic social defeat stress experimental paradigm. C. Interleukin 1 beta (IL-1β) mRNA is significantly increased in the VTA of PS mice compared to VS (##p<0.01) and control mice (**p<0.01), n=12 mice/group. D. VTA expression of tumor necrosis factor alpha (TNFα) is not significantly altered following CSDS, n=11–12 mice/group. E. VTA expression of interleukin-6 (IL-6) is not significantly altered following CSDS, n=11–12 mice/group. F. IL-1β gene expression in VTA is negatively correlated with SI score, n=36 mice. G. There is a modest positive correlation between TNFα gene expression in the VTA and SI score, n=34 mice. H. There is no correlation between VTA IL-6 expression and SI score, n=35 mice.

To determine whether exposure to PS or VS increased inflammatory signaling in the VTA, we assessed expression of three major pro-inflammatory cytokines, IL-1β, TNFα, and IL-6. Expression of IL-1β mRNA was significantly increased by PS (Figure 1C, F(2,33)=9.61, one-way ANOVA, p=0.0005, post-hoc Tukey’s test, PS-CON: p=0.002), but this effect was not observed in VS mice (post-hoc Tukey’s test, VS-CON: p=0.99). In contrast, we did not observe any significant effect of either PS or VS on TNFα (Figure 1D, one-way ANOVA, F(2,31)=2.37, p=0.11) or IL-6 mRNA expression (Figure 1E, F(2,32)=0.55, p=0.58). Moreover, we observed a significant negative correlation between SI ratio and VTA IL-1β mRNA levels (Figure 1F, r=−0.37, p=0.03) and, interestingly, a significant positive correlation between SI ratio and TNFα expression (Figure 1G, r=0.34, p=0.048). No correlation between IL-6 expression and SI ratio was observed (Figure 1H, r=0.06, p=0.72).

Taken together, our findings show that PS increases expression of IL-1β in the VTA and that increased IL-1β expression is correlated with increased social avoidance. However, we did not detect significant CSDS-induced changes in TNFα and IL-6 expression in the VTA. There was a trend for decreased TNFα expression in the VTA of stressed mice (p=0.11), and this contributed to a significant positive correlation between social interaction score and TNFα expression.

CSDS does not alter markers of microglial and astrocyte activity in the VTA

Given the link between IL-1β expression and microglial phenotype and activation (Monif et al., 2016), we next investigated whether CSDS altered glial cell activity in the VTA. We used immunohistochemistry for ionized calcium-binding adapter protein 1 (Iba1) to analyze microglia-specific signal in the VTA (Figure 2A). We did not observe any significant differences in the number of Iba1-positive cells in the VTA of CSDS mice compared to non-stress controls (Figure 2B, one-way ANOVA, F(2,26)=3.0, p=0.07), although mean Iba1 staining tended to be higher in VS mice. We also examined Iba1 signal intensity and similarly found that CSDS did not induce significant changes (Figure 2C, one-way ANOVA, F(2,26)=2.0, p=0.15). Lastly, we did not observe any correlation between the number of VTA Iba1-positive cells and SI ratio (Figure 2D, r=0.09, p=0.65). To assess whether there were changes in microglial morphology consistent with activation (Morrison et al., 2017;Morrison and Filosa, 2013;Siemsen et al., 2020), we performed confocal microscopy and skeleton analysis on Iba1-labeled cells in the VTA (Figure 3A, B). We did not observe any significant differences in either the number of microglia endpoints per cell (Figure 3C, one-way ANOVA, F(2,13)=0.48, p=0.63) or the summed branch length per cell (Figure 3D, one-way ANOVA, F(2,13)=2.0, p=0.17) between treatment groups.

