Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2021 Mar 29;17(3):e1009466. doi: 10.1371/journal.pgen.1009466

activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis

Jennifer K Cloutier 1,2,3,4, Conor L McMann 1,2,3, Isaac M Oderberg 1,2,3, Peter W Reddien 1,2,3,*
Editor: A Aziz Aboobaker5
PMCID: PMC8057570  PMID: 33780442

Abstract

Planarians are flatworms and can perform whole-body regeneration. This ability involves a mechanism to distinguish between anterior-facing wounds that require head regeneration and posterior-facing wounds that require tail regeneration. How this head-tail regeneration polarity decision is made is studied to identify principles underlying tissue-identity specification in regeneration. We report that inhibition of activin-2, which encodes an Activin-like signaling ligand, resulted in the regeneration of ectopic posterior-facing heads following amputation. During tissue turnover in uninjured planarians, positional information is constitutively expressed in muscle to maintain proper patterning. Positional information includes Wnts expressed in the posterior and Wnt antagonists expressed in the anterior. Upon amputation, several wound-induced genes promote re-establishment of positional information. The head-versus-tail regeneration decision involves preferential wound induction of the Wnt antagonist notum at anterior-facing over posterior-facing wounds. Asymmetric activation of notum represents the earliest known molecular distinction between head and tail regeneration, yet how it occurs is unknown. activin-2 RNAi animals displayed symmetric wound-induced activation of notum at anterior- and posterior-facing wounds, providing a molecular explanation for their ectopic posterior-head phenotype. activin-2 RNAi animals also displayed anterior-posterior (AP) axis splitting, with two heads appearing in anterior blastemas, and various combinations of heads and tails appearing in posterior blastemas. This was associated with ectopic nucleation of anterior poles, which are head-tip muscle cells that facilitate AP and medial-lateral (ML) pattern at posterior-facing wounds. These findings reveal a role for Activin signaling in determining the outcome of AP-axis-patterning events that are specific to regeneration.

Author summary

A central problem in animal regeneration is how animals determine what body part to regenerate. Planarians are flatworms that can regenerate any missing body region, and are studied to identify mechanisms underlying regeneration. At transverse amputation planes, a poorly understood mechanism specifies regeneration of either a head or a tail. This head-versus-tail regeneration decision-making process is referred to as regeneration polarity and has been studied for over a century to identify mechanisms that specify what to regenerate. The gene notum, which encodes a Wnt antagonist, is induced within hours after injury preferentially at anterior-facing wounds, where it specifies head regeneration. We report that Activin signaling is required for regeneration polarity, and the underlying asymmetric activation of notum at anterior- over posterior-facing wounds. We propose that Activin signaling is involved in regeneration-specific responses broadly in the animal kingdom.

Introduction

The planarian Schmidtea mediterranea is a powerful model for the study of whole-body regeneration. In many planarian species a single animal can be cut into multiple small fragments, which can each regenerate a complete animal within a matter of weeks [1,2]. Planarian regeneration involves new cell production from a population of stem cells called neoblasts. Neoblasts produce all new cell types in planarian regeneration and also allow extensive tissue turnover in uninjured animals [3]. Planarian tissue patterning requires the regionalized expression of numerous signaling ligands and their pathway components [3]. Many such genes are termed position control genes (PCGs) and are defined by displaying constitutive regional expression and a patterning RNAi phenotype, or association with a planarian-patterning pathway. PCGs are predominantly expressed in planarian muscle [4].

The distribution of tissues on the planarian anterior-posterior (AP) axis and the head-versus-tail regeneration decision at transverse amputation planes prominently involve Wnt signaling [518]. A Wnt expression and activity gradient exists along the planarian AP axis, with the anterior being Wnt-signaling low and the posterior being Wnt-signaling high [518]. Multiple planarian wnt family genes are considered PCGs and are predominantly expressed in muscle [4]. Inhibition of the Wnt pathway, such as with β-catenin-1 RNAi, causes regeneration of posterior-facing heads [57]. β-catenin-1 RNAi during tissue turnover causes ectopic anterior PCG expression in the posterior and loss of posterior PCG expression, resulting in ectopic head formation [57,10,13,15,16,18].

Regeneration following transverse amputation of the (AP) axis requires a mechanism to specify formation of a head or a tail at the amputation plane–this determination is made within hours following amputation and involves wound signaling [9,10,12,19]. Wounds generically induce the transcription of ~200+ genes [19,20]. wnt1 is activated at all wounds and promotes tail regeneration at posterior-facing wounds. The gene notum is unique among wound-induced genes in that it is preferentially induced at anterior-facing wounds [12,19]. notum encodes a broadly conserved Wnt deacylase that inhibits Wnt signaling [21], and is required for the regeneration of a head instead of a tail at anterior-facing wounds [12]. The activation of these two genes results in a Wnt-inhibited anterior-facing wound for head regeneration and a Wnt-active posterior-facing wound for tail regeneration. Wound-induced notum expression occurs specifically in preexisting longitudinal muscle fibers, which are oriented along the AP axis [22]. After this wound-induced phase of notum expression, other anterior PCGs are expressed in muscle and progenitors for the anterior pole are specified. The anterior pole is a signaling center [2326] comprised of muscle cells generated from neoblasts during regeneration [2325], and the anterior pole also expresses notum [12]. Thus the two phases of notum expression in head regeneration involve distinct cells; i.e., the wound-induced notum+ cells do not directly form the anterior pole [12,23,25]. The asymmetric wound induction of notum is the earliest known difference in gene expression that exists between wounds that go on to make a head instead of a tail [12,19]. This step is therefore central to regeneration, yet, how the asymmetric activation of notum at anterior-versus-posterior-facing wounds is accomplished is unknown.

Additional wound-induced genes have roles in determining the outcome of planarian regeneration [9,2729]. follistatin is activated at planarian wounds and is required for a set of cellular and molecular responses collectively referred to as the missing tissue response [27,28,30]. The missing tissue response involves cell proliferation at the wound, a body-wide increase in cell death, and sustained expression of wound-induced genes. follistatin is also required for regeneration of anterior PCG expression domains and head regeneration [27,28,30], but only when amputations are made in a Wnt-high environment (i.e., transverse amputation in the trunk and tail) [30]. follistatin RNAi leads to the upregulation of wound-induced wnt1 at 6 hours post amputation (hpa)–higher wound-induced wnt1 levels in an already high Wnt environment are proposed to block the ability of notum to generate a Wnt-low environment for head regeneration at anterior-facing wounds [30]. Follistatin is a broadly conserved negative regulator of Activin/Myostatin signaling ligands [3134], and the follistatin RNAi head regeneration failure phenotype requires Activin signaling [27,28,30]. More specifically, the failed missing tissue response [28] and increased wound-induced wnt1 expression at wounds [30] in follistatin RNAi animals is thought to act through modulation of Activin signalling. Whereas follistatin RNAi causes upregulation of Activin signalling, the impact of downregulation of Activin is less well understood. ActR-1 (encoding an Activin receptor) RNAi can lead to ectopic pharynges [27] and some blastema splitting [35]. Activin and Follistatin have roles at wounds in multiple vertebrates [3639]. These observations raise the possibility that Activin signaling is broadly utilized in animal regeneration, a possibility that remains poorly explored. Planarians are an attractive system to continue to dissect the mechanisms by which Activin signaling regulates regeneration.

Here we report an unexpected role for Activin signaling in controlling head-versus-tail regeneration through the regulation of asymmetric wound-induced notum expression at wounds in planarians. In animals with inhibited Activin signaling, ectopic posterior-facing heads form specifically during regeneration and are associated with a loss of asymmetry in wound-induced notum expression. We conclude that Activin has an essential role in the asymmetric activation of notum and in determining the head-tail regeneration decision at transverse amputation planes during planarian whole-body regeneration.

Results

activin-2 is required for regeneration polarity and regeneration of AP-axis pattern

Planarians, as Platyhelminthes, are part of the Spiralia superphylum [40]. Genes from various spiralian species encode TGF-β-family signaling molecules, including planarian activin-1 and activin-2 [27,28,36]. Prior work indicates that some of these spiralian proteins belong to a TGF-β clade that includes vertebrate Activin and Myostatin [36]. Phylogenetic analysis places Schmidtea mediterannea Activin-2 in a clade primarily made up of Activins; however, whether this gene and other spiralian Activins are derived from an ancestral myostatin or activin gene remains unknown (S1 Fig and S1 Data). Activin and Myostatin can signal through the same TGF-β receptors [4143] and are sister groups within the TGF-β superfamily [44,45].

