Abstract
Human embryonic stem cells are a type of pluripotent stem cells (hPSCs) that are used to investigate their differentiation into diverse mature cell types for molecular studies. The mechanisms underlying insulin receptor (IR)-mediated signaling in the maintenance of human pluripotent stem cell (hPSC) identity and cell fate specification are not fully understood. Here, we used two independent shRNAs to stably knock down IRs in two hPSC lines that represent pluripotent stem cells and explored the consequences on expression of key proteins in pathways linked to proliferation and differentiation. We consistently observed lowered pAKT in contrast to increased pERK1/2 and a concordant elevation in pluripotency gene expression. ERK2 chromatin immunoprecipitation, luciferase assays, and ERK1/2 inhibitors established direct causality between ERK1/2 and OCT4 expression. Of importance, RNA sequencing analyses indicated a dysregulation of genes involved in cell differentiation and organismal development. Mass spectrometry–based proteomic analyses further confirmed a global downregulation of extracellular matrix proteins. Subsequent differentiation toward the neural lineage reflected alterations in SOX1+PAX6+ neuroectoderm and FOXG1+ cortical neuron marker expression and protein localization. Collectively, our data underscore the role of IR-mediated signaling in maintaining pluripotency, the extracellular matrix necessary for the stem cell niche, and regulating cell fate specification including the neural lineage.
Keywords: human, insulin receptors, signaling, stem cells, differentiation, pluripotency, cell fate specification, neural lineage, AKT, ERK1/2
Abbreviations: ECM, extracellular matrix; hESC, human embryonic stem cell; hPSC, human pluripotent stem cell; IGF, insulin-like growth factor; IR, insulin receptor; KOSR, KnockOut Serum Replacement
Human embryonic stem cells (hESCs) are prototypical human pluripotent stem cells (hPSCs) widely used for studying pluripotency and differentiation (1). Pluripotency factors (2) as well as Activin/Nodal and fibroblast growth factor (FGF) signaling (3) define the characteristics of hPSCs. In recent years, the use of KnockOut Serum Replacement (KOSR) and defined media for culturing hPSCs such as StemPro, mTeSR1, and Essential 8 (E8) has shed light on the extracellular components necessary for maintaining human pluripotency and metabolic homeostasis.
These hPSC media that contain supraphysiological levels of insulin and insulin-like growth factors (IGFs) suggest a requirement for insulin and/or IGF-I receptors in regulating hPSCs (4). In general, insulin binds insulin receptor (IR) isoforms IR-A (-exon 11) or IR-B (+exon 11), IGF-II binds IR-A or IGF1R, and IGF-I binds IGF1R (5). Indeed, the IGF-I analog heregulin-1β supports hESC proliferation and self-renewal (6), whereas IGF-II alone is sufficient to maintain hESC cultures (7). Conversely, blockade of IGF1R decreases survival of hESCs (7) and promotes differentiation (6). Beyond pluripotency, the knockout of IR in the mouse brain has also been reported to lead to neuronal defects that contribute to neurological disorders (8). Although most studies to date have focused on IGF1R signaling in regulating human pluripotency, the precise role of IR in hPSCs and their differentiated progeny has received poor attention.
To directly address the significance of IR in pluripotency and hPSC identity, we used two independent shRNAs to stably knock down IR in two different hPSC lines and interrogated the consequences on insulin/IGF-I signaling pathways (9). Knock down of IR decreased basal pAKT and reciprocally increased pERK1/2 levels. Next, genome-wide RNA sequencing (RNA-Seq) and mass spectrometry (MS)-based proteomics analyses in shIR-hPSCs revealed an increased expression of numerous pluripotency genes (OCT4, SOX2, DPPA4, and LIN28). The compensatory increase in pERK1/2 could possibly account for the elevated pluripotency gene expression since ERK2 has been reported to bind proximal to the promoter of pluripotency genes (10). ERK2 chromatin immunoprecipitation, luciferase assays, and ERK1/2 inhibitors together establish direct causality between ERK1/2 and OCT4 expression. It is striking that RNA-Seq and proteomics analyses revealed a dysregulation of germ layer cell fate specification genes and an unexpected global downregulation of extracellular matrix (ECM) genes. When these shIR-hPSCs were differentiated toward the neural lineage, we observed aberrant neuroectoderm and cerebral organoid development. Together, these results demonstrate the importance of IR-mediated signaling in the maintenance of pluripotency, the ECM which contributes to the hPSC niche (11), and long-lasting effects on tissue and neural differentiation.
Results
Knock down of IR in hPSCs perturbs insulin/AKT/ERK1/2 signaling pathways
Consistent with previous reports (12, 13), we detected high levels of human insulin in Dulbecco's modified Eagle's medium (DMEM)/F-12/20% KOSR (∼1200 ± 175 nM) and mTeSR1 media (∼1407 ± 128 nM). Although the rationale for adding >100× physiological concentration of recombinant insulin/IGFs to hPSC media is unclear, one implication is that insulin/IGF signaling is important for the maintenance of hPSCs.
To directly investigate the role of IR signaling in mediating human pluripotency, we stably knocked down IR in two different hESC lines (CHB8 and H9). Among the four shRNA constructs (Sigma) we tested, the short hairpins that target the CACTGATTACTTGCTGCTCT sequence in exon 2 and GTGCTGTATGAAGTGAGTTA sequence in exon 13 of IR gene (INSR) resulted in a reproducible knockdown of IR transcript and protein expression. Of a total of 52 clones (35 for CHB8 and 17 for H9) that were screened both at the transcript and protein levels, we obtained two independent IR knocked down clones in CHB8 (shIR-CHB8) and three in H9 hESCs (shIR-H9). QPCR and Western blot analyses confirmed the knock down of IR in CHB8 (Fig. 1A and Fig. S1A) and H9 hESCs (Fig. 1B and Fig. S1B). Of interest, knock down of IR resulted in a concomitant decrease in IGF1R protein expression (Fig. 1, A and B).
Figure 1.