Increased IL-1β levels have also been linked to astrocyte activation, so we next assessed glial fibrillary acidic protein (Gfap) immunoreactivity (Figure 4A). No differences were observed in the number of Gfap-positive cells (Figure 4B, one-way ANOVA, F(2,19)=2.28, p=0.13) or Gfap signal intensity (Figure 4C, one-way ANOVA, F(2,19)=5.2, p=0.02, post-hoc Tukey’s test, PS-CON: p=0.3, VS-CON: p=0.1) in the VTA of VS or PS mice compared to non-stress controls. However, there was a significant increase in Gfap signal intensity in VS mice compared to PS mice (post-hoc Tukey’s test, PS-VS: p=0.01). There was no correlation between the number of Gfap-positive cells and SI ratio (Figure 4D, r=0.26, p=0.25). Consistent with the immunohistochemistry results, CSDS did not alter GFAP mRNA expression (Figure 4E, one-way ANOVA, F(2,33)=0.25, p=0.78). There was no correlation between GFAP mRNA and SI score (Figure 4F, r=−0.24, p=0.16). In summary, neither PS nor VS significantly altered cellular markers of microglial or astrocyte activation in the VTA.

Figure 4. VTA astrocyte activity, as measured by Gfap expression, is not altered following physical or vicarious CSDS.

Figure 4.

Open in a new tab

A. Representative images of glial fibrillary acidic protein (Gfap, red) and tyrosine hydroxylase (TH, green) labeling in the VTA of control and vicarious and physical CSDS stress mice. TH signal was used to define VTA boundaries. B. The number of Gfap-positive cells in the VTA is not altered 1 day after CSDS, n=7–8 mice/group. C. Intensity of Gfap labeling in the VTA is altered following CSDS as vicarious CSDS mice have increased labeling compared to physical CSDS mice, n=7–8 mice/group, #p<0.05. D. No correlation was observed between the number of Gfap-positive cells in the VTA and social interaction (SI) score, n=22 mice. E. GFAP gene expression is not altered in the VTA following vicarious or physical CSDS, n=11–14 mice/group. F. No correlation was observed between GFAP expression and social interaction (SI) score, n=36 mice.

Subchronic variable stress (SCVS) does not alter VTA IL-1β expression

Given the observed increase in VTA IL-1β expression in male PS mice, we next sought to determine the effect of chronic stress on proinflammatory cytokine expression in the VTA of female mice. We used subchronic variable stress (SCVS, Figure 5A), a model known to induce behavioral changes in female but not male mice (Hodes et al., 2015;Johnson et al., 2020;Williams, et al., 2020) and examined the same three major pro-inflammatory cytokines: IL-1β, TNFα and IL-6. There was a trend for decreased sucrose preference in female mice exposed to SCVS, as expected (Figure 5B), however this difference was not statistically significant (two-way ANOVA, sex: F(1,26)=0.49, p=0.49, stress: F(1,26)=2.00, p=0.17, interaction: F(1,26)=3.43, p=0.08). To determine whether exposure to SCVS increased inflammatory signaling in the VTA, we assessed expression of IL-1β, TNFα, and IL-6 following sucrose preference testing (5 days after the last stressor). In contrast to CSDS, IL-1β expression in VTA was not significantly changed by SCVS (Figure 5C, two-way ANOVA, sex: F(1,22)=0.10, p=0.76, stress: F(1,22)=0.08, p=0.77, interaction F(1,22)=3.94, p=0.06). There were also no differences observed in VTA TNFα (Figure 5D, two-way ANOVA, sex: F(1,22)=0.16, p=0.70, stress: F(1,22)=0.19, p=0.67, interaction: F(1,22)=2.12, p=0.16) or IL-6 expression (Figure 5E, two-way ANOVA, sex: F(1,22)=1.70, p=0.21, stress: F(1,22)=0.14, p=0.71, interaction: F(1,22)=0.0002, p=0.99).

Figure 5. Subchronic variable stress (SCVS) decreases TNFα gene expression in the VTA.

Figure 5.