We inhibited the S. mediterranea activin-2 gene by feeding dsRNA for RNA interference (RNAi). RNAi of activin-2 (known as activin in [27]) was previously shown to suppress the follistatin failed regeneration RNAi phenotype [27,28]. After differing times of gene inhibition with RNAi, some animals were amputated and analyzed at time points post amputation (Fig 1A). activin-2 RNAi (S2A Fig) resulted in a novel phenotype involving both regeneration of a head at posterior-facing wounds and AP-axis bifurcations in regenerating blastemas, leading, for example, to two heads in a single anterior blastema (Fig 1B). The combined presence of these two defects resulted in variable numbers of heads and tails in fragments with both head and tail amputated (trunk fragments) (Figs 1B and S2B). At anterior-facing wounds, only heads appeared. By contrast, at posterior-facing wounds, animals regenerated a presumptive tail or combinations of heads and tails (Figs 1B and S2B).

Fig 1. activin-2 is required for regeneration polarity and regeneration of AP axis pattern.

Fig 1

(A) Schematic of RNAi experiments where the number of days on RNAi and number of days post amputation (dpa) are specified separately. (B) Regenerating activin-2 RNAi animals. Insets show magnified ectopic heads and eyes (magenta arrows). Green arrows, AP axis bifurcations; yellow arrows, ectopic pharynges. (C) FISH shows (left) CNS (chat+) and mouth and esophagus (NB.22.1e) and (right) PCG expression (midline slit+; anterior sFRP-1+) in ectopic axes. Inset: magnified view shows ectopic anterior. Yellow arrows: esophagi. (D) Quantification of posterior heads (based on presence of eyes) and axis bifurcations in regenerating animals, and ectopic pharynges seen in uninjured animals (DAPI) at 21 and 40 days after first RNAi. h is the number of posterior heads in a given animal. (E) activin-2 expression pattern by FISH, from dorsal to ventral. All images are anterior up. Scale bars, 200 μm. Numbers of representative animals are indicated on bottom left of each panel.

Ectopic posterior-facing heads in activin-2 RNAi animals contained correctly positioned head anatomy, anterior head-tip (sFRP-1) and midline (slit) PCG expression domains, and developed a mid-body pharynx with reversed polarity, indicating that fully patterned anterior body axes developed with reversed polarity (Fig 1C). activin-2 RNAi animals that did not develop ectopic heads displayed normal anatomy and PCG expression in regeneration, with the exception of ectopic posterior mouth tissue in some animals (S2C Fig). Trunk fragments were generated at early (21 days) and late (40 days) amputation time points after RNAi initiation, and were assessed for components of the activin-2 RNAi phenotype after an additional 14 days post amputation. Polarity reversals were seen at the early regeneration time point, with penetrance not increasing with further time of RNAi (Fig 1D). Axis bifurcations at 21 days of RNAi were present mainly in the posterior and were associated with posterior-facing heads. Anterior axis bifurcation increased in penetrance over time–from 3/47 at 21 days RNAi to 20/55 at 40 days of RNAi (Fig 1D).

Both uninjured and regenerating activin-2 RNAi animals displayed ectopic pharynges, mouths, and esophagi (Figs 1C and S2C–S2F). Animals were assessed for ectopic pharynges prior to amputation. At the early RNAi time point (21 days) 5/41 animals had an ectopic pharynx; at the late RNAi timepoint (40 days) 36/38 animals had an ectopic pharynx (Figs 1D and S2C–S2F). Ectopic pharynges [27] and anterior head splitting [35] have been observed in Activin receptor (ActR1, dd_3426) RNAi animals, consistent with a role for Activin signaling in regulating pharynx number and preventing axis splitting. Inhibition of other patterning genes, such as ndl-3, wntP-2, and ptk7 can cause the formation of ectopic pharynges without causing axis bifurcations or polarity reversal, indicating that ectopic pharynx formation can be separable from the latter processes [15,16]. These observations–earlier abundance of polarity reversal than pharynx duplication in activin-2 RNAi animals and the lack of polarity reversals in other RNAi phenotypes with ectopic pharynges–suggest that regeneration polarity reversal was not caused by the appearance of ectopic pharynges.

In other organisms, activin genes are expressed broadly in muscle, intestine, and at wounds [37,4648]. This broad expression pattern allows Activins to act as humoral agents signaling environmental states. In S. mediterranea, activin-2 was expressed throughout the planarian AP axis and most strongly medially (Fig 1E). This pattern stayed consistent after injury, 24 hours post amputation (S2G Fig). The medial enrichment of activin-2 expression was previously shown in a regeneration time-course of activin-2 expression [28]. activin-2 was lowly expressed in currently available whole-animal scRNA-seq datasets (S2H Fig) [49]. Muscle-specific scRNA-seq data indicates that activin-2 is expressed in nkx1.1+ circular muscle cells, as well as a cluster described as DV-like but not well characterized (S2H Fig) [50]. Expression in body wall and pharyngeal muscle, and intestine, was confirmed with FISH (S2I Fig).

activin-2 RNAi results in regeneration-specific AP-polarity patterning defects

Many planarian RNAi phenotypes that affect patterning in regeneration also affect patterning in uninjured animals undergoing tissue turnover. Uninjured activin-2 RNAi animals displayed mid-body widening associated with ectopic mouth cells, esophagi, and pharynges (Figs 2A and S3A). The aberrations to AP-axis polarity (posterior-facing heads) and AP-axis organization (duplicated heads/tails) that occurred during regeneration, however, did not occur during tissue turnover in activin-2 RNAi animals (Figs 2A–2C and S3B). This raises the possibility that the AP-axis-patterning defects of activin-2 RNAi animals reflect a requirement for activin-2 in some regeneration-specific (i.e., not essential or occurring in tissue turnover) processes.

Fig 2. Intact activin-2 RNAi animals do not show polarity defects in patterning gene expression.

Fig 2

(A) Uninjured activin-2 RNAi animals at 21 and 40 days after first RNAi feeding. Original pharynges (white arrows) and ectopic pharynx (yellow arrow) are shown. (B) FISH shows normal PCG expression and pole presence in uninjured activin-2 (act-2) RNAi animals at 21 days after first RNAi feeding. (C) Intact activin-2 RNAi animals display maintenance of anterior and posterior identity at 40 days RNAi by FISH. Bn contrast, β-catenin-1 RNAi promotes a loss of posterior identity, and ectopic anterior identity in intact animals by 10 days of RNAi. (Top) A pool of anterior restricted genes (sFRP-1, ndl-2, ndl-4, ndl-5, and wnt2), (Bottom) A pool of posteriorly expressed genes (wntP-2, wnt1, wnt11-1, and wnt11-2). All images are anterior up. Scale bars, 200 μm.

In principle, activin-2 could be required for normal expression of patterning molecules during tissue turnover, such that alteration to the AP-patterning state results in polarity defects in regeneration. We therefore sought to determine whether homeostatic PCG expression region loss or reversal might occur in activin-2 RNAi animals at 21 days of activin-2 RNAi, when regeneration polarity was affected but regeneration axis splitting and pharyngeal duplication were minimally present. Transcripts for patterning genes that are normally expressed in the anterior (ndl-5, sFRP-1), trunk (ndl-3, wntP-2, ptk-7), posterior (wnt11-1, wnt11-2, and fz-4), and poles (posterior wnt1, anterior notum) were present and in the proper relative domain order in activin-2 RNAi animals (Figs 2B and S3B). We assessed boundaries and proportions of PCG expression domains, and found no significant changes, except for a subtle change in the anterior boundary of ndl-3 expression (S3C Fig). After 40 days of activin-2 RNAi, labeling with pools of anterior and posterior PCG RNA probes demonstrated that normal AP-axis polarization remained (Fig 2C).

These findings contrast with results for other genes known to control regeneration polarity outcomes, such as β-catenin-1 [57] (Fig 2C). RNAi of β-catenin-1 causes rapid and large-scale change of PCG expression domains throughout the body. activin-2 RNAi animals were also assessed after 60 days of gene inhibition. Animals continued to widen, became less flat, and possessed large lateral bulges of tissue (S3G Fig). Tissue bulges lacked ectopic cephalic ganglia (S3H Fig). Despite body plan and muscle fiber organization changes, the relative expression positions of ndl-3 and wntP-2 expression were preserved (S3H Fig). Similarly, ectopic tissue bulges lacked ectopic expression of the anterior pole marker notum (S3I Fig). These findings suggest that Activin might control AP polarity using a mechanism that is distinct from constitutive Wnt pathway regulation and might be regeneration specific.