Knockdown of IR in CHB8 and H9 hESCs perturbs the insulin signaling pathway. Western blot analyses for IR, IGF1R, and ACTIN protein levels in shScr and shIR in two different hESCs: (A) CHB8 and (B) H9 hESCs. Western blot analyses for pAKT, tAKT, pERK1/2, and tERK1/2 protein levels in shScr- and shIR- (C) CHB8 and (D) H9 hESCs. pAKT, tAKT, pERK1/2, and tERK1/2 Western blot bands were quantitated and represented as a ratio to depict pAKT and pERK1/2 signaling levels, respectively (lower panels). At least two independent experiments have been performed. All error bars indicate standard deviation of three biological replicates. Asterisk (∗) indicates p < 0.05 compared with shScr-hPSCs (Student’s t test). E, pAKT and tAKT Western blot bands were quantitated and represented as a ratio to depict pAKT signaling levels upon stimulation of shScr- and shIR-hPSCs with exogenous insulin for 5 min. Data from additional independent IR knocked down clones is presented in Fig S1. hESC, human embryonic stem cell; hPSC, human pluripotent stem cell; IR, insulin receptor.
Next, upon IR knockdown, we observed that IRS-1 and p85α protein expression was marginally decreased, whereas IRS-2 protein expression either increased or did not change (Fig. S1, C–E). Notwithstanding the mild changes in expression of the proximal adaptor proteins, we observed a drastic decrease in pAKTS473 and a surprising reciprocal increase in pERK1/2T202/Y204 signaling (Fig. 1, C and D). Western blot analyses on additional independent IR knocked down clones in H9 hESCs, generated using different shRNA constructs, reflected similar changes in protein expression (Fig. S1E). Together, these data indicate that IR/AKT/ERK1/2 signaling is active in hPSCs and the loss of IR modulates PI3K/AKT and MEK/ERK signaling pathways in a reciprocal manner, which may, in turn, impact the hPSC state.
shIR-hPSCs are insensitive to insulin stimulation at the pAKT level
To determine if the shIR-hPSCs continued to respond normally to ligand, we starved the hPSCs for 24 h in DMEM/F-12 + 0.5% bovine serum albumin (BSA) + 10 ng/ml Activin + 12 ng/ml FGF2 (3) (minimal pluripotency-sustaining conditions devoid of undefined factors that would activate insulin signaling) before stimulating them with increasing doses of human insulin. The scrambled controls (shScr-hPSCs) exhibited a dose-dependent increase in pAKTS473 upon insulin stimulation (Fig. 1E), indicating primary activation of the PI3K/AKT signaling pathway in the maintenance of self-renewal and pluripotency. In contrast, shIR-hPSCs lost their responsiveness to exogenous insulin stimulation (Fig. 1E).
shIR-hPSCs exhibit compensatory increase in pluripotency gene expression
Next, to determine if the knock down of IR in hPSCs affected the hPSC state, we immunostained both shScr- and shIR-hPSCs for OCT4, SOX2, NANOG, SSEA4, and TRA-1-60 and confirmed that they remain pluripotent (Fig. 2A). We also differentiated them into the three germ layers in vivo via teratoma assays (Fig. S2A) and performed in vitro directed differentiation (Fig. S2B) to definitively demonstrate their pluripotency. We next undertook a systems biology approach to gain further insights into the impact of IR knock down on hPSCs. RNA-Seq performed on shIR-CHB8 hESCs indicated that INSR transcript was knocked down without affecting IGF1R transcripts (Table S1), suggesting that the short hairpins targeting INSR transcript are specific and that the decrease in IGF1R protein expression (Fig. 1, A and B and Fig. S1E) is secondary to the loss of IR protein expression. Proteomics analyses further confirmed that IR protein was knocked down in shIR-CHB8 hESCs (Table S2).
Figure 2.
shIR-hPSCs exhibit increased pluripotency gene expression.A, immunostaining for OCT4, SOX2, NANOG, SSEA-4, and TRA-1-60 pluripotency markers in shScr- and shIR-CHB8 hESCs. Scale bar: 200 μm. B, heat map of RNA-Seq analyses of genes involved in pluripotency from shScr- and shIR-CHB8 hESCs (upregulation in red, downregulation in blue). C, heat map showing mass spectrometry analyses of proteins involved in pluripotency from shScr- and shIR-CHB8 hESCs (upregulation in red, downregulation in blue). D, Western blot analyses for OCT4, SOX2, DPPA4, LIN28, and ACTIN protein levels in shScr- and shIR-CHB8 hESCs. E, ERK2 binds onto OCT4 genomic locus in a ChIP assay in shScr- and shIR-H9 hESCs. F, ERK2-bound OCT4 genomic locus is transcriptionally active in a luciferase assay in shScr- and shIR-CHB8 hESCs. The inhibition of (G) ERK2 or (H) ERK1/2 with two different inhibitors results in the abolishment of OCT4 expression but not SOX2 in shScr- and shIR-H9 hESCs. All error bars indicate standard deviation of three replicates. Asterisk (∗) indicates p < 0.05 (Student’s t test). Data from additional independent IR knocked down clones is presented in Fig S2. hESC, human embryonic stem cell; hPSC, human pluripotent stem cell; IR, insulin receptor.
RNA-Seq analyses performed on shIR-CHB8 hESCs revealed an interesting trend of upregulation of numerous pluripotency genes (Fig. 2B, Fig. S2C and Table S1). Proteomics analyses revealed similar changes in both CHB8 (Fig. 2C and Fig. S2D) and H9 (Fig. S2, E and F) hESCs (Tables S2 and S3). Western blot analyses confirmed that the knock down of IR resulted in an upregulation of OCT4, SOX2, DPPA4, and LIN28 protein expression both in CHB8 (Fig. 2D) and H9 (Fig. S2, G and H) hESCs.