Open in a new tab

A. Subchronic variable stress (SCVS) experimental paradigm and timeline. Samples were collected 5 days (C-E, dark pink and blue) or 1 day (F-H, light pink and blue) after the last stress. B. Sucrose preference was not significantly altered in male or female mice following SCVS, although there was a trend for a decrease in SCVS females (p=0.08), n=6–8 mice/group. C. Interleukin 1 beta (IL-1β) mRNA is not altered in male or female mice 5 days after SCVS, n=6–7 mice/group. D. VTA expression of tumor necrosis factor alpha (TNFα) is not altered in male or female mice 5 days after SCVS, n=6–7 mice/group. E. VTA expression of interleukin-6 (IL-6) is not significantly changed in male or female mice 5 days after SCVS, n=6–7 mice/group. F. IL-1β expression in VTA is not altered 1 day after SCVS, n=7–8 mice/group. G. TNFα gene expression in the VTA is significantly decreased in both male and female mice 1 day after SCVS compared to same sex controls (*p<0.05, **p<0.01), n=7–9 mice/group. H. VTA IL-6 expression is not altered 1 day after SCVS, n=7–8 mice/group.

To determine whether the lack of effect on inflammatory markers was due to the extended time between the last stress exposure and tissue collection (5 days for SCVS vs. 2 days for CSDS), we repeated the experiment and collected samples 1 day following SCVS. No sex or stress differences in VTA IL-1β expression were observed (Figure 5F, two-way ANOVA, sex: F(1,27)=0.36, p=0.55, stress: F(1,27)=2.06, p=0.16, interaction: F(1,27)=1.21, p=0.28). However, we observed differences in VTA TNFα expression (Figure 5G), as there was a significant effect of both stress and sex (two-way ANOVA, stress: (F(1,27)=17.80, p=0.0002), sex: (F(1,27)=5.29, p=0.03), interaction: F(1,27)=0.02, p=0.88). Specifically, TNFα expression was decreased in both male and female SCVS mice compared to their same sex controls (Figure 5G, post-hoc Sidak’s test, males: p=0.017, females p=0.008). No effects on VTA IL-6 expression were observed following SCVS (Figure 5H, two-way ANOVA, sex: F(1,27)=1.40, p=0.25), stress: F(1,27)=0.33, p=0.57, interaction: F(1,27)=2.30, p=0.14). Overall, these data indicate SDS and SCVS induce distinct proinflammatory signaling changes in the VTA.

Discussion

Here we report that IL-1β expression is upregulated in the VTA of animals that experienced physical, but not vicarious, CSDS. These results are consistent with reports that have linked stress-induced behavioral changes to increased IL-1β expression and activity in the brain. For example, chronic mild stress (CMS) increases hippocampal IL-1β protein levels in male mice (Goshen et al., 2008). Moreover, IL-1β infusion was sufficient to decrease sucrose preference and hippocampal neurogenesis while knockout of the IL-1 receptor prevented CMS-induced changes in behavior and neurogenesis (Goshen, et al., 2008). Interestingly, in this same study, CMS did not alter hippocampal IL-6 levels (Goshen, et al., 2008). Similarly, we observed no changes in IL-6 in the VTA of CSDS mice. However, elevated IL-6 levels have been linked to CSDS-induced behavioral changes (Hodes, et al., 2014). Plasma IL-6 levels remain increased 30 days following physical or vicarious CSDS and transplantation of bone marrow hematopoietic progenitor cells isolated from mice susceptible to CSDS was sufficient to promote sensitivity to physical and vicarious CSDS (Hodes, et al., 2014). These data, along with studies that systemically injected a neutralizing IL-6 antibody, support the hypothesis that increased peripheral IL-6 promotes sensitivity to CSDS. However, these data do not negate a potential role for IL-6 in the brain, as a variety of stressors increase central IL-6 mRNA or protein expression (Hodes et al., 2016), and while local IL-6 production in VTA is not evident, this does not discount that IL-6 produced elsewhere in the brain could be released in VTA to contribute to behavioral effects. It may also be that changes in peripheral IL-6 are sufficient to alter mesolimbic DA circuitry. For example, systemic injection of IL-6, but not IL-1, decreased DA levels in the nucleus accumbens (Song et al., 1999). Together, these examples support our finding of differential regulation of VTA IL-1β vs. IL-6 expression in response to CSDS.