The midline also appeared normal at 21 days of activin-2 RNAi. However, at 40 days of RNAi, a disorganized slit+ midline was apparent (S3D Fig). Disorganization of body-wall muscle fibers was also seen only at this late time point, although body-wall muscle cell number and the overall dispersed pattern of the nuclei of these mononucleate cells was normal (S3E and S3F Fig). Midline disorganization was correlated temporally with the increase in anterior bifurcations during regeneration (Figs 1C and S3D).

activin-2 RNAi results in symmetric notum expression at wounds

The patterning defects (polarity and axis bifurcation) of activin-2 RNAi animals observed only in regeneration prompted us to assess whether regeneration-specific adult processes required activin-2. We first assessed the process of wound induction of genes involved in re-setting PCG expression domains. FISH experiments demonstrated a robust loss of asymmetry of notum activation at 18h post-amputation in activin-2 RNAi animals with high penetrance (95.4%) (Fig 3A). At this time point, there was not a significant difference in notum expression between activin-2 RNAi and control anterior-facing wounds, or between activin-2 RNAi anterior- and posterior-facing wounds (Fig 3B). This suggests that there was not a general overexpression of notum at wounds following activin-2 RNAi, but a loss of notum inhibition at posterior-facing wounds. i.e., notum expression was no longer specific to anterior-facing wounds following activin-2 RNAi.

Fig 3. activin-2 is required for asymmetric activation of notum at anterior-versus-posterior wounds.

Fig 3

(A) FISH shows loss of wound-induced notum asymmetry (polarity) in activin-2 RNAi animals at 18 hpa. (B) Cartoons show results from DESeq analyses: no significant difference between wound-induced notum expression at anterior- and posterior-facing wounds in activin-2 RNAi animals, and increased notum expression at posterior-facing wounds in activin-2 RNAi animals compared to controls at 18 hours post amputation. ns, not significant. Graph shows notum reads per million at posterior-facing wounds over time. (C) Heatmap shows expression of wound-induced genes as described [22] from bulk mRNA-seq of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post amputation, and anterior-facing wounds at 18 hours post amputation. Cartoons show the wounds described in the heatmap. (D) FISH shows no difference in muscle wound-induced gene expression between control and activin-2 RNAi animals. Magenta, anterior-facing wound; green, posterior-facing wound. All images are anterior up. Scale bars, 200 μm.

To assess whether the change in notum expression reflected a defect in the wound response, affecting many genes, we utilized RNA sequencing. RNA sequencing also allows assessment of other events occurring in regeneration after the generic wound response. We performed RNA sequencing of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post-amputation and of anterior-facing wounds at 18 hours post-amputation (S2 Data). We collected posterior-facing wounds at all time points because this is the site of ectopic notum expression, as well as anterior-facing wounds at 18 hpa to compare notum expression across wounds. No significant defect in muscle-specific gene expression was observed at the time of amputation (0 hours post-amputation) (S4A Fig). These data together with the data that muscle fibers and cell numbers were not overtly abnormal at this RNAi time point (S3E–S3F Fig) suggest that the notum expression phenotype was not caused by obvious changes to fiber number or morphology. No significant defect in the averaged expression of 128 planarian wound-induced genes occurred in activin-2 RNAi samples (Figs 3C and S4B, and S3 Data). After the generic wound response phase, a missing tissue response occurs at major injuries and is associated with an enrichment of mitotic neoblasts at wounds, which can be detected as an increase in neoblast-specific transcripts at wounds in RNA-sequencing data. This occurred normally in activin-2 RNAi animals (S4B Fig). These data indicate that the generic wound response and the missing tissue response both occurred in activin-2 RNAi animals. Furthermore, activin-2 expression itself was not detectably asymmetric at anterior- versus posterior- facing wounds both by FISH and by RNA sequencing (S4C Fig).

Although most assessed wound-induced genes were activated normally in activin-2 RNAi animals, 6/128 displayed significantly different expression (adjusted p < 0.001) at 6 and/or 18 hpa in the RNA-sequencing data (S4 Data). notum was the most robustly changed gene in this data. We used FISH to examine the expression of some of these genes and observed that they were changed according to the sequencing experiment, validating our data (S4D Fig). We also performed FISH on other previously known planarian wound-induced genes, including a subset that are activated in muscle, and saw no overt differences in expression (Figs 3D and S4E). Among genes generically activated by wounding within hours of injury, wnt1 promotes posterior identity [8,9]. However, wound-induced wnt1 expression was not detectably aberrant in activin-2 RNAi animals by FISH or RNA-seq (Fig 3D and S2 Data). Of all wound-induced genes assessed by RNA sequencing, notum displayed the highest log2(fold change) (1.51) and lowest adjusted p-value at the time point when AP-regeneration polarity defects emerged following activin-2 RNAi (S4 Data).

Although not significantly different by RNA sequencing, foxD expression at wounds was higher in activin-2 RNAi animals when compared with controls by FISH, but only at late time points following RNAi initiation (35 days)–temporally correlated with slit+-midline and animal widening (S4F Fig). foxD is wound-induced in myoD+ longitudinal muscle (S4G Fig) specifically at the ventral midline [23]; increased expression is therefore likely associated with midline widening.

activin-2 promotes the polarized response of longitudinal muscle fibers to wound orientation independent of AP location

Ectopic notum expression at posterior-facing wounds occurred by 18 hpa, but was not present at early time points. By 24 hpa normal wound-induced notum expression lowered in control and activin-2 RNAi animals, reflecting the waning of wound induction (Fig 4A). Ectopic notum expression occurred at 21 days of activin-2 RNAi and later by FISH (S5A Fig). We therefore used 18 hpa at 21 days of RNAi to further characterize ectopic notum at posterior-facing wounds. Some regeneration phenotypes associated with defects in regulation of Wnt signaling only affect head regeneration in fragments from the posterior (e.g., follistatin RNAi) [30]. We therefore tested whether the effects of activin-2 RNAi on regeneration polarity are region specific. Elevated wound-induced notum expression at posterior-facing wounds occurred at every AP-amputation location examined, suggesting activin-2 RNAi impacted regeneration polarity across the entire AP axis (Fig 4B and 4C).

Fig 4. activin-2 promotes the polarized response of longitudinal muscle fibers to wound orientation independent of AP-axis position.

Fig 4

(A) Increased notum is seen at posterior-facing wounds specifically at 18 hours post amputation. (B) FISH shows increased notum expression at posterior-facing wounds across the AP axis. Animals were amputated into five fragments and assayed at 18 hours post amputation. (C) Graph shows quantification for (B). Data are shown as the ratio of notum+ cells found at anterior-facing versus posterior-facing wounds of a given piece. Kruskal-Wallis (one-way ANOVA on ranks) test with multiple comparisons was performed to determine P values. (D) FISH shows co-expression of wound-induced notum and myoD, snail at anterior- and posterior-facing wounds in activin-2 RNAi animals. Number of myoD/snail+ cells that co-localize with notum (magenta) out of total notum+ cells (yellow). White number, percentage of notum+ cells that are longitudinal fibers. All images are anterior up. Scale bars, 200 μm, except for high magnification panels in where they represent 10 μm.

Wound-induced notum expression at anterior-facing wounds in wild-type animals occurs specifically in longitudinal muscle cells, which are oriented along the AP axis and express myoD and snail [22]. Ectopic notum expression at posterior-facing wounds of activin-2 RNAi animals was similarly specific to myoD+/snail+ cells (Fig 4D). These findings are consistent with the possibility that biology intrinsic to longitudinal muscle is responsible for generating notum-expression polarity at wounds, and that activin-2 is required for this process.

activin-2 promotes the local polarized response of newly specified longitudinal muscle fibers to wound orientation

Because the loss of notum polarity in activin-2 RNAi animals was observed at 21 but not at 7 and 14 days post-RNAi initiation, we considered the possibility that activin-2 was required during muscle cell turnover to maintain regeneration polarity. In this scenario, it would take time for a substantial number muscle cells at posterior-facing wounds to have been generated in cell turnover under activin-2 RNAi conditions to observe ectopic notum expression. activin-2 transcripts were significantly reduced by 7 days RNAi by qPCR (S5B Fig). Because neoblasts are the only cycling somatic planarian cells [5154], EdU labeling marks a subset of newly formed cells originating from neoblasts. Consistent with the possibility that activin-2 RNAi affected the ability of newly made longitudinal muscle cells to display polarity, EdU labeling showed that notum+ longitudinal fibers at anterior- and posterior-facing wounds in activin-2 RNAi animals included newly generated cells (Figs 5A and S5C).

Fig 5. activin-2 promotes the polarized response of newly specified longitudinal muscle fibers to wound orientation.