Phosphoproteomics analyses performed on shIR-H9 hESCs confirmed an increased phosphorylation of ERK1Y204 and ERK2Y187 (Table S4), corroborating our observations on increased pERK1/2T202/Y204 in shIR-hPSCs (Fig. 1, C and D and Fig. S1E). These data gain significance since ERK2 has been reported to bind to promoter/enhancer regions of pluripotency genes OCT4, SOX2, DPPA4, LIN28A, SALL4, and DNMT3B (10). Furthermore, OCT4, SOX2, and SALL4 all contain putative ERK phosphorylation sites among which ERK2 was confirmed to phosphorylate OCT4, thereby directly linking ERK signaling with pluripotency (14). Therefore, we hypothesized that the loss of IR in hPSCs led to a compensatory increase in pERK1/2, which in turn upregulated the expression of pluripotency genes to maintain the hPSC state.
To establish direct causality between ERK1/2 and pluripotency, we first performed ERK2 chromatin immunoprecipitation (ChIP) qPCR analyses on promoter/enhancer regions of pluripotency genes OCT4, SOX2, DPPA4, LIN28A, SALL4, and ZFX as indicated by Goke et al. (2013) (10). Among these genomic loci, we only found ERK2 to consistently bind onto the OCT4 enhancer region (Fig. 2E). To confirm that the OCT4 enhancer region bound by ERK2 is transcriptionally active, we cloned the promoter/enhancer regions of OCT4, SOX2, and DPPA4 into luciferase assay vectors. Among these three pluripotency genes, indeed we found the OCT4 enhancer region to be transcriptionally active (Fig. 2F). To further demonstrate that the direct interaction between ERK1/2 and OCT4 genomic loci is functionally active, we used two different ERK1/2 inhibitors (instead of MEK inhibitors) on shScr- and shIR-hPSCs and observed that the inhibition of ERK1/2 reproducibly abolished the protein expression of OCT4 but not that of SOX2 (Fig. 2, G and H). The knockdown of ERK1/2 via shRNAs was unfortunately unsuccessful across multiple attempts.
To identify other pluripotency genes that could be directly phosphorylated and regulated by pERK1/2, we performed phosphoproteomics analyses on shIR-CHB8 and shIR-H9 hESCs. NR6A1, SALL4, and DPPA4 exhibited increased phosphorylation (p < 0.05) in shIR-CHB8 hESCs (Table S5), whereas DPPA4 and UTF1 exhibited increased phosphorylation (p < 0.05) in shIR-H9 hESCs (Table S4). DPPA4 distinctly exhibited increased phosphorylation (p < 0.05) in both hESCs (Tables S4 and S5). Taken together, our data suggest that the increased pERK1/2 due to loss of IR in hPSCs phosphorylates and increases the expression of pluripotency genes to maintain the hPSC state.
shIR-hPSCs exhibit perturbations in cell fate markers and decreased ECM gene expression
Since shIR-hPSCs exhibited increased pERK1/2 and gene expression of pluripotency factors, we next sought to determine if the increased expression of pluripotency genes modulated cell fate specification markers, in line with reports that increased pERK1/2 can lead to increased differentiation (15). Initial triage of RNA-Seq data from shIR-CHB8 hESCs (fold change > 1.5; p < 0.05) via Gene Ontology (GO) analyses indicated an upregulation of genes linked to nervous system development and neurogenesis (Fig. 3, A–C). This correlated with the increased expression of all Hox genes (majorly expressed in the vertebrate nervous system) detected in the RNA-Seq data (among 20,469 genes) (Fig. 3B). In addition, a majority of the most differentially upregulated genes in shIR-hPSCs were related to the neural lineage (Table S1).
Figure 3.
Knockdown of IR in hPSCs perturbs cell fate commitment balance. Heat map of RNA-Seq analyses showing (A) germ layer and (B) HOX gene expression from shScr- and shIR-CHB8 hESCs (upregulation in red, downregulation in blue). GO analysis of differentially (C) upregulated and (D) downregulated genes (RNA-Seq data) in shIR-CHB8 hESCs. E, GO analysis of differentially downregulated genes (MS data) in both shIR-CHB8 and shIR-H9 hESCs. GO terms are indicated along the y-axis and the p values for significance of enrichment for the top 10 Gene Ontology terms along the x-axis. Expression of EOMES, SOX17, and FOXA2 transcripts in shScr- and shIR- (F) CHB8 and (G) H9 hESCs. All error bars indicate standard deviation of three biological replicates. Asterisk (∗) indicates p < 0.05 compared with shScr-hPSCs (Student’s t test). hESC, human embryonic stem cell; hPSC, human pluripotent stem cell; IR, insulin receptor.
GO analyses indicated that multiple biological processes were both up- and downregulated in the RNA-Seq data (Fig. 3, C and D). Among the early germ layer specification genes, we observed that indeed numerous neuroectodermal genes such as PAX2, GBX2, CHRD, and NES and numerous HOX genes were upregulated, whereas most of the mesodermal and endodermal genes were strikingly downregulated in shIR-hPSCs (Fig. 3, A and B). GO analyses performed on downregulated proteins in the proteomics data from both shIR-CHB8 and shIR-H9 hESC lines (fold change > 1.5) (Fig. 3E) corroborated the RNA-Seq data (Fig. 3D). QPCR analyses then confirmed that some of the most downregulated genes (mostly endodermal) such as EOMES, SOX17, and FOXA2 were severely suppressed in shIR-hPSCs (Fig. 3, F and G). Thus, knockdown of IR in hPSCs causes an imbalance in germ layer specification genes, likely owing to an increase in phosphorylation coupled with total protein expression of numerous pluripotency genes.
