Skip to main content
NCBI home page
Open Veterinary Journal logoLink to Open Veterinary Journal
. 2021 Mar 10;11(1):165–173. doi: 10.4314/ovj.v11i1.24

Severe pneumonia in a street rat (Rattus norvegicus) caused by Rodentibacter rarus strain RMC2

Hacène Medkour 1,2,†, Younes Laidoudi 1,2,†, Handi Dahmana 1,2, Bastien Salvi 2, Hubert Lepidi 1,2,3, Oleg Mediannikov 1,2, Bernard Davoust 1,2,*
PMCID: PMC8057205  PMID: 33898299

Abstract

Background:

Rodents are one of the most dangerous reservoirs and carriers of infectious diseases. Gradually, rats have become predominant in cities, sometimes staying in close vicinity to humans, pets, and other animals. Consequently, they tend to increase the transmission risk of pathogens.

Case Description:

Here, we report an original case of bacterial pneumonia in a street rat (Rattus norvegicus). The rat was found dead on a street in the chief town of Marseille (France) after being run over by a car. The necropsy of the corpse revealed generalized granulomatous pneumonia in almost all the pulmonary lobes. Lung lesions and predominantly multiple fibro-inflammatory areas are presumably the witness of an infectious etiology. Bacterial isolation was carried out from lung tissues. Colonies were identified by MALDI-TOF MS and confirmed by 16S rRNA sequencing. The following bacteria were identified: Staphylococcus cohnii, Bordetella bronchiseptica, Bordetella parapertussi, Corynebacterium glucuronolyticum, Pelistega suis and Rodentibacter rarus. Based on the histopathological diagnosis and the avoidance approach, the most likely etiological agent of pneumonia is therefore R. rarus, a little-known Pasteurellales bacterium that is closely related to Rodentibacter pneumotropicus.

Conclusion:

These data emphasize the severity of R. rarus infection in rodents. Thus, pointing out a potential risk for other animals (dogs, cats, and birds), as well as humans. The health monitoring program for rodents and rabbits pasteurellosis should now include R. rarus. Therefore, the pathological effect of the Rodentibacterspecies and/or strains needs to be better explored.

Keywords: Rodents, Rattus norvegicus, Rodentibacter rarus, Pasteurellosis, Pneumonia

Introduction

Pasteurellaceae bacterium is often involved in pneumonia. They are among the most prevalent commensal and opportunistic bacteria found globally in domestic and wild animals (Wilson et al., 2013). However, the surveillance of these microorganisms is limited to species and/or strains with a virulent effect, such as Pasteurella pneumotropica, and Pasteurella multocida (Itoh and Kurai, 2018), a well-known pathogen for humans and a wide range of animals. Due to the gravity of the disease and zoonotic risk, the Federation of European Laboratory Animal Science Associations recommended a health monitoring program for laboratory rodents and rabbits for Pasteurellaceae infections (Nicklas et al., 2002; Mähler Convenor et al., 2014), especially P. pneumotropica.

Pasteurella pneumotropica was initially isolated and described by Jawetz (1950) from pneumonic lesions of laboratory mice. Later, the human biotype of P. multocida was reclassified as P. pneumotropica by Henriksen (1962). However, recent advances in clinical microbiology as well as in molecular taxonomic systems, allowed for the reclassification of P. pneumotropica to a distinct species within the genus Rodentibacter. Two P. pneumotropica biotypes, namely Jawetz and Heyl, were reclassified as part of Rodentibacter pneumotropicus and Rodentibacter heylii, respectively (Adhikary et al., 2017). Other Rodentibacter species, namely R. ratti, Rodentibacter myodis, Rodentibacter heidelbergensis, R. heidelbergensis, R. trehalosifermentans, Rodentibacter mrazii, and Rodentibacter rarus (Adhikary et al., 2017) were derived from some Bisgaard strains (Boot and Bisgaard, 1995). The identification of Pasteurellaceae as an etiological agent of rodents, usually isolated from the nasopharynx (Dafni et al., 2019), is lacking efficiency since the clear-cut distinction between these species/strains relies on a laborious biochemical analysis (Adhikary et al., 2017). Consequently, the diseases they induce remain poorly studied. Nowadays, scant pathological studies on a few Rodentibacter species have been reported. Rodentibacter pneumotropicus and R. heylii are highly virulent pathogens for immunodeficient mice, inducing severe pneumonia, septicemia, and conjunctivitis (Kawamoto et al., 2011). Rodentibacter pneumotropicus was also involved in bronchopneumonia and septicemia in wildtype mice (Fornefett et al., 2018).