Fig 5

(A) EdU incorporation in notum+ cells at posterior-facing wounds in an activin-2 RNAi animal. Lower magnification in S5A. (B) Top: cartoon shows the experimental design. Bottom: FISH shows notum expression at 18 hours post-amputation 21 days after the first RNAi feeding in lethally irradiated (6,000 rads) animals. (C) Top: cartoon shows the experimental design. Bottom: FISH shows notum expression at 18 hours post-amputation 21 days after the first RNAi feeding where a sublethal dose of irradiation (1,350 rads) was given 19 days prior to amputation. (D) Top: Cartoon showing experimental design. Animals were fed every 3 days. Animals were fed either control or activin-2 dsRNA for feeding 1, 2, 3, 5, and either myoD or control for feeding 4. Bottom: FISH shows notum expression at 18 hours post-amputation 21 days after the first RNAi feeding. Magenta, anterior-facing wounds; green, posterior-facing wounds. All images are anterior up. Scale bars, 200 μm, except for high magnification panels in where they represent 10 μm.

To further explore this possibility, we first utilized irradiation, which can reduce or eliminate neoblasts [55,56]. As a control, lethal irradiation (6,000 rads) two days prior to amputation eliminated neoblasts acutely in activin-2 RNAi animals and wound-induced notum was still symmetric (Figs 5B and S5D). Neoblasts are therefore not acutely required for wound-induced notum expression at activin-2 RNAi posterior-facing wounds. Sublethal irradiation causes a reduction in neoblasts, which was used to decrease cell turnover while allowing animals to survive for a long enough period of time to observe the impacts of reduced cell turnover. Animals were sublethally irradiated (1,350 rads) after 3 days of RNAi to severely reduce but not eliminate neoblasts, and amputated at 21 days of RNAi. These activin-2 RNAi animals displayed a marked decrease in posterior-facing notum expression compared to unirradiated controls or to lethally irradiated (6,000 rads) animals (Figs 5C and S5D and S5E). This is consistent with the possibility that irradiation blocked the formation of new muscle cells in activin-2 RNAi animals and that it is the newly differentiated muscle cells that display ectopic notum expression at posterior-facing wounds.

We also tested whether muscle cell turnover is required for the loss of notum asymmetry in activin-2 RNAi animals by using RNAi of myoD. notum is wound-induced in longitudinal muscle cells and myoD is required for new longitudinal muscle cell production in tissue turnover [22]. Therefore, RNAi of myoD causes a gradual decline in longitudinal muscle because new muscle cells fail to form and replace dying muscle cells during tissue turnover. Concurrent inhibition of myoD and activin-2 RNAi, to inhibit new muscle production, robustly blocked ectopic notum expression at posterior-facing wounds (Fig 5D); i.e., notum expression asymmetry (stronger at anterior-facing wounds) was present despite activin-2 RNAi. In this experiment, wound-induced notum expression was also decreased but not gone at anterior-facing wounds, as expected. There were similar levels of activin-2 transcript reduction between conditions (S5F Fig). The suppression of the activin-2 RNAi phenotype with irradiation or myoD RNAi further suggests that the activin-2 phenotype involves defects in the ability of newly generated longitudinal muscle cells to display asymmetry in notum activation at wounds.

Anterior axis splitting in activin-2 RNAi animals is associated with the formation of two anterior poles

By 48-72h post-amputation, the anterior pole forms at the pre-existing midline where it acts as a signaling center to influence ML and AP pattern in the blastema [23,24,26,57,58]. This time of regeneration is subsequent to the generic wound-response phase when notum is activated at anterior-facing wounds in pre-existing muscle cells. The regenerating anterior and posterior poles are newly generated cells with fates specified to make pole cells by transcription factor expression (e.g., foxD for the anterior pole) in neoblasts [2325].

At anterior-facing wounds, some activin-2 RNAi animals displayed the nucleation of split anterior poles at 72 hpa (Fig 6A). Given the organizer-like role of anterior poles in promoting midline and AP pattern, this suggests split anterior pole nucleation resulted in double heads in anterior activin-2 blastemas. This split pole defect, associated with head duplication in anterior blastemas, occurred primarily at the late RNAi time point (40 days) when animals displayed multiple body shape abnormalities including widening. Anterior pole cell numbers (notum+ and/or foxD+) were similar between control and activin-2 RNAi uninjured animals at 21 or 40 days on RNAi, as well as in 72 hpa blastemas (S6A and S6B Fig). Some poles were not split but wider than in controls after 40 days of RNAi (S6B and S6C Fig).

Fig 6. Ectopic wound-induced notum is correlated with the formation of an ectopic anterior pole in a Wnt-high environment.

Fig 6

(A) FISH shows split anterior poles (notum/ foxD+) in 72 hours regenerating activin-2 RNAi animals. (B) FISH show anterior (notum) and posterior (wnt1) pole markers at 12 days post amputation in activin-2 RNAi animals. (C) FISH shows expression of notum and wnt1 in the same posterior-facing wound of an activin-2 RNAi regenerating fragment at 30 hours post amputation. Green arrows show notum+ cells. White arrows denote cells that co-express notum and wnt1. (D) FISH shows regenerating fragments resetting PCG (ndl-5, notum, wntP-2) expression and nucleating new anterior poles at different time points. activin-2 RNAi animals show ectopic anterior poles at posterior-facing wounds. Boxes indicate high magnification images shown below. (E) FISH shows anterior pole markers (notum and foxD), and the posterior pole marker (wnt1) at the same posterior-facing wound of a regenerating fragment at 36 hours of regeneration. Zoom out seen in S7A Fig. (F) FISH shows posterior-facing wound of regenerating fragments at five days. Posterior related (wntP-2) and anterior related (notum/sFRP-1+) gene expression by FISH. (G) FISH shows ovo+ eye progenitors and expression of anterior (sFRP-1) and posterior (wntP-2) PCGs at posterior-facing wounds of an activin-2 RNAi animal. Boxes: zoom ins on the right. Magenta, anterior-facing wound; green, posterior-facing wound. Scale bars, 200 μm, except for high magnification panels in where they represent 10 μm.

Head blastema and anterior pole bifurcation is similar to the defect caused by RNAi of nkx-1.1, which is required for the maintenance of ML axis-oriented circular body wall muscle fibers [22]. activin-2 is expressed in circular muscle fibers, and its expression therefore decreases with circular fiber loss [22]. This suggests that the blastema bifurcation phenotype of nkx1.1 RNAi animals might be associated with reduced expression of activin-2. Furthermore, there was elevated wound-induced notum expression at the posterior-facing wounds of head fragments in nkx1.1 RNAi animals (S6D Fig). During early regeneration (48 hpa) muscle was present at activin-2 RNAi wound sites (S6E Fig) and activin-2 RNAi animals contracted wounds to promote wound closure normally (S6F Fig).

Ectopic wound-induced notum is correlated with the formation of an ectopic anterior pole in a Wnt-high environment

Posterior-facing wounds in activin-2 RNAi animals always regenerated at least one posterior pole, but also displayed simultaneous production of discrete anterior and posterior poles (Fig 6B). At 30 hpa, notum+ and wnt1+ cells were present in variable, but intermingled distributions at posterior-facing wounds; at this time point positive cells could include both pole progenitors and cells with residual wound-induced expression. Foci of cells reflecting new poles were not yet present (Figs 6C and S7A). Despite the largely dispersed and intermingled pattern of cells expressing these genes at this early time point, two distinct foci of either anterior or posterior pole cells formed later in regeneration.

By 36–38 hpa the anterior PCGs ndl-5 and sFRP-1 were ectopically expressed in a locally clustered manner at posterior-facing wounds, prior to substantial ectopic anterior-pole coalescence (Figs 6D and S7B). notum+ cells were present at this time, and localized to the regions of ndl-5 and sFRP-1 expression. However, there were few notum+ cells and they were not yet coalesced into tight foci reflecting new poles. At this time (38 hpa), posterior PCG expression (wntP-2) was still broad at the wound, but was reduced in level locally in the region of ectopic anterior PCG expression clusters (Figs 6D and S7B). The notum+ cells at 36 hpa were foxD+, indicating that they were pole progenitors and/or pole cells (Fig 6E). wnt1+ cells at this time were also regional and no longer intermingled with notum+ cells. Instead, local and separate locations of notum+ and wnt1+ cells at the same wound face were emerging (Fig 6E). In summary, by around 36 hpa ectopic local anterior PCG expression in activin-2 RNAi animals was associated with local reduction in wntP-2 expression and early stages of ectopic anterior pole formation spatially separated from posterior pole cells.