We also observed a significant negative correlation between VTA IL-1β expression and SI ratio; mice with high IL-1β levels exhibited more social avoidance. Interestingly, a similar negative correlation is observed between hippocampal caspase-1 mRNA and SI ratio following physical CSDS (Li et al., 2018). Caspase-1 is critical enzyme for production of mature IL-1β and its expression is increased in the hippocampus following CSDS (Li, et al., 2018). Increasing caspase-1 in the hippocampus increased IL-1β levels and decreased sucrose preference and social interaction, while knockout of caspase-1 prevented CSDS-induced increases in hippocampal IL-1β and behavioral changes (Li, et al., 2018), linking caspase-1 regulation of IL-1β to stress-associated behavioral changes. Critically, while that work functionally connected changes in hippocampal IL-1β signaling with CSDS-induced behavioral changes, it will be necessary to perform additional studies to determine whether VTA IL-1β signaling similarly contributes to CSDS-induced behavioral changes as both indirect, via glia, and direct modulation of neuronal function by IL-1β have been reported. While the indirect route mediated by altered glial function is most characterized, direct roles for IL-1β on neuronal function have been noted, such as in sensory neurons where functional coupling between IL-1β and NMDA receptors leads to altered glutamate release in a rat model of neuropathic pain (Yan and Weng, 2013).

In contrast to our findings with CSDS, SCVS did not alter VTA IL-1β expression in either male or female mice. There are notable differences between these paradigms, including that SCVS produces behavioral changes, such as decreased sucrose preference, in female, but not male, mice (Hodes, et al., 2015;Johnson, et al., 2020;Williams, et al., 2020). One possibility is that while SCVS is sufficient to alter behavior of female mice, a more robust stress exposure may be required to produce VTA IL-1β changes. This idea is supported by our differential findings between physical and vicarious CSDS in male mice. Vicarious stress is sufficient to induce social avoidance, but not VTA IL-1β expression, while physical stress produces a more robust social avoidance phenotype and induces VTA IL-1β expression. This is consistent with reports that physical and vicarious CSDS produce overlapping, but not identical, phenotypes (Warren et al., 2020). Another possibility is that physical CSDS and SCVS differentially impact the function of the mesocorticolimbic reward circuitry. While optogenetic studies have shown that the activity VTA DA neurons contributes to both CSDS- and CMS-induced behavioral changes (Chaudhury, et al., 2013;Tye, et al., 2013), a similar role for VTA DA activity has yet to be defined for SCVS or vicarious CSDS. Finally, we observed a decrease in TNFα expression in the VTA of male and female mice following SCVS that was not observed following CSDS, although we did observe a modest positive correlation between TNFα expression and SI ratio that is consistent with SCVS results. The decrease in TNFα expression is counter to the expectation of a stress-induced inflammatory state. However, a decrease in TNFα mRNA expression does not necessarily predict a decrease in TNFα protein expression. As with many other genes, cytokine gene and protein expression can be independently regulated, resulting in changes in one without a corresponding change in the other as well as feedback mechanisms which may lead to mRNA decay or decreased translation (Anderson, 2008). Thus, future studies should investigate whether stress-induced changes in mRNA expression are mirrored by changes in protein expression.