The brown rat or Norwegian rat (Rattus norvegicus) arrived in Europe around 1,750 through international trade vessels. These rodents then became dominant in cities, usually around the port cities by supplanting the black rat (Rattus rattus) (Schweinfurth, 2020). In addition to the bad image they give to the cities, they are the most threatening sentinel of public health by propagating a wide range of pathogens. In Marseille, which is the second-largest commune in France with 863,310 inhabitants, we have already conducted studies to identify pathogens in street rats (86 R. norvegicus and 22 R. rattus): Hantavirus (0%) Bartonella spp. (30%), Leptospira interrogans (9%), Streptobacillus moniliformis (13%), Calodium hepaticum (44%), Trichinella spp. (0%), and Xenopsylla cheopis (21%) (Boni et al., 1997; Davoust et al., 1997; Gundi et al., 2004; Socolovschi et al., 2011). More recently, in an urban park near Paris, the brown rats were found to be infected with Rickettsia spp. (1.2%), Bartonella spp. (53%), Francisella tularensis (5%), and Leptospira spp. (21%) (Desvars-Larrive et al., 2017). Paradoxically, worldwide, the wild brown rat is one of the most prevalent animals.

Nowadays, studies on pulmonary infectious diseases of brown rats are lacking. These rodents have been investigated for pulmonary infectious diseases only in Vancouver city (631,486 inhabitants) in Canada, a similar city to Marseille (Himsworth et al., 2014a, 2014b). Notably, researchers reported macroscopic and histologic lesions, particularly in the lungs. These data remain the only available ones (Himsworth et al., 2013; Rothenburger et al., 2015), wherein the peribronchiolar and/or perivascular lymphoplasmacytic cuffs were present and were also significantly associated with a cilia-associated respiratory bacillus and Mycoplasma pulmonis (Rothenburger et al., 2019). In this context and to extend our knowledge on the pulmonary diseases of brown rats, we present in this article an original case of severe bacterial pneumonia from a street rat in Marseille (France).

Case Details

In December 2019, a rat was struck by a round run in the chief town of Marseille (France) (43°17′06.2 ″N – 5°23′46.7 ″E). The rat corpse was immediately transported to a specific biohazard bag to the veterinary research center at the Institut Hospitalo-Universitaire (IHU) Méditerrannée Infection. The preliminary examination showed that the corpse corresponds to a street rat (R. norvegicus), male, weighing 475 g, with a length (head + body) of 25 cm and a tail length of 22 cm. Except for the head, which was strongly damaged, the corpse had a normal appearance. However, a few ectoparasites (Ornithonyssus spp.; family Macronyssidae; Acari) were observed.

The rat corpse was necropsied and sampled as described elsewhere (Herbreteau et al., 2011). Visual examination of tissues and visceral organs was carefully carried out. Microscopic examination was carried out using both routine and specific staining techniques and examined at three different magnifications (20×, 80×, and 300×).

Besides, the following quantitative polymerase chain reaction (qPCR) screening was carried out on lung tissues to search for the most-known bacteria causing pneumonia: Mycobacterium spp. (Bruijnesteijn van Coppenraet et al., 2004), Pneumocystis jirovecii (Linssen et al., 2006), Mycoplasma species (Cohen-Bacrie et al., 2011), Mycoplasma pneumonia and finally, M. hominis using a homemade qPCR based on the newly designed primers targeting the 16S rRNA gene of M. hominis: Mhom_16S_F_GCTGTTATAAGGGAAGAACATTTGC, Mhom_16S_R_GGCACATAGTTAGCCATCGC and the hydrolysis TaqMan® probe Mhom_16S_P_6FAM- AAATGATTGCAGACTGACGGTACCTTGTCAG.

Bacterial isolation was carried out by inoculating three pieces from the lung tissue into Columbia agar medium supplemented with 5% sheep blood (bioMérieux, Marcy l’Etoile, France). The culture was carried out for 24 hours at 37°C. Once isolated, bacterial colonies were subjected individually to MALDI-TOF MS identification as previously described (Seng et al., 2009). Subsequently, genomic DNA was extracted from each bacterial colony using the EZ1 DNA tissue kit (Qiagen, Courtaboeuf, France) and subjected to the 16S sequencing (Weisburg et al., 1991). Species resolution was carried out using BLASTn analysis (Altschul et al., 1990).

Molecular phylogenetic analysis was conducted essentially for bacterial strains identified as the most likely species to be involved in pneumonia. Multiple alignments against the homologous GenBank sequences was conducted using multiple alignment using fast Fourier transform (MAFFT) (Katoh et al., 2002). The Best fit model and maximum likelihood phylogeny were conducted on MEGA 6 (Tamura et al., 2013). Phylogram was edited using iTOL v4 software (Letunic et al., 2019). Additionally, the interspecific nucleotide pairwise distance (NPD) was evaluated to estimate the genetic divergence between the bacterial strains we isolated herein and those from the GenBank database using MEGA 6 (Tamura et al., 2013).

Finally, this bacterium was subjected to the antimicrobial susceptibility test according to the European Committee on Antimicrobial Susceptibility Testing.

See SI Materials and Methods for complete details on the materials and methods.

The necropsy examination revealed that the cause of death was due to severe brain injury caused by a round run. Furthermore, the necropsy revealed generalized granulomatous pneumonia lesions. Granulomas appeared to be consistently hard and whitish with up to 2 mm in diameter and were distributed throughout all the lung tissues (Fig. 1). On the liver, we observed multiple small nodules composed of whitish fibrosis, suggesting C. hepaticum parasitism. Finally, few necrosis foci were observed in the kidneys.