The knock down of IR in hPSCs also distinctly resulted in a global downregulation of ECM gene expression. RNA-Seq data indicated that a majority of the collagen (COL), keratins (KRT), vitronectin (VTN), fibronectin (FN1), laminins (LAM), and prolyl 4-hydroxylase (P4H) genes were dramatically downregulated in shIR-hPSCs (Fig. S3A). Proteomics data in shIR-CHB8 and shIR-H9 hESCs further reflected this global downregulation of ECM proteins (Fig. S3, B and C). QPCR analyses on FN1, COL1A1, and KRT19 genes in both shIR-CHB8 and shIR-H9 hESCs (Fig. S3D) and Western blot analyses on FN1, COL1, and P4HB (Fig. S3E) provided corroborative independent validations.
shIR-hPSCs exhibit aberrant neural lineage differentiation
Considering the RNA-Seq data pointed to perturbations in genes involved in nervous system development in undifferentiated hPSCs (Fig. 3, A–C), we then differentiated both shScr- and shIR-hPSCs into neuroectoderm and cerebral organoids to evaluate the effects of IR knockdown on neural lineage differentiation. QPCR analyses revealed an upregulation of neuroectodermal markers SOX2, SOX1, PAX6, and SIP1 in shIR-hPSCs differentiated into day 7 neuroectoderm (Fig. 4A). Immunostaining then revealed that SOX1 and PAX6 proteins colocalized in shScr-hPSC–derived neuroectoderm but not in shIR-hPSC–derived neuroectoderm (Fig. 4B and Fig. S4).
Figure 4.
Knockdown of IR in hPSCs perturbs neuroectoderm differentiation and subsequent formation of cerebral organoids.A, expression of IR-A, IR-B, IGF1R, OCT4, SOX2, NANOG, SOX1, PAX6, and SIP1 transcripts in shScr- and shIR-hESC–derived neuroectoderm. B, immunostaining for SOX1 and PAX6 neuroectoderm markers in shScr- and shIR-hESCs. Scale bar: 200 μm. C, expression of PAX6, FOXG1, and REELIN transcripts in shScr- and shIR-hESC–derived cerebral organoids. All error bars indicate standard deviation of three biological replicates. Asterisk (∗) indicates p < 0.05 compared with shScr-hPSCs (Student’s t test). D, immunostaining for PAX6 and FOXG1 in shScr- and shIR-hESC–derived cerebral organoids. Cortical membrane-like structures are shown with arrows. Scale bar: 200 μm. E, summary model depicting (1) shIR-hPSCs with decreased (2) pAKT and (3) ECM protein expression, (4) elevated pERK1/2, and (5) elevated pluripotency gene expression, resulting in (6) perturbations in cell fate commitment gene expression, including that of the neural lineage. hESC, human embryonic stem cell; hPSC, human pluripotent stem cell; IR, insulin receptor.
Moving forward, we differentiated both shScr- and shIR-hPSCs into cerebral organoids using the protocol published by Lancaster et al. (16). We continued to observe an upregulation of PAX6 gene expression in this advanced neural differentiation protocol (Fig. 4C). However, we consistently found the forebrain marker FOXG1 and Cajal–Retzius marker REELIN to be significantly downregulated at the end of the cerebral differentiation (Fig. 4C). Immunostaining for FOXG1 in these cerebral organoids then showed that shScr-hPSC–derived cerebral organoids formed FOXG1+ cortical membrane-like structures (see white arrows) but shIR-hPSC–derived cerebral organoids did not (Fig. 4D). This suggests that the knockdown of IR in hPSCs led to aberrant neuroectoderm development, giving rise to disrupted neural gene expression and the proper formation of mature cortical structures in this cerebral organoid model.
Collectively, our data demonstrate that the knock down of IR in hPSCs (1; Fig. 4E) decreased pAKT (2; Fig. 4E) and resulted in a global decrease in ECM gene expression necessary for the hPSC niche (3; Fig. 4E). The knockdown also resulted in a compensatory increase in pERK1/2 (4; Fig. 4E), an inherent compensatory mechanism, leading to increased pluripotency marker gene expression (5; Fig. 4E), and perturbations in cell fate specification such as that of neural development (6; Fig. 4E).
Discussion
Insulin/IGF-I signaling pathways regulate the growth and specialized functions of most mammalian tissues including pluripotent stem cells. Although a role for IGF1R has been reported (6, 7), virtually nothing is known about the significance of IR in hPSCs. Using genome-wide RNA-Seq, proteomics, and phosphoproteomics analyses of two different clones in two different hESC lines (CHB8 and H9), we demonstrated that the IR is indeed important for hPSC viability and function. Knockdown of IR marginally perturbed adaptor proteins while strongly decreasing pAKT and evoking a compensatory increase in pERK1/2 signaling. Insulin stimulation of shScr-hPSCs demonstrates that pAKT signaling is the predominant pathway activated via ligand binding to IR/IGF1R.
Among the nodes downstream of insulin/IGF-I signaling, both the AKT and ERK1/2 pathways (9) are considered important for pluripotency and viability of hESCs (17). In contrast to human PSCs, IR-mediated signaling showed a decrease in Erk/mTor pathways along with a decrease in Akt pathway in mouse PSCs (18), suggesting some species differences. In our studies, the severe reduction in pAKT signaling in shIR-hPSCs and a strong concomitant increase in pERK1/2 signaling is consistent with a recent report that PI3K/AKT inhibition induces pERK1/2 expression to modulate self-renewal of hPSCs (15). The decrease in pAKT signaling in our shIR-hPSCs should not be confused with the inhibition of PI3K/AKT signaling that induces endoderm differentiation because the latter takes place in the presence of a high dose of Activin A (19). Since the insulin/IGF-I signaling pathway is known to be actively involved in the maintenance of self-renewal and pluripotency of hPSCs (20) and considering the high levels of recombinant insulin/IGFs in hPSC media, one can argue that insulin/IGF-I is highly implicated in mediating the increase in pERK1/2 signaling.