By 48 hpa both notum+; foxD+ anterior poles and wnt1+ posterior poles showed increased emergence at different locations (S7C Fig). By 72 hpa, all notum+ ectopic anterior-pole cells at posterior-facing wounds had coalesced and the ectopic ndl-5+ regions were expanded and stronger (Fig 6D). At 5 dpa, regenerating animals still possessed a global posterior wntP-2+ zone, with wntP-2 expression being only locally cleared near anteriorized regions (Fig 6F). Reduction of wntP-2 expression near anterior PCG foci was stronger at 5 dpa than when initial anterior PCG expression was detected at 36 hpa. In bulk RNA-sequencing data from activin-2 RNAi animals, an increase in posterior identity at posterior-facing wounds occurred normally, consistent with the local nature of the phenotype and its incomplete penetrance (S7D Fig). These molecular analyses only identified three combinations of heads and tails at posterior-facing wounds in activin-2 RNAi animals: tail only, tail-head, and head-tail-head.

These findings indicate the local nature of the patterning changes that occurred at activin-2 RNAi wounds–with local anterior PCG expression in part of the blastema associated with locally reduced posterior PCG expression, and with ectopic anterior pole formation only occurring near the blastema region with focal anterior PCG expression. This explains how both heads and tails were able to regenerate from single posterior-facing wounds in activin-2 RNAi animals. Furthermore, the percentage of activin-2 RNAi animals with ndl-5+ and notum+ foci at posterior-facing wounds at 72 hpa (23.1%) (Fig 6D), or ectopic foxD+/notum+ poles (18.2%) (S7E Fig), was similar to that of animals with ectopic posterior heads (31.9%) (Fig 1D). This suggests that ectopic wound-induced notum might only result in posterior-facing heads when ectopic anterior PCG induction occurred and was associated with reduced local Wnt activity and anterior pole formation.

PCGs are hypothesized to influence the specialization choices of neoblasts [3]. For example, RNAi of bmp4 results in dorsal epidermis-specialized neoblasts expressing ventral markers [59]. Consistent with this hypothesis, posterior-facing wounds in activin-2 RNAi animals had local eye-specialized neoblasts (ovo+) at 48 hours post-injury (Figs 6G and S7F). The location of these progenitors was proximal to anterior-PCG sFRP-1+ cells, suggesting that local changes in Wnt signaling led to local alteration in the fate choices of neighbouring neoblasts and the regeneration of posterior-facing head cell types that could organize into an ectopic posterior head.

Discussion

Pattern formation is the process of specifying the identity and organization of cells in spatial arrangements. Patterning in regeneration initiates at wound faces that are unpredictable in location and shape, involves production of variable combinations of missing cell types, and involves patterning of new tissue in the context of pre-existing mature tissues. These unique challenges suggest the existence of regeneration-specific patterning mechanisms. The resetting of the expression domains of patterning genes in muscle after injury has been proposed to drive planarian regeneration [3,22,30]. How patterning gene expression domains are reset after injury is poorly understood, but involves wound signaling. notum encodes a Wnt antagonist and is unique among known wound-induced genes in being preferentially activated at anterior- over posterior-facing wounds, where it promotes head identity [12]. How the polarity of wound-induced notum is established has remained unknown, but occurs in longitudinal (AP axis-oriented) muscle fibers [22]. One model is that some prior property of adult tissue, "polarity", is a pre-existing architectural cue leveraged by wounds to trigger asymmetric outcomes for anterior-facing and posterior-facing blastemas.

Prior work on regeneration polarity has identified components of Wnt signaling as required for the head-versus-tail regeneration outcome [57,9,10,12]. However, in APC RNAi animals, which have upregulated Wnt signaling [6], the asymmetry of notum activation at anterior-facing over posterior-facing wounds remains [12]. Wnt signaling itself might therefore not be a direct regulator of the polarity mechanism that enables asymmetric notum activation at wounds. Similarly, Hedgehog signaling is known to impact the head-versus-tail regeneration decision in planarians [60, 61]. hedgehog RNAi animals fail to regenerate tails [6062] and RNAi of patched, which causes upregulation of the Hedgehog pathway, causes regeneration of tails in place of heads [60,61]. However, patched RNAi does not impact the asymmetric activation of notum at wounds [12]. Therefore, no signaling pathway is as yet established to be required for this upstream most polarity step in the process of head regeneration. Here, we found that Activin signaling is required for AP regeneration polarity, involving a requirement for wound-induced notum asymmetry. activin-2 inhibition had no detectable impact on the ability of homeostatic Wnt signaling to maintain AP PCG expression, consistent with the possibility that Activin impacts some process required for regeneration polarity but not homeostatic maintenance of the order of existing PCG expression patterns. Our data indicate that activin-2 affects the ability of newly specified longitudinal muscle cells to be regeneration polarity competent. Perturbing muscle production, such as with myoD RNAi, does not cause loss of notum expression polarity in remaining fibers; furthermore, longitudinal fiber number was normal in activin-2 RNAi animals with polarity defects. Therefore, the requirement for activin-2 in regeneration polarity is not simply explained by a defect in longitudinal muscle production. One hypothesis is that longitudinal muscle cells have AP polarity and that this orientation impacts the asymmetry of wound-induced notum expression. Inhibition of Activin could perturb the polarization of newly synthesized longitudinal muscle or a different process essential for the capacity of longitudinal muscle to properly regulate notum activation asymmetrically. Future work could aim to understand the relation between activin-2 signaling and asymmetric processes that result in longitudinal muscle displaying preferential activation of notum at anterior over posterior-facing wounds.

Ectopic notum expression at posterior-facing wounds in activin-2 RNAi animals was associated with ectopic anterior PCG expression, local reduction of posterior wnt expression, and ectopic anterior pole formation (Fig 7). Unexpectedly, this phenomenon could result in the simultaneous formation of discrete anterior and posterior poles and a head and a tail emerging from individual posterior-facing wounds. We propose that ectopic wound-induced notum expression can result in some anterior PCG activation, and that this can in some but not all cases lead to tipping points of local stable anterior identity. Why stable anterior PCG activation appears localized to only a region of the posterior-facing blastema and in only some animals is not fully understood. However, one possibility is that there is variability in how much anterior PCG activation is caused by ectopic notum expression at posterior-facing wounds. Local tipping points could then be stochastically reached, with sufficient anterior PCG expression resulting in more anterior PCG expression in new muscle cells. Such a self-reinforcing process could ultimately be stabilized by formation of an anterior pole from neoblasts choosing an anterior pole fate near anterior PCG expression foci. With a nucleated anterior pole, local posterior PCG expression inhibition and stable anterior PCG expression would occur. In many cases, a tipping point would not be reached, with posterior PCG expression dominating the entire wound and no ectopic anterior pole(s) forming. notum does not turn on as early at activin-2 RNAi posterior-facing wounds as it does at wild-type anterior-facing wounds, possibly explaining why this process is less robust than wild-type head formation. There could also be additional mechanisms that distinguish anterior- and posterior-facing wounds. Regardless, in essentially all cases involving ectopic anterior pole formation at posterior-facing wounds in activin-2 RNAi animals, posterior pole formation also occurred–anterior identity foci formation might have only been compatible with posterior pole formation when it was sufficiently spatially separated from it.

Fig 7. activin-2 RNAi animals display a regeneration-specific polarity defect in patterning correlated with a loss of wound-induced notum polarity.

Fig 7

Model of regeneration with activin-2 RNAi defects depicted. Animals possess a wnt expression gradient from posterior to anterior. Upon amputation in activin-2 RNAi animals, notum wound-induced gene expression (6–24 hr) is no longer spatially restricted to the anterior. Multiple midlines and poles can form, including anterior poles at the posterior-facing wound (36-72 hpa). Posterior identity is maintained in regenerated animals, with ectopic anterior axes (14 d).

At anterior-facing wounds, activin-2 was required for the pattern of nucleation of the anterior pole, with inhibition of activin-2 causing the occasional nucleation of two poles. The regeneration-specific head-splitting aspect of the activin-2 RNAi phenotype was temporally correlated with midline widening and nucleation of multiple poles. These processes requiring activin-2 –wound-induced notum activation and the de novo nucleation of poles–are two processes unique to regeneration as compared to tissue turnover (Fig 7).