Fig. 1. Necropsy examination of the rat corpse showing the thoracic and abdominal viscera. Arrowed lesions indicate whitish colored nodules distributed throughout the lung (yellow arrows) and liver (green arrows) parenchyma.

Fig. 1.

Open in a new tab

Histological analysis of the lung tissues revealed the presence of several fibro-inflammatory areas of up 2 mm in diameter (Fig. 2a). These foci were dominated by the presence of a hyaline fibrous scar containing inflammatory cells, mainly epithelioid macrophages with a rim of lymphocytes (Fig. 2b). We also noted a small number of multinucleated giant cells (MGC) in these lesions. However, central necrosis and bacteria were not present (Fig. 2c).

Fig. 2. Hematoxylin eosin saffron staining of the lung section examined at 20× (a), 80× (b), and 150× (c) magnifications showing the histopathological aspect of the lung. (a and b) Lesions containing mononuclear inflammatory cells (green arrows) surrounded by fibrous tissue (red arrows). (c) Pulmonary granuloma with MGC (red arrows).

Fig. 2.

Open in a new tab

Additionally, the lung tissue showed the foci of inflammatory cells with a patchy distribution, and the alveoli filled mainly with lymphocytes and alveolar macrophages (Fig. 3a). Arterial vessels were surrounded by chronic inflammatory cells (Fig. 3b).

Fig. 3. Hematoxylin eosin saffron staining of the lung section examined at 300× magnification. (a) Dense inflammatory infiltrate composed of lymphocytes (red arrow) and alveolar macrophages (green arrow). (b) Alveolar inflammatory infiltrates around an arterial vessel (red arrow).

Fig. 3.

Open in a new tab

Accordingly, the histologic analysis of the whitish hepatic nodules confirmed the presence of the parasitic nematode C. hepaticum (formerly known as Capillaria hepatica; Trichocephalida, Capillariidae). Nematode eggs were visualized in great number surrounding the fibrous tissue. These hepatic nodules measured 0.5–2 mm in diameter and were distributed under the hepatic capsule inside the parenchyma.

All lung tissue samples were qPCR negative for Mycobacterium spp., Mycoplasma spp., M. pneumoniae, M. hominis, and P. jirovecii.

Bacterial growth was observed among all the inoculated lung tissues on the agar medium at 37°C. MALDI-TOF MS and 16S sequencing yielded the identification of at least ten bacterial colonies (Table 1).

Table 1. MALDI-TOF MS and 16S rRNA identifications of isolated colonies.

Isolate MALDI-TOF MS 16 sequencing
Colony Id. Species name Accession no. Species name Identity (%)
RMC 1 S. cohnii HG941657 S. cohnii 99.9
RMC 2 Unidentified KX858113 R. rarus 99.04
RMC 3 B. bronchiseptica E03742/CP052851 B. bronchiseptica/B. parapertussis 100
RMC 4 Bordetella holnesii CP018899 B. holnesii 99.5
RMC 5 Corynebacterium glucuronolyticum AJ277970 C. glucuronolyticum 100
RMC 6 Unidentified E03742/CP052851 B. bronchiseptica/B. parapertussis 100
RMC 7 Unidentified E03742/CP052851 B. bronchiseptica/B. parapertussis 100
RMC 8 Unidentified NR_145928 strain (3340-03) P. suis 99.16
RMC 9 Unidentified P. suis 99.16
RMC 10 Unidentified NR156996 R. rarus 99.02
Open in a new tab

Phylogenetic analysis of the 16S sequences (Fig. 4) showed that the bacterial strain of R. rarus from the colony RMC2 was clustered together with R. rarus strains (NR156996 and AY362902) and the other Rodentibacter species isolated from rats (R. mrazii, R. ratti, R. heidelbergensis and R. trehalosifermentans). This group of rat-associated Rodentibacter formed a monophyletic clade with mouse-associated Rodentibacter (R. pneumotropicus and R. heylii). Similarly, the lowest (0.002; 0.003) NPD of R. rarus (RMC2) herein we isolated was observed with R. rarus strains.

Fig. 4. Phylogenetic tree showing the position of R. rarus strain isolated in the present study (indicated in red) among the representative members of the Pasteurellacea family. The tree was inferred using the Maximum Likelihood method based on 1000 bootstraps and the Kimura 2-parameter model. The analysis involved 39 nearly complete (1409) 16S rRNA sequences. Outgroup taxons Escherichia coli (CP061914) are drawn at the root. A discrete Gamma distribution was used to model evolutionary rate differences among sites [five categories (+G. parameter = 0.2834)]. The rate variation model allowed for some sites to be evolutionarily invariable [(+I). 59.6971% sites]. Log likelihood was −6,365.9530. The axis showed the global distance observed throughout the trees. The value above branches indicates branch length. Branches are color-coded according to the bootstrap’s percent. The identity of each taxon is color-coded according to the genus. GenBank accession numbers, strain name, and isolation source are indicated at each node. The number of base substitutions per site from between the R. rarus strain isolated in the present study and the GenBank strains is shown. Standard error estimate(s) are shown in the last column. Analyses were conducted using the Maximum Composite Likelihood model in MEGA 6. All ambiguous positions were removed for each sequence pair (pairwise deletion option).