Insulin/IGF-I signaling activates the MAPK pathway, and a high basal level of MAPK signaling has been reported to maintain the expression of pluripotency genes in hPSCs (21, 22). MAPK signaling is essential for the maintenance of pluripotency in both mouse and human PSCs, but, in contrast, high levels of MAPK signaling is reported to involve differentiation in mouse PSCs. The MEK/ERK signaling pathway has diverse functions with some reports indicating that it maintains pluripotency and self-renewal (17, 22) and others claiming it promotes differentiation or counters BMP-induced differentiation (23, 24). Since KOSR contains BMP-like activities, the increased pERK1/2 in shIR-hPSCs could be playing a role in inhibiting BMP signaling-induced differentiation. Increased pERK1/2 has been suggested to lead to increased differentiation (15). However, in our shIR-hPSCs, the increased pERK1/2 is tightly correlated with increased pluripotency gene expression, phosphorylation, and widespread downregulation of mesodermal and endodermal gene expression. In fact, investigation of ERK signaling for the self-renewal of hESCs reveals that ERK2 binds near OCT4, SOX2, DPPA4, LIN28A, SALL4, and DNMT3B and is necessary for the maintenance of pluripotency (10). In addition, OCT4, SOX2, and SALL4 contain putative ERK phosphorylation sites of which ERK2 was confirmed to phosphorylate OCT4 (14). The binding by ERK2 onto its target genes is reported to be phosphorylation dependent (10). Our data definitively establishes direct causality between ERK1/2 and the master pluripotency regulator OCT4 (25). These findings are corroborated by the report on the importance of ERK signaling in the maintenance of self-renewal, by phosphorylating pluripotency genes, leading to the recruitment of complexes involved in protein degradation, reduced transcriptional activity, or protein stability (26, 27). The increase in OCT4 gene expression could in turn upregulate the expression of other downstream pluripotency genes to curb undesired differentiation and to maintain the hPSC state.
OCT4 and SOX2 are at the core of the self-renewal and pluripotency network of hPSCs (2). UTF1, a target gene of OCT4 and SOX2, functions to regulate differentiation via the tight control of bivalent genes. Other pluripotency factors such as DPPA4 inhibit ESC differentiation; DNMT3B is a DNA methyltransferase that regulates developmental potential of PSCs, whereas LIN28A potentiates insulin/PI3K signaling via the repression of let-7. Therefore, the increased expression of these pluripotency genes appears to counter the effects of IR knockdown via diverse mechanisms that serve to maintain the self-renewal and pluripotent state of hPSCs.
Among the pluripotency genes, OCT4, SOX2, and NANOG are placed at the top of the hierarchy. Increased levels of OCT4 and SOX2 are known to suppress mesodermal and endodermal genes (28). In agreement with this, many germ layer specification genes, primarily endodermal and mesodermal, were strikingly downregulated in hPSCs with reduced insulin receptors. In these shIR-hPSCs, which exhibit perturbed pluripotency versus cell fate commitment balance, there is an initial increase in the expression of PAX2, GBX2, CHRD, NES, and numerous HOX genes. The increased expression of SOX2 that can initiate the neural cell fate (29) likely explains this phenomenon. Overall, the cause for imbalance in germ layer specification genes is likely due to an increase in phosphorylation coupled with total protein expression of numerous pluripotency genes.
The ECM is necessary for survival and proliferation of epithelial cells such as hPSCs. Knockdown of IR in hPSCs resulted in a global downregulation of ECM proteins. To our knowledge, there is limited evidence to date linking the role of IR signaling to ECM formation (30). ERK1/2 signaling is apparently required for cell adhesion to facilitate hPSC clonogenicity (23). In addition, increased pERK1/2 signaling reduces stem cell differentiation (31). Collectively, this suggests that the increased pERK1/2 in shIR-hPSCs is a feedback response to counter shIR-mediated loss of ECM proteins, to improve cellular adhesion, hPSC self-renewal, and survival and to decrease differentiation.
Our RNA-Seq data on shIR-hPSCs first revealed distinct effects on nervous system development. Further differentiation of these shIR-hPSCs into neuroectoderm and cerebral organoids then demonstrated various aberrant signatures, consistent with the importance of insulin signaling during brain development (32, 33). Since the Sox1 to Pax6 switch is involved in radial glia progression (34), the dysregulation of SOX1 and PAX6 gene expression and protein localization could affect the specialization of neural cells. FOXG1 is a critical transcription factor playing pleiotropic functions during brain development (35). It suppresses premature cortical cell fate (36) and maintains the proliferative state of neurons (37). The gene dosage of FOXG1 can account for the various types of FOXG1 syndrome (38). Given that FOXG1 is known to be directly regulated by AKT signaling (37), the loss of IR can partly contribute to its reduced expression, thereby leading to the abnormal structures in the cerebral organoids.
In summary, our follow-up study (18) using genome-wide RNA-Seq, proteomics and phosphoproteomics analyses, and its validation in various clones of two different hESC lines (CHB8 and H9) demonstrates the importance of IR-mediated pAKT signaling in hPSCs, without which ECM formation, which is critical for cellular attachment, is severely attenuated. An inherent compensatory mechanism in the form of upregulated pERK1/2 signaling leads to increased pluripotency gene expression and a perturbation of the balance between pluripotency versus cell fate commitment (Fig. 4E). Overall, this study links IR-mediated signaling to the pluripotent function of hPSCs and the proper regulation of cell fate specification, including that of the neural lineage. Future experiments are warranted to elucidate ERK1/2-bound targets in shIR-hPSCs to potentially reveal direct regulatory relationships with germ layer–specific genes.
Experimental procedures
Cell culture
CHB8 (Daley lab) and H9 (WiCell) hESCs stably transfected with shIR plasmids were cultured in mTeSR1 media supplemented with 1 μg/ml puromycin (28). Two different shIR plasmids were used to generate independent IR knocked down clones in CHB8 and H9 hESCs. For stimulation assays, hPSCs were grown in DMEM/F-12 + 0.5% BSA + 10 ng/ml Activin + 12 ng/ml FGF2 (3) for 24 h before being stimulated with 0, 1, 10, or 100 nM human insulin for 5 min. TCS ERK 11e (Tocris Bioscience) was used to inhibit ERK2, whereas SCH772984 (Selleck Chemicals) was used to inhibit ERK1/2. hPSCs were treated with the ERK1/2 inhibitors for 72 h. hESCs used were tested mycoplasma negative.