Activin signaling has been implicated in several processes in planarian biology from prior work. Inhibition of planarian follistatin, which encodes a conserved Activin inhibitor, can cause head regeneration failure when amputation occurs in the posterior [27,28,30]. This is associated with regulation of the levels of wound-induced wnt1, and activin-1 RNAi can suppress this phenotype [30]. Furthermore, follistatin RNAi causes a defect in the missing tissue response and this defect is also suppressed by RNAi of either activin-1 or activin-2 [28]. follistatin is activated by wound signaling [27,28,30], and these findings implicate inhibition of Activin by Follistatin in setting the levels of wound-induced wnt1 and in promoting the missing tissue response. notum expression was not determined to be aberrant in follistatin RNAi animals [30], unlike the case for activin-2 RNAi animals. Our data suggests that activin-2 does not regulate notum wound-induced levels per se, but specifically is required to prevent notum from being activated at posterior-facing wounds. follistatin RNAi should result in increased Activin-2 signaling and might therefore simply result in increased Activin-2-mediated promotion of polarity, with polarity therefore being normally generated. Inhibition of an Activin receptor-encoding gene can result in ectopic pharynges (ActR-1, dd_3426) [27] and anterior head splitting (ActR-1, dd_3426) [35]. However, Activin signaling was previously not known to regulate regeneration polarity at posterior-facing wounds. Together these findings highlight the prominent role of Activin in regulating processes at planarian wounds associated with key steps of regeneration.

Pattern formation in development involves prominent signaling pathways, including different Tgf-β signaling pathways. Tgf-β signaling ligands are subdivided into two major groups, which signal through different receptors and Smad-family proteins: (i) Bmp and (ii) a group including Activin, Myostatin, Tgf-β, and Nodal. Multiple of these signaling ligands have important roles in patterning embryos. For example, Bmp patterns the dorsal-ventral axis of embryos throughout the animal kingdom [63]. Bmp also patterns the adult planarian DV axis [6466]. Among the other ligand group, Nodal has major roles in the specification and patterning of embryonic mesendoderm and in the development of left-right asymmetry [6772]. By contrast, the Activin-Follistatin pathway has not been identified as a major regulator of patterning in animal development and instead is more prominently associated with non-patterning or adult processes [72,73]. In zebrafish heart and fin regeneration, the Activin pathway ligand-encoding gene inhbaa and the Activin receptor-encoding alk4 gene are expressed at wounds and are required for proper regeneration [38,39]. In mice, follistatin and activin are expressed at dermal wounds [37,46] and have roles in repair [74,75]. In axolotls, a Follistatin-like molecule, kazald-1 is specifically expressed in the adult regenerating limb and is required for regeneration [76]. Activin and the related Myostatin also have roles in adult homeostatic processes providing, for example, inter-organ humoral signals to regulate fat body and endocrine functions [47,48,7779]. These findings raise the possibility that the Activin-Follistatin signaling pathway has broad roles in adult biology that are conserved in evolution, including in wound repair and regeneration. The many and distributed expression locations of activin-2 in planarians are consistent with the possibility that Activin might, similar to the case in other organisms, have a broad-acting (rather than only local) signaling role [73]. Our findings suggest some of these roles can include regeneration-specific pattern-initiating processes, and that Activin signaling might prove to be a major regulator of regeneration in animals. This will be an important possibility to explore in multiple additional regenerative organisms.

In conclusion, an Activin-family signaling ligand has essential roles in events occurring at wounds that initiate pattern in planarian regeneration. Disruption of these processes leads to body plan aberration with animals regenerating multiple heads and heads formed with reversed polarity. Activin is required for the earliest known step in establishing head-versus-tail regeneration–the polarized expression of notum that is selective for anterior-facing wounds. We suggest that Activin signaling is an important regulator of Wnt signaling at wounds to promote pattern in whole-body regeneration.

Methods

Double-strand RNA synthesis and RNAi

dsRNA was synthesized using in vitro transcription reactions (Promega) using PCR-generated templates with flanking T7 promoters (TAATACGACTCACTATAGGG). 16 ul of template reaction was mixed with 1.6 ul of each rNTP (100 mM); 0.6 ul dithiothreitol (1M DTT); 4 ul T7 polymerase; and 24 ul of 5x Transcription buffer. Reactions were incubated overnight at 37°C. Forward and reverse reactions were then combined, followed by ethanol precipitation, resuspension in 30 ul of water and annealing (95°C for 5 minutes, room temperature for 20 minutes). dsRNA concentration was between 5–8 ug/ul. Animals were fed twice per week using a ~2:1 ratio of homogenized calf liver to dsRNA (13 ul dsRNA, 26 ul of calf liver, and 1 ul of dye per aliquot). At each feeding excess food was added to each dish so that not all food was finished; approximately 4 ul per worm. In all cases, animals were fixed seven days after the last feeding. For regeneration and RNA-seq experiment, animals were amputated one week after the last RNAi feeding. Contraction experiments placed some amputated animals directly into 100% modified Holtfreter’s solution (3.5 g/L NaCl, 0.2 g/L NaHCO3, 0.05 g/L KCl, 0.2 g/L MgSO4, 0.1 g/L CaCl2, pH 7.0–7.5) to inhibit muscle movement as a negative control for wound contraction.

Fixation

Animals were killed in 5% N-acetyl-cysteine (NAC) in PBS for 3 minutes before fixation in 4% formaldehyde in PBSTx (PBS + 0.3% Triton X-100) for 15 minutes. Fixative was removed and worms were rinsed with PBSTx. Animals were dehydrated and stored in methanol at -20°C.

Whole-mount fluorescence in situ hybridizations and immunostainings

RNA probes were synthesized using in vitro transcription reactions (Promega) and whole-mount FISH was performed as previously described (King and Newmark 2013), with minor modifications. Briefly, animals were rehydrated, bleached in a formamide based solution on a light table and treated with proteinase K (2 μg/ml). Following overnight hybridizations, samples were washed twice in each of pre-hybridization buffer, 1:1 pre-hybridization-2X SSC, 2X SSC, 0.2X SSC, PBS with Triton-X (PBST). Subsequently, blocking was performed in 0.5% Western Blocking Reagent (Roche, 11921673001) and 5% inactivated horse serum PBSTx solution and anti-DIG, anti-DNP, or anti-FITC antibodies were used overnight at 4°C. Washes and tyramide development were as previously described. Peroxidase inactivation with 1% sodium azide was done for 90 minutes at room temperature. An anti-muscle mouse monoclonal antibody 6G10 was used in a 1:1,000 dilution, and an anti-mouse Alexa-488 conjugated antibody (Life Tech) was used in a 1:500 dilution. Samples were stained with DAPI overnight (Sigma, 1 mg/ml in PBSTx). Nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) colorimetric whole-mount in situ hybridizations (ISH) were performed as described[80].

Imaging

Fluorescence images were taken with a Zeiss LSM700 Confocal Microscope using ZEN software or with a Leica SP8 Confocal Microscope. Image analysis was performed using Fiji/ImageJ. For each channel, histograms of fluorescence intensity were used to determine the cut-off between signal and background. All FISH images are representative of all images taken in each condition. Light images were taken with a Zeiss Discovery Microscope. Cell counting was performed manually after blinding control and experimental conditions.

RNA-seq experiments

Total RNA was isolated using Trizol (Life Technologies) from animal fragments. Libraries were prepared using the Kapa Stranded mRNA-Seq Kit Illumina Platform (KapaBiosystems). Libraries were sequenced on an Illumina Hi-Seq. Libraries were mapped to the dd_Smed_v6 transcriptome (http://planmine.mpi-cbg.de); using bowtie v1.1.2 with -best alignment parameter. The number of mapped reads per contig in every cell was quantified using the coverageBed utility from the bedtools v2.26.0 suite and reads from the same isotig were summed to generate raw read counts for each transcript. Pairwise differential expression analysis was performed using DESeq2. Expression values from DESeq normalization were scaled, row-wise, to generate z-scores for heatmaps and visualized using the pheatmap package. Significance is reported as padj values, with padj < 0.05 used as a cutoff.

Irradiation

Animals were irradiated using a dual Gammacell-40 137 cesium source to deliver either 1350 or 6,000 rads.

EdU delivery and labeling

Animals were fed EdU (Sigma #T511293) diluted in liver to 0.5 mg/ml and 1% DMSO. Following feeding, animals were incubated in 5g/L Instant Ocean until fixation. Animals were processed using the FISH protocol with a modified EdU labeling step after probe hybridization. Animals were incubated in the dark for 30 min in an azide click reaction containing 1% 100 mM CuSO4, 0.1% 10mM azide-fluorophore 545 (Sigma #MKCH3642), 20% 50 mM ascorbic acid from (+) sodium-L-ascorbate in PBS. Ascorbic acid was made fresh for each reaction. After EdU labeling animals were washed in PBSTx 3x and FISH protocol was continued.