Fig. 4.

Open in a new tab

Rodentibacter rarus was considered here as the most likely etiological agent of rat-pneumonia. The 16S sequence of R. rarus strain RMC2 was deposited in the GenBank database under MT860347, while the bacterial isolate was deposited in the strain collection (Collection de Souches de l’Unité des Rickettsies WDCM 875) under accession number Q4538.

Rodentibacter rarus RMC2 strain was sensitive for all tested antibiotics except for ciprofloxacin against which the bacteria showed a resistance expressed by 22 mm disk diameter (Table 2).

Table 2. Detailed results of the antimicrobial susceptibility testing of R. rarus strain MRC2.

Abbreviation Antibiotic Concentration (μg/ml) Ø (mm) S/R
TIC Ticarcillin 75 40.5 S
TCC Ticarcillin/Clavulanic acid 10 40.4 S
TPZ Piperacillin/Tazobactam 36 38.5 S
ATM Aztreonam 40 39.8 S
CAZ Ceftazidime 30 33.4 S
FEP Cefepime 30 43.2 S
MER Meropenem 10 34.5 S
IPM Imipenem 10 36.3 S
FF Fosfomycin 200 41.3 S
RA Rifampicin 300 27.8 S
SXT Trimethoprim/Sulfamethoxazole 25 39.4 S
AK Amikacin 30 20.2 S
CIP Ciprofloxacin 5 22 R
DO Doxycycline 30 29 S
CT Colistin 50 25.2 S
CN Gentamicin 15 29 S
Open in a new tab

S = Sensitive; R = Resistant.

Discussion

We describe here the histopathological lesions in bacterial pneumonia potentially caused by R. rarus in a street rat. The necropsy examination revealed an unexpected lung lesion never encountered in previous studies (Davoust et al., 1997; Boni et al., 1997; Gundi et al., 2004; Socolovschi et al., 2011). Since the infection is natural, which could involve several potential pathogens, we used the experiential avoidance approach relying on the full exploration of pathogens following a one-by-one elimination of the detected microorganisms according to their known pathological status, if it had been already described.

In the present study, we searched for the possible bacterial agent that could be involved in rat pneumonia, while no search for viruses has been undertaken. According to the histopathological lesions and literature, no virus is known to induce such lesions in rats (Rothenburger et al., 2015; Kling, 2011). Therefore, the extension of the granulomatous lesions to almost all the pulmonary lobes supported the exclusion of parasitic origin.

Pneumocystis jirovecii infection was, however, investigated. Since the PCR was negative and pathological analysis did not reveal any cystic forms in the pulmonary alveoli, this etiology was discarded. P. carinii has been consistently identified as a causative agent in the pneumonia of wild brown rats co-infected with M. pulmonis (Rothenburger et al., 2015). Mycoplasma pulmonis is the most common cause of bronchopneumonia in rats (Kling, 2011) and causes purulent pneumonia, not granulomatous. Our macroscopic and histological observations were not in favor of this diagnosis, and it was further excluded by the mycoplasma-negative PCR. In this study, neither P. carinii, Mycoplasma pneumoniae nor M. hominis were detected.

On the other hand, the importance of the fibrosis inside the granulomas suggested an old bacterial infection that is not in favor of mycobacteriosis that causes granulomatous inflammatory reactions, forming both caseating and noncaseating granulomas. Therefore, the presence of mycobacterial infections was also excluded by both PCR and Ziehl–Neelsen staining.

Thanks to the bacterial culture, followed by MALDI-TOF MS and 16S sequencing, we initially identified four bacterial strains (Staphylococcus cohnii, Pelistega suis, Bordetella parapertussis, and R. rarus) that could be the potential cause of this pneumonia.

Staphylococcus cohnii is a coagulase-negative staphylococci bacterium colonizing skin and mucous membranes of humans, farm, and companion animals (Mendoza-Olazarán et al., 2017). It may have been the cause of a few cases of nosocomial infections (Hu et al., 2014). In rats, staphylococci infections cause skin abscesses but never pneumonia (Heilmann et al., 2019). Exceptionally, this bacterium was found to be transmitted by rat bite in one of 40 rats studied (Himsworth et al., 2014c). With regard to other coagulase-negative staphylococci, S. cohnii is frequently detected as contaminants of microbiological cultures from clinical specimens (Mendoza-Olazarán et al., 2017).