Despite increased IL-1β in VTA of PS mice, we did not find evidence of microglial or astrocyte activation in the VTA by CSDS. We used Iba1 and GFAP immunoreactivity to assess VTA microglia and astrocyte cell number, respectively. We did not observe any changes in regional signal intensity or cell numbers 24 hours after the last stress in PS mice compared to non-stressed controls. We also did not observe changes in the morphology of Iba1-labeled cells consistent with activation (i.e., ramified to deramified, as measured by branch length and number of endpoints). These results are in contrast to a recent report that found Iba1 immunoreactivity was increased in the VTA, but not nucleus accumbens, after 15 days of chronic social stress (Bergamini et al., 2018). It is possible that our measurements were not sensitive enough to detect modest changes in microglia activation and additional markers (such as CD-68) would reveal evidence of activation (Jurga et al., 2020). Tanaka et al. also did not detect any change in the number of Iba1-positive cells in the VTA following physical CSDS, but reported an increase in the ramification and signal intensity of individual microglia in the VTA CSDS mice (Tanaka et al., 2012). Regional differences in microglial activation have also been found in rat models of social defeat stress. Notably, a recent study observed an increased number of Iba1-positive cells in the basolateral amygdala, but not hippocampus, of socially defeated rats despite increased IL-1β mRNA expression in both regions following stress (Ferle et al., 2020). These data support our observation that changes in brain IL-1β expression can occur independently of microglial activation. Additionally, conducting Iba1 analysis at a later timepoint in future studies may be informative, as sequential response to LPS occurs in which peak microglial cytokine expression is induced within 2–4 hours of administration, while expression in astrocytes peaks at 12–24 hours, but increased Iba1 staining in the hippocampus is not evident until 24–48 hours after LPS (Norden et al., 2016). While microglia and astrocytes have both the ability and strategic location to modulate inflammatory response and affect local circuitry (Ikegami et al., 2019;Khakh and Sofroniew, 2015), it is also possible that the source of IL-1β mRNA in the VTA may be a different cell type, such as peripheral monocytes. This has been shown in a model of repeated social defeat stress, as microglia-dependent recruitment of bone marrow-derived IL-1β-producing monocytes from the periphery into the prelimbic cortex was linked to anxiety-like behavior (McKim et al., 2018). Thus, while there is clearly induction of IL-1β in the VTA following physical CSDS, further studies are necessary to determine the cell type of origin.

In conclusion, IL-1β is a pro-inflammatory cytokine that plays an important role in both normal immune response as well as chronic inflammatory diseases (Kaneko et al., 2019). In our study, physical CSDS increases IL-1β mRNA expression in the VTA, without evidence of pronounced microglial or astrocyte activation. This effect was not observed in male mice that experienced vicarious CSDS, or in male or female mice exposed to SCVS, suggesting a more robust stressor may be necessary for VTA IL-1β induction. Future studies should determine whether the source of IL-1β is resident VTA glial cells, or a different cell type, such as recruited peripheral monocytes or T cells. Given that VTA IL-1β expression was correlated with social interaction, it will also be important to manipulate IL-1β expression to determine whether VTA IL-1β signaling contributes to stress-induced behavioral changes. Finally, although changes in pro-inflammatory signaling have been implicated in a variety of animal stress protocols, our data and those of others support that such changes are not universal. Thus, it will be critical to take into account the type of stress, time-course, brain region, and inflammatory marker to better identify common mediators critical for stress-induced pathology. Our studies in particular point toward a role for elevated VTA IL-1β in physical chronic social defeat stress, a prominent preclinical model used to study depressive-like behavior.

Highlights.

  • Physical, but not vicarious, social defeat stress increases IL-1β mRNA in the VTA

  • Physical social defeat stress does not alter the number of Iba1- or Gfap-positive cells in the VTA

  • Subchronic variable stress does not alter IL-1β mRNA in VTA of male or female mice

Acknowledgments

We would like to acknowledge the excellent technical support provided by Kenneth Moon. Figure schematics were created with BioRender.com. These studies were supported by the NIH grants DA039895 (MMR) and MH111604 (AJR) and training fellowships DA042502 (SCS), NS090989 (MR and SAR), and NS044928 (MAD).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declarations of interest: None