Quantification and statistical analysis

Statistical analyses were performed using the Prism software package (GraphPad Inc., La Jolla, CA). Comparisons between the means of two populations were done by a Student’s t test. Comparisons of means between multiple populations were done by one-way ANOVA test followed by Dunnett’s multiple comparison test was used when analyzing more than two conditions. Significance was defined as p < 0.05. Statistical tests, significance, data points, error bars and animal numbers (n) for each figure are provided in the legends.

qPCR

Total RNA was isolated using Trizol (Life Technologies) from animal fragments. activin-2 primers were designed to include both a portion of the dsRNA construct and the rest of the endogenous gene in order to avoid amplification of dsRNA. Primers for activin-2 amplification are as follows: tccaatcatgcttctcaaagga and tcaactggattggccataattg. The SuperScript III Reverse Transcriptase kit (Invitrogen) was used to create cDNA from 500 ng of RNA input. CT values were calculated as the average of three technical replicates. These values were then normalized to the housekeeping gene g6pd (S2A Fig) or gapdh (S5B and S5F Fig) in order to calculate the ΔCt. -ΔΔCt values were calculated by measuring the difference of a given ΔCt to that of control replicates. 2-ΔΔCt values are plotted as data in a bar graph, along with the standard deviation for each set of values.

Supporting information

S1 Fig. Phylogenetic analysis of Schmidtea mediterranea activin-2.

Related to Fig 1. (A) Phylogenetic tree for the placement of Schmidtea mediterranea activin-2. Bayesian analysis of TGF- superfamily ligand proteins with a focus on Activins and Myostatins, where BMP-2/4 is used as an outgroup across species. Percent posterior probability is indicated at nodes. Smed (Schmidtea mediterranea), Nve (Nematostella vectenesis), Mmu (Mus musculus), Bfl (Branchiostoma floridae), Sko (Saccoglossus kowalevskii), Lgi (Lottia gigantea). In Mus musculus genes that contribute to Activin proteins are called inhibin, we used this nomenclature in the tree. Protein sequences are provided in S1 Data.

(PDF)

S2 Fig. Characterization of the activin-2 RNAi phenotype.

Related to Fig 1. (A) RNAi control. Transcript abundance for TGF-β ligands and follistatin from bulk sequencing expression data in control and activin-2 RNAi animals. RPM is reads per million. Data is three replicates of a post-pharyngeal fragment. Related to S2 Data. (B) Regenerating activin-2 RNAi animals after 40 days of RNAi, and 14 days post amputation. The three representative images show examples of (Left) anterior axis bifurcation, (Middle) parapharyngeal bulging indicative of ectopic pharyngeal tissue; (Right) posterior axis bifurcation and loss of polarity resulting in ectopic posterior heads. (C) Negative results related to 1C. FISH shows (left) CNS (chat+) and mouth and esophagus (NB.22.1e) and (right) PCG expression (midline slit+; anterior sFRP-1+). Yellow arrow shows ectopic posterior mouth tissue. (D) DAPI shows intact (Left) and regenerated (Right) animals develop ectopic pharynges. Red arrows show anatomy. Phx = pharynx. (E) Intact activin-2 RNAi animals develop ectopic pharynges (Top) and ectopic mouth tissue (Bottom). At 21 days RNAi, 5/7 animals display an anteriorly expanded dd_554 domain, and a 6/7 display posteriorly expanded NB.22.1e domain. At 40 days RNAi, all animals assayed display ectopic pharynges and mouth tissue. (F) Ectopic pharynges express the transcription factor foxA, dd_554, and are connected to the (6G10+) muscularized gut by an NB.22.1e+ esophagus. 6G10 is a muscle antibody, other markers are RNA probes. (G) activin-2 expression at 0 and 24 hours post amputation in a midbody piece. (H) t-SNE representation of clustered cells (dots) colored according to single gene expression or cluster assignment based on global gene expression. (Top left) 50,562 cells [50] obtained by Drop-seq are colored according to major planarian tissue type cluster assignment. (Top right) Each cell is colored and sized by the average normalized expression of activin-2. (Bottom) Muscle cells obtained by Smart-seq2 [51] are colored according to planarian muscle cluster assignment. activin-2 expression is plotted on these cells. (I) (Top left) activin-2 is expressed in collagen-2+ muscle cells in the body-wall (Bottom left) activin-2 is expressed in mp-1+ muscle cells in the pharynx (Top right) activin-2 is expressed in the intestine. (Bottom right) activin-2 is highly expressed in an inner muscle wall of the pharynx, interior to slit+ cells. White shows co-localization. Scale bars represent 200 μm, except for high magnification panels in S1F (Left) where they represent 10 μm.

(PDF)

S3 Fig. Characterization of the activin-2 RNAi intact animal pattern.

Related to Fig 2. (A) Graphs show body width/length per animal at different time points. Width quantified at widest point of the animal. (B) Intact activin-2 RNAi animals display proper PCG expression and pole presence at 21 days of activin-2 RNAi along the AP axis by FISH. (Pink) Anterior restricted genes, (Green) posterior restricted genes. act-2 is abbreviation for activin-2. (C) Quantification of PCG domain expression relative to animal length. The length to body ratio for ndl-3 and wntP-2 was blind scored following the landmarks show in the top left. Data are presented as mean +/- SD. A student’s t-test was performed to determine significance with a cutoff of p = 0.05. (D) Intact activin-2 RNAi animal midline (slit+) gene expression at 21 days and 40 days by FISH. (E) Intact animal muscle fibres (6G10+) at 21 days and 40 days activin-2 RNAi by immunofluorescence. 40 day RNAi animals display loss of orthogonal directionality of muscle fibres. (F) Intact activin-2 animal muscle cell gene expression (collagen-2) at 40 days of activin-2 RNAi by FISH. (G) Live images of intact control and activin-2 animals at 60 days of RNAi. (H) (Left) Immunofluorescence (6G10) of control and activin-2 animals showing muscle fibers, (Middle, Right) FISH of control and activin-2 RNAi animals showing central nervous system (chat), and PCGs (ndl-3, wntP-2) at 60 days of RNAi. (I) Intact activin-2 RNAi animals display maintenance of restriction of the anterior pole maker notum at 60 days RNAi by FISH.

(PDF)

S4 Fig. Characterization of the activin-2 RNAi animal wound response.

Related to Fig 3. (A) Heatmap of top 100 muscle specific genes annotated in [19] from bulk sequencing of posterior-facing wounds at 0 hours post amputation after 21 days of either activin-2 or control RNAi (three wound sites per replicate). Each gene is a row, and each replicate is a column. Related to S2 Data. (B) Heatmap of wound induced gene expression from bulk sequencing of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post amputation, and anterior-facing wounds at 18 hours post amputation (three to four wound sites per replicate). Each gene is a row, and each replicate is a column. Related to S2S4 Data. Top: known wound induced genes expressed in muscle (notum, foxD, fst, inhibin-1, wntless, nlg-1, wnt1), epidermis (hadrian), neoblasts (runt-1), and broadly induced (fos-1). Bottom: known neoblast genes, expression increases indicate an increase in cycling cell number (C) Left: in situ hybridization of activin-2 at 18 hpa, Right: carton showing DE-Seq result from bulk sequencing data that there is no significant difference in activin-2 expression at 18 hpa between anterior- and posterior- facing wounds in control animals. (D-E) Wound-induced gene expression at 18 hours post amputation. Magenta denotes anterior-facing wound, and green denotes posterior-facing wound. (D) FISH shows genes that are expected to change given DEseq data. (F) Wound induced foxD expression is correlated to midline (slit+) width. activin-2 RNAi animals have a marked increase in midline (slit+) width by 35 days, and foxD expression at 6 hours post amputation is increased to a similar width (ventral view). (G) foxD expression in activin-2 RNAi animals is specific to longitudinal muscle (myoD+, snail+) at posterior-facing wounds by FISH. Pink number is number of myoD/snail+ cells co-localized with foxD. Yellow number is total foxD+ cells. White number is percent foxD cells that are longitudinal fibers. Scale bars represent 200 μm, except for the high magnification panel in S4G where they represent 10 μm.

(PDF)

S5 Fig. Characterization of symmetric wound-induced notum as turnover dependent.

Related to Fig 5. (A) Wound-induced notum expression at posterior-facing wounds first appears after 21 days of RNAi (18 hpa) by FISH. (B) RT-PCR quantification of activin-2 expression at 7, 14, and 21 days of activin-2 or control RNAi. Relative expression is plotted as 2-ΔΔCT values. Data are plotted as mean ± S.D. NS if p>0.05. (C) Zoom out of EdU labeling with notum FISH seen in Fig 5A. Anterior- and posterior-facing wounds of activin-2 RNAi are shown. Animals were fed with EdU once at day 15 of activin-2 RNAi. (D) smedwi-1 (neoblast marker) gene expression in different irradiation conditions performed in Fig 5B and 5C. Left: control with no irradiation, Middle: 18 days post 1350 rads, Right: three days post 6000 rads. (E) activin-2 gene expression across conditions performed in Fig 4D and 4E. (F) RT-PCR for of activin-2 for RNAi condition stated. Relative expression is plotted as 2-ΔΔCT values. Data are plotted as mean ± S.D. NS if p>0.05. Magenta denotes anterior-facing wound, and green denotes posterior-facing wound. Scale bars represent 200 μm.