Pelistega suis was initially isolated from the tonsils swab samples of pigs and wild boars (Vela et al., 2015). However, there is no reported data on its pneumonic pathogenicity neither in their type of hosts nor in rats, While B. parapertussis is the agent of a mild form of whooping cough (20% of the cases), a highly contagious disease of the upper respiratory tract in humans. The involvement of this bacterium in rat pneumonia remains completely avoided since humans are the only known reservoir and there were no available data from rodent hosts (Guiso, 2015). On the contrary, Bordetella bronchiseptica causes respiratory infections in many different mammals, including mice, rats, rabbits, cats, dogs, ferrets, foxes, pigs, hedgehogs, sheep, horses, and, occasionally, humans (Mattoo and Cherry, 2005). Bordetella bronchiseptica causes in rats multifocal bronchopneumonia with polymorphonuclear cell and lymphocytic infiltration with peribronchial lymphoid hyperplasia as revealed in the microscopic examination (Kling, 2011). However, B. bronchiseptica infection could not be confirmed in this study, since the clear-cut distinction between B. bronchiseptica and B. parapertussis was not possible by the 16S sequencing. Therefore, the histopathological lesions were not in favor of B. bronchiseptica infection.

Finally, R. rarus is one of the frequent Pasteurellales agents of rats. Phylogenetic characterization revealed its placement with rat-associated Rodentibacter species. These species were also monophyletic with the known virulent strains of rat and mouse-associated Rodentibacter. Furthermore, R. rarus was close to R. pneumotropica, the agent of rodent pneumonia and septicemia (Frebourg et al., 2002).

The genome-based description of R. rarus was recently made on the type of species of R. rarus (CCUG number: 17206, DSM number: 103980, NCBI: txid1908260) (Adhikary et al., 2017), initially isolated from a rat in Denmark and later from the mouse as the reference strain of taxon 17 of Bisgaard (1993). Despite the low host specificity of the Rodentibacter species, the phylogenetic analysis we conducted herein revealed that rat and mouse-associated Rodentibacter are grouped according to their hosts. Therefore, we confirm the previous phenotypic characterization of the Rodentibacter species (Adhikary et al., 2017).

The problem in rodent Pasteurellaceae infections is evident. Since the latest molecular-based reclassifications, there is an emergence of several Rodentibacter species from Pasteurella species, and the clear-cut identification of the etiological agent of the Pasteurellales diseases is difficult. Although the investigation conducted by Hayashimoto in 2008 on the pathological effect of different P. pneumotropica strains revealed that pulmonary lesions were observed within P. pneumotropica ATCC 35149 and CNP 160 strains. However, the possibility that these strains are one of the Rodentibacter variants could not be ruled out in the absence of molecular data (Hayashimoto et al., 2008). Rodents are the main hosts of Rodentibacter bacteria causing pneumonia. Usually, immunocompetent rodents are asymptomatic carriers. Experimental infections of severe combined immunodeficient (SCID) mice cause the appearance of pneumonia lesions (Sasaki et al., 2018). Another study showed that a highly virulent strain of R. pneumotropicus causes severe pneumonia and septicemia after intranasal infection of C57BL/6 and BALB/c mice (Fornefett et al., 2018). Alveoli and bronchioles of this mouse were infiltrated with a high number of neutrophils. Rodentibacter pneumotropicus is best known in laboratory rodents (rat and mouse) as an opportunistic microbe that can seriously affect the health of rodents and thus disrupt experiments (Benga et al., 2018).

So far, data on the pathogenicity of R. rarus in rodents are lacking and have never been studied in other hosts. Here, we report the first isolation of a pathogenic strain of R. rarus from a street rat. The bacterium was genetically close to rat-associated Rodentibacter with a close relatedness to the virulent strain of R. pneumotropicus.

Conclusion

From all the results, the clear-cut distinction between the opportunistic or the strictly virulent character of R. rarus we isolated herein cannot be ruled out yet. Further investigation on the virulence of this strain is needed. Obviously, our results need to be confirmed or disproved by an experimental model of R. rarus infections for the purpose of health monitoring of laboratory rodents (Otto and Myles, 2020; Fingas et al., 2019). Our initial work on the detection of pathogenic microorganisms in brown rats must be part of our ongoing efforts to inform health authorities about the risks these animals may present. Moreover, this case of pneumonia associated with R. rarus is of great importance as it concerns a species of commensal rodent living in the vicinity of other animals (dogs, cats, and birds) and humans. The World Health Organization is working to bring together experts in the control of rodent commensal reservoirs and potential vectors of zoonoses and to publish recommendations (Colombe et al., 2019).

Acknowledgments

The authors thank Lola Castinel for their technical assistance.

Funding information

This study was supported by the IHU Méditerranée Infection, the National Research Agency under the program “Investissements d’avenir” (reference ANR-10-IAHU-03), the Région Provence-Alpes-Côte d’Azur, and European funding FEDER PRIMI.

Conflicts of interest

The authors declare that there is no conflict of interest.

Authors’ contribution

Conceptualization: BD; formal analysis and investigation: HM, YL, BS, HL, and HD; writing and original draft preparation: BD, HM, YL, and HD; writing review: BD and HM; supervision: OM and BD. All authors read and approved the published version of the manuscript.