Literature Cited

  1. Anderson P (2008), Post-transcriptional control of cytokine production. Nat Immunol 9:353–359. [DOI] [PubMed] [Google Scholar]
  2. Anstrom KK, Miczek KA, Budygin EA (2009), Increased phasic dopamine signaling in the mesolimbic pathway during social defeat in rats. Neuroscience 161:3–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anstrom KK, Woodward DJ (2005), Restraint increases dopaminergic burst firing in awake rats. Neuropsychopharmacology 30:1832–1840. [DOI] [PubMed] [Google Scholar]
  4. Benros ME, Waltoft BL, Nordentoft M, Ostergaard SD, Eaton WW, Krogh J, Mortensen PB (2013), Autoimmune diseases and severe infections as risk factors for mood disorders: a nationwide study. JAMA Psychiatry 70:812–820. [DOI] [PubMed] [Google Scholar]
  5. Bergamini G, Mechtersheimer J, Azzinnari D, Sigrist H, Buerge M, Dallmann R, Freije R, Kouraki A, et al. (2018), Chronic social stress induces peripheral and central immune activation, blunted mesolimbic dopamine function, and reduced reward-directed behaviour in mice. Neurobiol Stress 8:42–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berton O, McClung CA, Dileone RJ, Krishnan V, Renthal W, Russo SJ, Graham D, Tsankova NM, et al. (2006), Essential role of BDNF in the mesolimbic dopamine pathway in social defeat stress. Science 311:864–868. [DOI] [PubMed] [Google Scholar]
  7. Chaudhury D, Walsh JJ, Friedman AK, Juarez B, Ku SM, Koo JW, Ferguson D, Tsai HC, et al. (2013), Rapid regulation of depression-related behaviours by control of midbrain dopamine neurons. Nature 493:532–536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cooper SE, Kechner M, Caraballo-Perez D, Kaska S, Robison AJ, Mazei-Robison MS (2017), Comparison of chronic physical and emotional social defeat stress effects on mesocorticolimbic circuit activation and voluntary consumption of morphine. Sci Rep 7:8445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Douma EH, de Kloet ER (2020), Stress-induced plasticity and functioning of ventral tegmental dopamine neurons. Neurosci Biobehav Rev 108:48–77. [DOI] [PubMed] [Google Scholar]
  10. Ferle V, Repouskou A, Aspiotis G, Raftogianni A, Chrousos G, Stylianopoulou F, Stamatakis A (2020), Synergistic effects of early life mild adversity and chronic social defeat on rat brain microglia and cytokines. Physiol Behav 215:112791. [DOI] [PubMed] [Google Scholar]
  11. Global Burden of Disease Collaborators GDaIIaPC (2018), Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 392:1789–1858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Golden SA, Covington HE, Berton O, Russo SJ (2011), A standardized protocol for repeated social defeat stress in mice. Nat Protoc 6:1183–1191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Goshen I, Kreisel T, Ben-Menachem-Zidon O, Licht T, Weidenfeld J, Ben-Hur T, Yirmiya R (2008), Brain interleukin-1 mediates chronic stress-induced depression in mice via adrenocortical activation and hippocampal neurogenesis suppression. Mol Psychiatry 13:717–728. [DOI] [PubMed] [Google Scholar]
  14. Hodes GE, Menard C, Russo SJ (2016), Integrating Interleukin-6 into depression diagnosis and treatment. Neurobiol Stress 4:15–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hodes GE, Pfau ML, Leboeuf M, Golden SA, Christoffel DJ, Bregman D, Rebusi N, Heshmati M, et al. (2014), Individual differences in the peripheral immune system promote resilience versus susceptibility to social stress. Proc Natl Acad Sci U S A 111:16136–16141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hodes GE, Pfau ML, Purushothaman I, Ahn HF, Golden SA, Christoffel DJ, Magida J, Brancato A, et al. (2015), Sex Differences in Nucleus Accumbens Transcriptome Profiles Associated with Susceptibility versus Resilience to Subchronic Variable Stress. J Neurosci 35:16362–16376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ikegami A, Haruwaka K, Wake H (2019), Microglia: Lifelong modulator of neural circuits. Neuropathology 39:173–180. [DOI] [PubMed] [Google Scholar]