For neuroectoderm differentiation, hESCs were cultured following the protocol established in a previous study by Chng et al. (29). For cerebral organoid differentiation, hESCs were grown to 90% confluency, dissociated into single cells using TrypLE Express Enzyme (Thermo Fisher), replated in TeSR-E8 media with 50 μM Y-27632, and seeded into ultralow-attachment 96-well plates (12,000 cells per well) (Corning Costar). After 24 h (designated as D0), the embryoid bodies were differentiated into neuroectoderm, neural progenitor, and cerebral organoids using a previously established protocol (16).
Teratoma and in vitro differentiation assays
The teratoma assay has been described previously (39). The embryoid body formation and in vitro differentiation assay to ascertain differentiation potential has been reported previously (40). Antibodies used are provided in Table S6.
qRT-PCR, Western blot, immunostaining, and chromatin immunoprecipitation analyses
Methods for qRT-PCR, Western blot, and immunostaining analyses have been described previously (41). The method for ChIP has been described previously (10, 28, 42). Western blot bands were quantitated using TotalLab Quant or LI-COR Image Studio Lite. All error bars represent standard deviation of three biological replicates. A p value <0.05 indicates statistical significance by two-sided Student’s t test. Primers and antibodies used are provided in Table S6.
Luciferase assay
OCT4, SOX2, and DPPA4 genomic regions bound by ERK2 (10) were cloned into pGL4.23 or pGL4.10 luciferase vectors using NheI and HindIII restriction enzyme sites. Primers used for cloning are provided in Table S6.
ELISA assay
Human insulin ELISA assay (Mercodia) was performed by the Joslin Specialized Assay Core.
RNA-Seq and MS data availability
RNA-Seq was performed at the Broad Institute. Raw data have been uploaded to GEO with accession number GSE60328. MS was performed in the Environmental Molecular Science Laboratory at Pacific Northwest National Laboratory. Raw data have been deposited in MassIVE (https://massive.ucsd.edu/) with accession number MSV000085298. See Supplementary Information for details.
Supporting information
This article contains supporting information.
Conflict of interest
The authors declare that they have no conflicts of interest with the contents of this article.
Acknowledgments
We thank G. Daley, MD, PhD for CHB8 hESCs; J. Jasmen, M. Santosa, R. Windmueller, and V. Bhere for assistance; G. Chirn for assistance with bioinformatics analyses; and A. Meissner, PhD for assistance with RNA-Seq submission.
Author contributions
Conceptualization, A. K. K. T. and R. N. K.; Validation and Investigation, A. K. K. T., L. N., H. H. L., M. K. G., L. S. W. L., N. J., C. S. L., W. M., M. A. G., J. L. R., and W.-J. Q.; Resources, W.-J. Q. and R. D. S.; Writing – Original Draft, Review and Editing, A. K. K. T. and R. N. K.; Supervision, R. N. K.; Project Administration, A. K. K. T. and R. N. K.; Funding Acquisition, A. K. K. T. and R. N. K.
Funding and additional information
A. K. K. T. is supported by the Institute of Molecular and Cell Biology (IMCB), A∗STAR, the JCO Career Development Award (CDA) 15302FG148, NMRC OF-YIRG OFYIRG16may014, MRC Research Grant, A∗STAR ETPL Gap Funding ETPL/18-GAP005-R20H, Skin Innovation Grant SIG18011, NMRC OF-LCG/DYNAMO, Lee Foundation Grant SHTX/LFG/002/2018, Precision Medicine and Personalised Therapeutics Joint Research Grant 2019, FY2019 SingHealth Duke-NUS Surgery Academic Clinical Programme Research Support Programme Grant, SingHealth Duke-NUS Transplant Centre – Multi-Visceral Transplant Fund Award and the Industry Alignment Fund-Industry Collaboration Project (IAF-ICP). R. D. S. is supported by NIH grant P41 GM103493. R. N. K. is supported by the HSCI and, NIH grants R01 DK 67536, R01 DK103215, and UC4 DK 116278. Pacific Northwest National Laboratory is under DOE contract DE-AC05-76RLO-1830. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
Edited by Qi-Qun Tang
Contributor Information
Adrian Kee Keong Teo, Email: drainteo@gmail.com, ateo@imcb.a-star.edu.sg.
Rohit N. Kulkarni, Email: rohit.kulkarni@joslin.harvard.edu.