References

  1. Adhikary S, Nicklas W, Bisgaard M, Boot R, Kuhnert P, Waberschek T, Aalbæk B, Korczak B, Christensen H. Rodentibacter gen. nov. including Rodentibacter pneumotropicus comb. nov., Rodentibacter heylii sp. nov., Rodentibacter myodis sp. nov., Rodentibacter ratti sp. nov., Rodentibacter heidelbergensis sp. nov., Rodentibacter trehalosifermentans sp. nov., Rodentibacter rarus sp. nov., Rodentibacter mrazii and two genomospecies. Int. J. Syst. Evol. Microbiol. 2017;67:1793–1806. doi: 10.1099/ijsem.0.001866. [DOI] [PubMed] [Google Scholar]
  2. Altschul S.F, Gish W, Miller W, Myers E.W, Lipman D.J. Basic local alignment search tool. J. Mol. Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  3. Benga L, Sager M, Christensen H. From the [Pasteurella] pneumotropica complex to Rodentibacter spp.: an update on [Pasteurella] pneumotropica. Vet. Microbiol. 2018;217:121–134. doi: 10.1016/j.vetmic.2018.03.011. [DOI] [PubMed] [Google Scholar]
  4. Bisgaard M. Ecology and significance of Pasteurellaceae in animals. Zentralbl. Bakteriol. 1993;279:7–26. doi: 10.1016/s0934-8840(11)80487-1. [DOI] [PubMed] [Google Scholar]
  5. Boni M, Davoust B, Drancourt M, Louis F.J, André-Fontaine G, Jouan A, Parzy D, Birtles R. Rats et chats errants: enquête épidémiologique en milieu urbain. Bull. Soc. Vet. Prat. de France. 1997;81:441–457. [Google Scholar]
  6. Boot R, Bisgaard M. Reclassification of 30 Pasteurellaceae strains isolated from rodents. Lab. Anim. 1995;29:314–319. doi: 10.1258/002367795781088342. [DOI] [PubMed] [Google Scholar]
  7. Bruijnesteijn van Coppenraet E.S, Lindeboom J.A, Prins J.M, Peeters M.F, Claas E.C.J, Kuijper E.J. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children. J. Clin. Microbiol. 2004;42:2644–2650. doi: 10.1128/JCM.42.6.2644-2650.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cohen-Bacrie S, Ninove L, Nougairède A, Charrel R, Richet H, Minodier P, Badiaga S, Noël G, La Scola B, de Lamballerie X, Drancourt M, Raoult D. Revolutionizing clinical microbiology laboratory organization in hospitals with in situ point-of-care. PLoS One. 2011;6:e22403. doi: 10.1371/journal.pone.0022403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Colombe S, Jancloes M, Riviere A, Bertherat E. A new approach to rodent control to better protect human health: first international meeting of experts under the auspices of WHO and the Pan American Health Organization. Wkly. Epidemiol. Rec. 2019;17:197–203. [Google Scholar]
  10. Dafni H, Greenfeld L, Oren R, Harmelin A. The likelihood of misidentifying rodent Pasteurellaceae by using results from a single PCR assay. J. Am. Assoc. Lab. Anim. Sci. 2019;58(2):201–207. doi: 10.30802/AALAS-JAALAS-18-000049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Davoust B, Boni M, Branquet D, Ducos de Lahitte J, Martet G. Recherche de trois infestations parasitaires chez des rats capturés à Marseille: évaluation du risque zoonosique. Bull. Acad. Natle Med. 1997;181:887–897. [PubMed] [Google Scholar]
  12. Desvars-Larrive A, Pascal M, Gasqui P, Cosson J.F, Benoît E, Lattard V, Crespin L, Lorvelec O, Pisanu B, Teynié A, Vayssier-Taussat M, Bonnet S, Marianneau P, Lacôte S, Bourhy P, Berny P, Pavio N, Le Poder S, Gilot-Fromont E, Jourdain E, Hammed A, Fourel I, Chikh F, Vourc'h G. Population genetics, community of parasites, and resistance to rodenticides in an urban brown rat (Rattus norvegicus) population. PLoS One. 2017;12:e0184015. doi: 10.1371/journal.pone.0184015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fingas F, Volke D, Hassert R, Fornefett J, Funk S, Baums C.G, Hoffmann R. Sensitive and immunogen-specific serological detection of Rodentibacter pneumotropicus infections in mice. BMC Microbiol. 2019;19:43. doi: 10.1186/s12866-019-1417-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fornefett J, Krause J, Klose K, Fingas F, Hassert R, Benga L, Grunwald T, Müller U, Schrödl W, Baums C.G. Comparative analysis of humoral immune responses and pathologies of BALB/c and C57BL/6 wildtype mice experimentally infected with a highly virulent Rodentibacter pneumotropicus (Pasteurella pneumotropica) strain. BMC Microbiol. 2018;18:45. doi: 10.1186/s12866-018-1186-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Frebourg N.B, Berthelot G, Hocq R, Chibani A, Lemeland J.F. Septicemia due to Pasteurella pneumotropica: 16S rRNA sequencing for diagnosis confirmation. J. Clin. Microbiol. 2002;40:687–689. doi: 10.1128/JCM.40.2.687-689.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Guiso N. Bordetella pertussis. In: Tang, Sussman, et al., editors. Molecular medical microbiology. 2nd. Cambridge: USA; 2015. pp. 1507–1527. 3. [Google Scholar]