  18. Johnson A, Rainville JR, Rivero-Ballon GN, Dhimitri K, Hodes GE (2020), Testing the Limits of Sex Differences Using Variable Stress. Neuroscience. [DOI] [PubMed] [Google Scholar]
  19. Jurga AM, Paleczna M, Kuter KZ (2020), Overview of General and Discriminating Markers of Differential Microglia Phenotypes. Front Cell Neurosci 14:198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kaneko N, Kurata M, Yamamoto T, Morikawa S, Masumoto J (2019), The role of interleukin-1 in general pathology. Inflamm Regen 39:12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Khakh BS, Sofroniew MV (2015), Diversity of astrocyte functions and phenotypes in neural circuits. Nat Neurosci 18:942–952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Krishnadas R, Cavanagh J (2012), Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry 83:495–502. [DOI] [PubMed] [Google Scholar]
  23. Krishnan V, Han MH, Graham DL, Berton O, Renthal W, Russo SJ, Laplant Q, Graham A, et al. (2007), Molecular adaptations underlying susceptibility and resistance to social defeat in brain reward regions. Cell 131:391–404. [DOI] [PubMed] [Google Scholar]
  24. Li MX, Zheng HL, Luo Y, He JG, Wang W, Han J, Zhang L, Wang X, et al. (2018), Gene deficiency and pharmacological inhibition of caspase-1 confers resilience to chronic social defeat stress via regulating the stability of surface AMPARs. Mol Psychiatry 23:556–568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. McKim DB, Weber MD, Niraula A, Sawicki CM, Liu X, Jarrett BL, Ramirez-Chan K, Wang Y, et al. (2018), Microglial recruitment of IL-1beta-producing monocytes to brain endothelium causes stress-induced anxiety. Mol Psychiatry 23:1421–1431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Miller AH, Raison CL (2016), The role of inflammation in depression: from evolutionary imperative to modern treatment target. Nat Rev Immunol 16:22–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Monif M, Reid CA, Powell KL, Drummond KJ, O’Brien TJ, Williams DA (2016), Interleukin-1beta has trophic effects in microglia and its release is mediated by P2X7R pore. J Neuroinflammation 13:173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Morrison H, Young K, Qureshi M, Rowe RK, Lifshitz J (2017), Quantitative microglia analyses reveal diverse morphologic responses in the rat cortex after diffuse brain injury. Sci Rep 7:13211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Morrison HW, Filosa JA (2013), A quantitative spatiotemporal analysis of microglia morphology during ischemic stroke and reperfusion. J Neuroinflammation 10:4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Norden DM, Trojanowski PJ, Villanueva E, Navarro E, Godbout JP (2016), Sequential activation of microglia and astrocyte cytokine expression precedes increased Iba-1 or GFAP immunoreactivity following systemic immune challenge. Glia 64:300–316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Osimo EF, Pillinger T, Rodriguez IM, Khandaker GM, Pariante CM, Howes OD (2020), Inflammatory markers in depression: A meta-analysis of mean differences and variability in 5,166 patients and 5,083 controls. Brain Behav Immun 87:901–909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pfau ML, Menard C, Russo SJ (2018), Inflammatory Mediators in Mood Disorders: Therapeutic Opportunities. Annu Rev Pharmacol Toxicol 58:411–428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Raison CL, Miller AH (2011), Is depression an inflammatory disorder? Curr Psychiatry Rep 13:467–475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rincon-Cortes M, Grace AA (2017), Sex-Dependent Effects of Stress on Immobility Behavior and VTA Dopamine Neuron Activity: Modulation by Ketamine. Int J Neuropsychopharmacol 