Supporting information
References
- 1.Teo A.K., Vallier L. Emerging use of stem cells in regenerative medicine. Biochem. J. 2010;428:11–23. doi: 10.1042/BJ20100102. [DOI] [PubMed] [Google Scholar]
- 2.Rizzino A. Concise review: The Sox2-Oct4 connection: Critical players in a much larger interdependent network integrated at multiple levels. Stem Cells. 2013;31:1033–1039. doi: 10.1002/stem.1352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Vallier L., Alexander M., Pedersen R.A. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J. Cell Sci. 2005;118:4495–4509. doi: 10.1242/jcs.02553. [DOI] [PubMed] [Google Scholar]
- 4.Sperger J.M., Chen X., Draper J.S., Antosiewicz J.E., Chon C.H., Jones S.B., Brooks J.D., Andrews P.W., Brown P.O., Thomson J.A. Gene expression patterns in human embryonic stem cells and human pluripotent germ cell tumors. Proc. Natl. Acad. Sci. U. S. A. 2003;100:13350–13355. doi: 10.1073/pnas.2235735100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Belfiore A., Frasca F., Pandini G., Sciacca L., Vigneri R. Insulin receptor isoforms and insulin receptor/insulin-like growth factor receptor hybrids in physiology and disease. Endocr. Rev. 2009;30:586–623. doi: 10.1210/er.2008-0047. [DOI] [PubMed] [Google Scholar]
- 6.Wang L., Schulz T.C., Sherrer E.S., Dauphin D.S., Shin S., Nelson A.M., Ware C.B., Zhan M., Song C.Z., Chen X., Brimble S.N., McLean A., Galeano M.J., Uhl E.W., D'Amour K.A. Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling. Blood. 2007;110:4111–4119. doi: 10.1182/blood-2007-03-082586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bendall S.C., Stewart M.H., Menendez P., George D., Vijayaragavan K., Werbowetski-Ogilvie T., Ramos-Mejia V., Rouleau A., Yang J., Bosse M., Lajoie G., Bhatia M. IGF and FGF cooperatively establish the regulatory stem cell niche of pluripotent human cells in vitro. Nature. 2007;448:1015–1021. doi: 10.1038/nature06027. [DOI] [PubMed] [Google Scholar]
- 8.Kleinridders A., Cai W., Cappellucci L., Ghazarian A., Collins W.R., Vienberg S.G., Pothos E.N., Kahn C.R. Insulin resistance in brain alters dopamine turnover and causes behavioral disorders. Proc. Natl. Acad. Sci. U. S. A. 2015;112:3463–3468. doi: 10.1073/pnas.1500877112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Taniguchi C.M., Emanuelli B., Kahn C.R. Critical nodes in signalling pathways: Insights into insulin action. Nat. Rev. Mol. Cell Biol. 2006;7:85–96. doi: 10.1038/nrm1837. [DOI] [PubMed] [Google Scholar]
- 10.Goke J., Chan Y.S., Yan J., Vingron M., Ng H.H. Genome-wide kinase-chromatin interactions reveal the regulatory network of ERK signaling in human embryonic stem cells. Mol. Cell. 2013;50:844–855. doi: 10.1016/j.molcel.2013.04.030. [DOI] [PubMed] [Google Scholar]
- 11.Watt F.M., Huck W.T. Role of the extracellular matrix in regulating stem cell fate. Nat. Rev. Mol. Cell Biol. 2013;14:467–473. doi: 10.1038/nrm3620. [DOI] [PubMed] [Google Scholar]
- 12.Ding V., Choo A.B., Oh S.K. Deciphering the importance of three key media components in human embryonic stem cell cultures. Biotechnol. Lett. 2006;28:491–495. doi: 10.1007/s10529-006-0005-8. [DOI] [PubMed] [Google Scholar]
- 13.Ludwig T., J A.T. Defined, feeder-independent medium for human embryonic stem cell culture. Curr. Protoc. Stem Cell Biol. 2007 doi: 10.1002/9780470151808.sc01c02s2. Chapter 1:Unit 1C 2. [DOI] [PubMed] [Google Scholar]
- 14.Brumbaugh J., Hou Z., Russell J.D., Howden S.E., Yu P., Ledvina A.R., Coon J.J., Thomson J.A. Phosphorylation regulates human OCT4. Proc. Natl. Acad. Sci. U. S. A. 2012;109:7162–7168. doi: 10.1073/pnas.1203874109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Singh A.M., Reynolds D., Cliff T., Ohtsuka S., Mattheyses A.L., Sun Y., Menendez L., Kulik M., Dalton S. Signaling network crosstalk in human pluripotent cells: A Smad2/3-regulated switch that controls the balance between self-renewal and differentiation. Cell Stem Cell. 2012;10:312–326. doi: 10.1016/j.stem.2012.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lancaster M.A., Knoblich J.A. Generation of cerebral organoids from human pluripotent stem cells. Nat. Protoc. 2014;9:2329–2340. doi: 10.1038/nprot.2014.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Armstrong L., Hughes O., Yung S., Hyslop L., Stewart R., Wappler I., Peters H., Walter T., Stojkovic P., Evans J., Stojkovic M., Lako M. The role of PI3K/AKT, MAPK/ERK and NFkappabeta signalling in the maintenance of human embryonic stem cell pluripotency and viability highlighted by transcriptional profiling and functional analysis. Hum. Mol. Genet. 2006;15:1894–1913. doi: 10.1093/hmg/ddl112. [DOI] [PubMed] [Google Scholar]
- 18.Gupta M.K., De Jesus D.F., Kahraman S., Valdez I.A., Shamsi F., Yi L., Swensen A.C., Tseng Y.H., Qian W.J., Kulkarni R.N. Insulin receptor-mediated signaling regulates pluripotency markers and lineage differentiation. Mol. Metab. 2018;18:153–163. doi: 10.1016/j.molmet.2018.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.McLean A.B., D'Amour K.A., Jones K.L., Krishnamoorthy M., Kulik M.J., Reynolds D.M., Sheppard A.M., Liu H., Xu Y., Baetge E.E., Dalton S. Activin a efficiently specifies definitive endoderm from human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is suppressed. Stem Cells. 2007;25:29–38. doi: 10.1634/stemcells.2006-0219. [DOI] [PubMed] [Google Scholar]
- 20.Dalton S. Signaling networks in human pluripotent stem cells. Curr. Opin. Cell Biol. 2013;25:241–246. doi: 10.1016/j.ceb.2012.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Eiselleova L., Matulka K., Kriz V., Kunova M., Schmidtova Z., Neradil J., Tichy B., Dvorakova D., Pospisilova S., Hampl A., Dvorak P. A complex role for FGF-2 in self-renewal, survival, and adhesion of human embryonic stem cells. Stem Cells. 2009;27:1847–1857. doi: 10.1002/stem.128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Li J., Wang G., Wang C., Zhao Y., Zhang H., Tan Z., Song Z., Ding M., Deng H. MEK/ERK signaling contributes to the maintenance of human embryonic stem cell self-renewal. Differentiation. 2007;75:299–307. doi: 10.1111/j.1432-0436.2006.00143.x. [DOI] [PubMed] [Google Scholar]
