Abstract
none
After our recent publication (Babenko et al. 2020), Dr. Cyrille A. D’Haese, of the Muséum national d’Histoire naturelle, Paris, France, called our attention to the errors contained in Table 1 (column: COI sequence number). We would like to take this opportunity to sincerely thank him and correct the following errors:
Table 1.
Species used for molecular study, primers, and GenBank accession numbers of the sequences.
| Species | Forward primer | Reverse primer | COI sequence number | Sequence size |
|---|---|---|---|---|
| Hypogastrura variata sp. nov. | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | MW518020 | 647 bp |
| MW518021 | ||||
| MW518022 | ||||
| Hypogastrura yosii Stach, 1964 | colfol-for: tttcaacaaatcataargayatygg | colfol-rev: taaacttcnggrtgnccaaaaaatca | MW507473 | 647 bp |
| MW507474 | ||||
| MW507475 | ||||
| Xenylla arnei sp. nov. | LCO1490_t1: tgtaaaacgacggccagtgg tcaacaaatcataaagatattgg | HCO2198_t1: caggaaacagctatgactaaacttc agggtgaccaaaaaatca | MW517749 | 658 bp |
| MW549335 | ||||
| MW549336 |
Other corrections:
Page 3, Additional material to Hypogastrura variata sp. nov., lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW518020– MW518022.
Page 8, Material to Hypogastrura yosii Stach, 1964, lines 3–4: Their partial COI genes were… deposited in the GenBank under the sample ID: MW507473– MW507475.
Page 13, Additional material to Xenylla arnei sp. nov., lines 2–4: Their partial COI genes were…deposited in the GenBank under the sample ID: MW517749, MW549335–MW549336.
Citation
Babenko A, Efeykin B, Bizin M (2021) Corrigenda: Three new and one little-known species of Hypogastruridae (Collembola) from Russia’s northeast. ZooKeys 1005: 1–20. https://doi.org/10.3897/zookeys.1005.54882. ZooKeys 1028: 161–162. https://doi.org/10.3897/zookeys.1028.65169
Reference
- Babenko A, Efeykin B, Bizin M. (2020) Three new and one little-known species of Hypogastruridae (Collembola) from Russia’s northeast. ZooKeys 1005: 1–20. 10.3897/zookeys.1005.54882 [DOI] [PMC free article] [PubMed] [Google Scholar]