20:823–832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sial OK, Warren BL, Alcantara LF, Parise EM, Bolanos-Guzman CA (2016), Vicarious social defeat stress: Bridging the gap between physical and emotional stress. J Neurosci Methods 258:94–103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Siemsen BM, Landin JD, McFaddin JA, Hooker KN, Chandler LJ, Scofield MD (2020), Chronic intermittent ethanol and lipopolysaccharide exposure differentially alter Iba1-derived microglia morphology in the prelimbic cortex and nucleus accumbens core of male Long-Evans rats. J Neurosci Res. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Simmons SC, Wheeler K, Mazei-Robison MS (2019), Determination of circuit-specific morphological adaptations in ventral tegmental area dopamine neurons by chronic morphine. Mol Brain 12:10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Song C, Merali Z, Anisman H (1999), Variations of nucleus accumbens dopamine and serotonin following systemic interleukin-1, interleukin-2 or interleukin-6 treatment. Neuroscience 88:823–836. [DOI] [PubMed] [Google Scholar]
  39. Souery D, Papakostas GI, Trivedi MH (2006), Treatment-resistant depression. J Clin Psychiatry 67 Suppl 6:16–22. [PubMed] [Google Scholar]
  40. Tanaka K, Furuyashiki T, Kitaoka S, Senzai Y, Imoto Y, Segi-Nishida E, Deguchi Y, Breyer RM, et al. (2012), Prostaglandin E2-mediated attenuation of mesocortical dopaminergic pathway is critical for susceptibility to repeated social defeat stress in mice. J Neurosci 32:4319–4329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Taylor AM, Castonguay A, Taylor AJ, Murphy NP, Ghogha A, Cook C, Xue L, Olmstead MC, et al. (2015), Microglia disrupt mesolimbic reward circuitry in chronic pain. J Neurosci 35:8442–8450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tsyglakova M, McDaniel D, Hodes GE (2019), Immune mechanisms of stress susceptibility and resilience: Lessons from animal models. Front Neuroendocrinol 54:100771. [DOI] [PubMed] [Google Scholar]
  43. Tye KM, Mirzabekov JJ, Warden MR, Ferenczi EA, Tsai HC, Finkelstein J, Kim SY, Adhikari A, et al. (2013), Dopamine neurons modulate neural encoding and expression of depression-related behaviour. Nature 493:537–541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Valenti O, Gill KM, Grace AA (2012), Different stressors produce excitation or inhibition of mesolimbic dopamine neuron activity: response alteration by stress pre-exposure. Eur J Neurosci 35:1312–1321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Warren BL, Mazei-Robison MS, Robison AJ, Iniguez SD (2020), Can I Get a Witness? Using Vicarious Defeat Stress to Study Mood-Related Illnesses in Traditionally Understudied Populations. Biol Psychiatry. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Williams ES, Manning CE, Eagle AL, Swift-Gallant A, Duque-Wilckens N, Chinnusamy S, Moeser A, Jordan C, et al. (2020), Androgen-Dependent Excitability of Mouse Ventral Hippocampal Afferents to Nucleus Accumbens Underlies Sex-Specific Susceptibility to Stress. Biol Psychiatry 87:492–501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yan X, Weng HR (2013), Endogenous interleukin-1beta in neuropathic rats enhances glutamate release from the primary afferents in the spinal dorsal horn through coupling with presynaptic N-methyl-D-aspartic acid receptors. J Biol Chem 288:30544–30557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Young K, Morrison H (2018), Quantifying Microglia Morphology from Photomicrographs of Immunohistochemistry Prepared Tissue Using ImageJ. J Vis Exp. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhu Y, Klomparens EA, Guo S, Geng X (2019), Neuroinflammation caused by mental stress: the effect of chronic restraint stress and acute repeated social defeat stress in mice. Neurol Res 41:762–769. [DOI] [PubMed] [Google Scholar]

RESOURCES