  17. Gundi V.K.B, Davoust B, Khamis A, Raoult D, La Scola B. Bartonella phoceensis sp. nov. from European Rattus norvegicus. J. Clin. Microbiol. 2004;42(8):3816–3818. doi: 10.1128/JCM.42.8.3816-3818.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hayashimoto N, Yasuda M, Ueno M, Goto K, Takakura A. Experimental infection studies of Pasteurella pneumotropica and V-factor dependent Pasteurellaceae for F344-rnu rats. Exp. Anim. 2008;57:57–63. doi: 10.1538/expanim.57.57. [DOI] [PubMed] [Google Scholar]
  19. Heilmann C, Ziebuhr W, Becker K. Are coagulase-negative staphylococci virulent? Clin. Microbiol. Infect. 2019;25:1071–1080. doi: 10.1016/j.cmi.2018.11.012. [DOI] [PubMed] [Google Scholar]
  20. Henriksen S.D. Some Pasteurella stains from the human respiratory tract. A correction and supplement. Acta Pathol. Microbiol. Immunol. Scand. 1962;55:355–356. doi: 10.1111/j.1699-0463.1962.tb04136.x. [DOI] [PubMed] [Google Scholar]
  21. Herbreteau V, Jittapalapong S, Rerkamnuaychoke W, Chaval Y, Morand S. Retrieved from CERoPath project. Bangkok, Thailand: Kasetsart University Press; 2011. Protocols for field and laboratory rodent studies; p. 46. [Google Scholar]
  22. Himsworth C.G, Jardine C.M, Parsons K.L, Feng A.Y, Patrick D.M. The characteristics of wild rat (Rattus spp.) populations from an inner-city neighborhood with a focus on factors critical to the understanding of rat-associated zoonoses. PLoS One. 2014a;9:e91654. doi: 10.1371/journal.pone.0091654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Himsworth C.G, Parsons K.L, Feng A.Y.T, Kerr T, Jardine C.M, Patrick D.M. A mixed methods approach to exploring the relationship between Norway rat (Rattus norvegicus) abundance and features of the urban environment in an inner-city neighborhood of Vancouver, Canada. PLoS One. 2014b;9(5):e97776. doi: 10.1371/journal.pone.0097776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Himsworth C.G, Parsons K.L, Jardine C, Patrick D.M. Rats, cities, people, and pathogens: A systematic review and narrative synthesis of literature regarding the ecology of rat-associated zoonoses in urban centers. Vector-Borne Zoonotic Dis. 2013;13:349–359. doi: 10.1089/vbz.2012.1195. [DOI] [PubMed] [Google Scholar]
  25. Himsworth C.G, Zabek E, Tang P, Parsons K.L, Koehn M, Jardine C.M, Patrick D.M. Bacteria isolated from conspecific bite wounds in Norway and black rats: implications for rat bite-associated infections in people. Vector Borne Zoonotic Dis. 2014c;14(2):94–100. doi: 10.1089/vbz.2013.1417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hu X, Li A, Lv L, Yuan C, Guo L, Jiang X, Jiang H, Qian G, Zheng B, Guo J, Li L. High quality draft genome sequence of Staphylococcus cohnii subsp. cohnii strain hu-01. Stand. Genomic. Sci. 2014;9:755–762. doi: 10.4056/sigs.5429581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Itoh N, Kurai H. A case of Pasteurella multocida pneumonia needed to differentiate from non-tuberculous mycobacteriosis. IDCases. 2018;12:136–139. doi: 10.1016/j.idcr.2018.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jawetz E. A pneumotropic pasteurella of laboratory animals; bacteriological and serological characteristics of the organism. J. Infect. Dis. 1950;86:172–183. doi: 10.1093/infdis/86.2.172. [DOI] [PubMed] [Google Scholar]
  29. Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30(14):3059–3066. doi: 10.1093/nar/gkf436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kawamoto E, Sasaki H, Okiyama E, Kanai T, Ueshiba H, Ohnishi N, Sawada T, Hayashimoto N, Takakura A, Itoh T. Pathogenicity of Pasteurella pneumotropica in immunodeficient NOD/ShiJic-scid/Jcl and immunocompetent Crlj:CD1 (ICR) mice. Exp. Anim. 2011;60:463–470. doi: 10.1538/expanim.60.463. [DOI] [PubMed] [Google Scholar]
  31. Kling M.A. A review of respiratory system anatomy, physiology, and disease in the mouse, rat, hamster, and gerbil. Vet. Clin. North Am. Exot. Anim. Pract. 2011;14:287–337. doi: 10.1016/j.cvex.2011.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Letunic I, Bork P. Interactive Tree of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. 2019;47(W1):256–259. doi: 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Linssen C, Jacobs J, Beckers P, Templeton K, Bakkers J, Kuijper E, Melchers W, Drent M, Vink C. Inter-laboratory comparison of three different real-time PCR assays for the detection of Pneumocystis jiroveci in bronchoalveolar lavage fluid samples. J. Med. Microbiol. 2006;55:1229–1235. doi: 10.1099/jmm.0.46552-0. [DOI] [PubMed] [Google Scholar]