- 23.Na J., Furue M.K., Andrews P.W. Inhibition of ERK1/2 prevents neural and mesendodermal differentiation and promotes human embryonic stem cell self-renewal. Stem Cell Res. 2010;5:157–169. doi: 10.1016/j.scr.2010.06.002. [DOI] [PubMed] [Google Scholar]
- 24.Xu R.H., Peck R.M., Li D.S., Feng X., Ludwig T., Thomson J.A. Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat. Methods. 2005;2:185–190. doi: 10.1038/nmeth744. [DOI] [PubMed] [Google Scholar]
- 25.Jerabek S., Merino F., Scholer H.R., Cojocaru V. OCT4: Dynamic DNA binding pioneers stem cell pluripotency. Biochim. Biophys. Acta. 2014;1839:138–154. doi: 10.1016/j.bbagrm.2013.10.001. [DOI] [PubMed] [Google Scholar]
- 26.Chen H., Guo R., Zhang Q., Guo H., Yang M., Wu Z., Gao S., Liu L., Chen L. Erk signaling is indispensable for genomic stability and self-renewal of mouse embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 2015;112:E5936–E5943. doi: 10.1073/pnas.1516319112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kim S.H., Kim M.O., Cho Y.Y., Yao K., Kim D.J., Jeong C.H., Yu D.H., Bae K.B., Cho E.J., Jung S.K., Lee M.H., Chen H., Kim J.Y., Bode A.M., Dong Z. ERK1 phosphorylates Nanog to regulate protein stability and stem cell self-renewal. Stem Cell Res. 2014;13:1–11. doi: 10.1016/j.scr.2014.04.001. [DOI] [PubMed] [Google Scholar]
- 28.Teo A.K., Arnold S.J., Trotter M.W., Brown S., Ang L.T., Chng Z., Robertson E.J., Dunn N.R., Vallier L. Pluripotency factors regulate definitive endoderm specification through eomesodermin. Genes Dev. 2011;25:238–250. doi: 10.1101/gad.607311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chng Z., Teo A., Pedersen R.A., Vallier L. SIP1 mediates cell-fate decisions between neuroectoderm and mesendoderm in human pluripotent stem cells. Cell Stem Cell. 2010;6:59–70. doi: 10.1016/j.stem.2009.11.015. [DOI] [PubMed] [Google Scholar]
- 30.Liu Z.Z., Kumar A., Ota K., Wallner E.I., Kanwar Y.S. Developmental regulation and the role of insulin and insulin receptor in metanephrogenesis. Proc. Natl. Acad. Sci. U. S. A. 1997;94:6758–6763. doi: 10.1073/pnas.94.13.6758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Trappmann B., Gautrot J.E., Connelly J.T., Strange D.G., Li Y., Oyen M.L., Cohen Stuart M.A., Boehm H., Li B., Vogel V., Spatz J.P., Watt F.M., Huck W.T. Extracellular-matrix tethering regulates stem-cell fate. Nat. Mater. 2012;11:642–649. doi: 10.1038/nmat3339. [DOI] [PubMed] [Google Scholar]
- 32.Liu J., Speder P., Brand A.H. Control of brain development and homeostasis by local and systemic insulin signalling. Diabetes Obes. Metab. 2014;16 Suppl 1:16–20. doi: 10.1111/dom.12337. [DOI] [PubMed] [Google Scholar]
- 33.Chiu S.L., Cline H.T. Insulin receptor signaling in the development of neuronal structure and function. Neural Dev. 2010;5:7. doi: 10.1186/1749-8104-5-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Suter D.M., Tirefort D., Julien S., Krause K.-H. A Sox1 to Pax6 switch drives neuroectoderm to radial glia progression during differentiation of mouse embryonic stem cells. Stem Cells. 2009;27:49–58. doi: 10.1634/stemcells.2008-0319. [DOI] [PubMed] [Google Scholar]
- 35.Kumamoto T., Hanashima C. Evolutionary conservation and conversion of Foxg1 function in brain development. Dev. Growth Differ. 2017;59:258–269. doi: 10.1111/dgd.12367. [DOI] [PubMed] [Google Scholar]
- 36.Hanashima C., Li S.C., Shen L., Lai E., Fishell G. FOXG1 supresses early cortical cell fate. Science. 2004;303:56–59. doi: 10.1126/science.1090674. [DOI] [PubMed] [Google Scholar]
- 37.Dastidar S.G., Landrieu P.M., D'Mello S.R. FoxG1 promotes the survival of postmitotic neurons. J. Neurosci. 2011;31:402–413. doi: 10.1523/JNEUROSCI.2897-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Mitter D., Pringsheim M., Kaulisch M., Plumacher K.S., Schroder S., Warthemann R., Abou Jamra R., Baethmann M., Bast T., Buttel H.M., Cohen J.S., Conover E., Courage C., Eger A., Fatemi A. FOXG1 syndrome: Genotype-phenotype association in 83 patients with FOXG1 variants. Genet. Med. 2018;20:98–108. doi: 10.1038/gim.2017.75. [DOI] [PubMed] [Google Scholar]
- 39.Teo A.K., Windmueller R., Johansson B.B., Dirice E., Njolstad P.R., Tjora E., Raeder H., Kulkarni R.N. Derivation of human induced pluripotent stem cells from patients with maturity onset diabetes of the young. J. Biol. Chem. 2013;288:5353–5356. doi: 10.1074/jbc.C112.428979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Gupta M.K., Teo A.K., Rao T.N., Bhatt S., Kleinridders A., Shirakawa J., Takatani T., Hu J., De Jesus D.F., Windmueller R., Wagers A.J., Kulkarni R.N. Excessive cellular proliferation negatively impacts reprogramming efficiency of human fibroblasts. Stem Cells Transl. Med. 2015;4:1101–1108. doi: 10.5966/sctm.2014-0217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Teo A.K., Valdez I.A., Dirice E., Kulkarni R.N. Comparable generation of activin-induced definitive endoderm via additive Wnt or BMP signaling in absence of serum. Stem Cell Reports. 2014;3:5–14. doi: 10.1016/j.stemcr.2014.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Teo A.K., Tsuneyoshi N., Hoon S., Tan E.K., Stanton L.W., Wright C.V., Dunn N.R. PDX1 binds and represses hepatic genes to ensure robust pancreatic commitment in differentiating human embryonic stem cells. Stem Cell Reports. 2015;4:578–590. doi: 10.1016/j.stemcr.2015.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.