  34. Mähler Convenor M, Berard M, Feinstein R, Gallagher A, Illgen-Wilcke B, Pritchett-Corning K, Raspa M. FELASA (Federation of European Laboratory Animal Science Associations Working Group on Health Monitoring of Rodent and Rabbit Colonies) recommendations for the health monitoring of mouse, rat, hamster, guinea pig and rabbit colonies in breeding and experimental units. Lab. Anim. 2014;48(3):178–192. doi: 10.1177/0023677213516312. [DOI] [PubMed] [Google Scholar]
  35. Mattoo S, Cherry J.D. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin. Microbiol. Rev. 2005;18:326–382. doi: 10.1128/CMR.18.2.326-382.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mendoza-Olazarán S, Garcia-Mazcorro J.F, Morfín-Otero R, Villarreal-Treviño L, Camacho-Ortiz A, Rodríguez-Noriega E, Bocanegra-Ibarias P, Maldonado-Garza H.J, Dowd S.E, Garza-González E. Draft genome sequences of two opportunistic pathogenic strains of Staphylococcus cohnii isolated from human patients. Stand. Genomic Sci. 2017;12:49. doi: 10.1186/s40793-017-0263-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nicklas W, Baneux P, Boot R, Decelle T, Deeny A.A, Fumanelli M, Illgen-Wilcke B. FELASA (Federation of European Laboratory Animal Science Associations Working Group on Health Monitoring of Rodent and Rabbit Colonies). Recommendations for the health monitoring of rodent and rabbit colonies in breeding and experimental units. Lab. Anim. 2002;36(1):20–42. doi: 10.1258/0023677021911740. [DOI] [PubMed] [Google Scholar]
  38. Otto G.M, Myles M.H. The laboratory rat. 3nd. Cambridge, USA: Academic Press; 2020. Medical management and diagnostic approaches; pp. 547–564. [Google Scholar]
  39. Rothenburger J.L, Himsworth C.G, Clifford C.B, Ellis J, Treuting P.M, Leighton F.A. Respiratory pathology and pathogens in wild urban rats (Rattus norvegicus and Rattus rattus) Vet. Pathol. 2015;52:1210–1219. doi: 10.1177/0300985815593123. [DOI] [PubMed] [Google Scholar]
  40. Rothenburger J.L, Himsworth C.G, La Perle K.M.D, Leighton F.A, Nemeth N.M, Treuting P.M, Jardine C.M. Pathology of wild Norway rats in Vancouver, Canada. J. Vet. Diagn. Invest. 2019;31:184–199. doi: 10.1177/1040638719833436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sasaki H, Ueshiba H, Kanai T, Kawamoto E. Experimental infection of immunodeficient and immunocompetent mice with Rodentibacter pneumotropicus. Contrib. Microbiol. 2018;10:22. http://www.avidscience.com . [Google Scholar]
  42. Schweinfurth M.K. The social life of Norway rats (Rattus norvegicus) Elife. 2020;9:e54020. doi: 10.7554/eLife.54020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Seng P, Drancourt M, Gouriet F, La Scola B, Fournier P.E, Rolain J.M, Raoult D. Ongoing revolution in bacteriology: routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin. Infect. Dis. 2009;49(4):543–551. doi: 10.1086/600885. [DOI] [PubMed] [Google Scholar]
  44. Socolovschi C, Angelakis E, Renvoisé A, Fournier P.E, Marié J.L, Davoust B, Stein A, Raoult D. Strikes, flooding, rats, and leptospirosis in Marseille, France. Int. J. Infect. Dis. 2011;15(10):e710–e715. doi: 10.1016/j.ijid.2011.05.017. [DOI] [PubMed] [Google Scholar]
  45. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013;30(12):2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vela A.I, Sancho M.P, Domínguez L, Busse H.J, Fernández-Garayzábal J.F. Pelistega suis sp. Nov., isolated from domestic and wild animals. Int. J. Syst. Evol. Microbiol. 2015;65:4909–4914. doi: 10.1099/ijsem.0.000673. [DOI] [PubMed] [Google Scholar]
  47. Weisburg W.G, Barns S.M, Pelletier D.A, Lane D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991;173(2):697–703. doi: 10.1128/jb.173.2.697-703.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wilson B.A, Ho M. Pasteurella multocida: from zoonosis to cellular microbiology. Clin. Microbiol. Rev. 2013;26:631–655. doi: 10.1128/CMR.00024-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Open Veterinary Journal are provided here courtesy of Faculty of Veterinary Medicine, University of Tripoli

RESOURCES