(PDF)

S6 Fig. Ectopic anterior fates and ectopic notum is locally expressed.

Related to Fig 6. (A) Number of pole cells (notum+ and/or foxD+) of (Left) intact animals at 21 days RNAi, (Middle) intact animals at 40 days RNAi, and 72 hpa (hours post amputation) animals at 40 days of RNAi. Student’s t-test used to determine statistical significance. NS is >p 0.05 act-2 = activin-2. (B) FISH of poles (notum+ or foxD+) of intact animals at 40 days RNAi. (C) Quantification for Fig 6A. Width of control and activin-2 RNAi animal poles (40 days of RNAi) at 72 hpa. Each datapoint is width of pole/width of wound face. NS >0.05. (D) notum expression at wounds in a head fragment and a midbody fragment after six weeks of nkx1.1 (circular fiber transcription factor) RNAi. Green arrow shows elevation of posterior-facing notum at 18 hours post amputation. (E) Immunofluorescence (6G10) showing muscle fibers at posterior-facing wounds at 48 hpa. (F) Live images of animals showing wound contraction at 30’ post amputation. Holtfreter’s solution inhibits muscle contraction, and was used as a negative control.

(PDF)

S7 Fig. Ectopic anterior tissue forms at posterior-facing wounds in activin-2 RNAi.

Related to Fig 6. (A) FISH shows expression of anterior pole marker (notum), and posterior pole marker (wnt1) in the same posterior-facing wound (Left: also shows anterior-facing wound) of an activin-2 RNAi regenerating fragment at 30 hours post amputation. Left: Magenta arrows show wnt1 cells proximal to posterior-facing wound. Green arrows show notum+ cells. White arrows denote cells that co-express notum and wnt1. 19 total animals were examined with varying FISH patterns; representative images of this experiment are shown here and in 7C. (B) FISH shows expression of anterior pole marker (notum), anterior PCG (sFRP-1), and posterior PCG (wntP-2) in the same posterior-facing wound (B). (C) FISH shows expression of anterior pole marker (notum), and posterior pole marker (wnt1) in the same posterior-facing wound of an activin-2 RNAi regenerating fragment at 48 hours. (D) Heatmap shows posterior PCGs and markers from bulk sequencing of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post amputation, and anterior-facing wounds at 18 hours post amputation. Each gene is a row, and each replicate is a column. Related to S2 Data. (E) foxD and notum are co-expressed in the ectopic anterior pole at the posterior-facing wound of an activin-2 RNAi animal fragment at 72 hours post amputation. (F) Lower magnification of image shown in Fig 7C denotes close proximity between ovo+ eye progenitors and the anterior PCG sFRP-1 at a posterior-facing wound of an activin-2 RNAi animal at 48 hours post amputation. Scale bars, 200 μm.

(PDF)

S1 Data. This file contains a list of protein sequences used in the phylogenetic analysis presented in S1 Fig.

Each sequence is annotated with species and available information of deposited location. This file also contains the trimmed input for Bayesian analysis from row 21–68.

(XLSX)

S2 Data. This file contains bulk RNA-sequencing analysis for regenerating control and activin-2 RNAi animals.

The DESeq tool was used to calculate log2FC and padj for each condition. Each transcript is annotated with best BLAST hits.

(XLSX)

S3 Data. This file contains a list of contigs that are the union of FISH validated wound induced genes found in Wurtzel et al 2015 and Wenemoser et al 2012.

Each transcript is annotated with best BLAST hits.

(XLSX)

S4 Data. This file contains a list of contigs that are the genes from S3 Data which significantly differ in S2 Data specifically at times 6 hpa and/or 18 hpa.

The cutoff for this table is padj<0.001. Rows from S2 Data meeting these specifications were transposed into this table. Each transcript is annotated with best BLAST hits.

(XLSX)

Acknowledgments

We thank members of the Reddien lab for discussions and comments on the manuscript.

Data Availability

All data is deposited and available at NCBI GSE148376.

Funding Statement

This work was supported by the Eleanor Schwartz Charitable Foundation (to PWR). PWR is an investigator of HHMI. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Randolph H. Observations and experiments on regeneration in planarians. Arch Entw Mech Org. 1897;5:352–72. [Google Scholar]
  • 2.Morgan TH. Experimental studies of the regeneration of Planaria maculata. Arch Entw Mech Org. 1898;7:364–97. [Google Scholar]
  • 3.Reddien PW. The Cellular and Molecular Basis for Planarian Regeneration. Cell. 2018;175(2):327–45. 10.1016/j.cell.2018.09.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Witchley JN, Mayer M, Wagner DE, Owen JH, Reddien PW. Muscle cells provide instructions for planarian regeneration. Cell Reports. 2013;4(4):633–41. 10.1016/j.celrep.2013.07.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Petersen CP, Reddien PW. Smed-betacatenin-1 is required for anteroposterior blastema polarity in planarian regeneration. Science. 2008;319(5861):327–30. 10.1126/science.1149943 [DOI] [PubMed] [Google Scholar]
  • 6.Gurley KA, Rink JC, Sánchez Alvarado A. Beta-catenin defines head versus tail identity during planarian regeneration and homeostasis. Science. 2008;319(5861):323–7. 10.1126/science.1150029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Iglesias M, Gomez-Skarmeta JL, Saló E, Adell T. Silencing of Smed-betacatenin1 generates radial-like hypercephalized planarians. Development. 2008;135(7):1215–21. 10.1242/dev.020289 [DOI] [PubMed] [Google Scholar]
  • 8.Adell T, Saló E, Boutros M, Bartscherer K. Smed-Evi/Wntless is required for beta-catenin-dependent and -independent processes during planarian regeneration. Development. 2009;136(6):905–10. 10.1242/dev.033761 [DOI] [PubMed] [Google Scholar]
  • 9.Petersen CP, Reddien PW. A wound-induced Wnt expression program controls planarian regeneration polarity. Proc Natl Acad Sci U S A. 2009;106(40):17061–6. 10.1073/pnas.0906823106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gurley KA, Elliott SA, Simakov O, Schmidt HA, Holstein TW, Sánchez Alvarado A. Expression of secreted Wnt pathway components reveals unexpected complexity of the planarian amputation response. Dev Biol. 2010;347(1):24–39. 10.1016/j.ydbio.2010.08.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Almuedo-Castillo M, Saló E, Adell T. Dishevelled is essential for neural connectivity and planar cell polarity in planarians. Proc Natl Acad Sci U S A. 2011;108(7):2813–8. 10.1073/pnas.1012090108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Petersen CP, Reddien PW. Polarized notum activation at wounds inhibits Wnt function to promote planarian head regeneration. Science. 2011;332(6031):852–5. 10.1126/science.1202143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Reuter H, Marz M, Vogg MC, Eccles D, Grifol-Boldu L, Wehner D, et al. Beta-catenin-dependent control of positional information along the AP body axis in planarians involves a teashirt family member. Cell Rep. 2015;10(2):253–65. 10.1016/j.celrep.2014.12.018 [DOI] [PubMed] [Google Scholar]
  • 14.Owen JH, Wagner DE, Chen CC, Petersen CP, Reddien PW. teashirt is required for head-versus-tail regeneration polarity in planarians. Development. 2015;142(6):1062–72. 10.1242/dev.119685 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Scimone ML, Cote LE, Rogers T, Reddien PW. Two FGFRL-Wnt circuits organize the planarian anteroposterior axis. Elife. 2016;5. 10.7554/eLife.12845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lander R, Petersen CP. Wnt, Ptk7, and FGFRL expression gradients control trunk positional identity in planarian regeneration. Elife. 2016;5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sureda-Gomez M, Martin-Duran JM, Adell T. Localization of planarian beta-CATENIN-1 reveals multiple roles during anterior-posterior regeneration and organogenesis. Development. 2016;143(22):4149–60. 10.1242/dev.135152 [DOI] [PubMed] [Google Scholar]
  • 18.Stuckemann T, Cleland JP, Werner S, Thi-Kim Vu H, Bayersdorf R, Liu SY, et al. Antagonistic Self-Organizing Patterning Systems Control Maintenance and Regeneration of the Anteroposterior Axis in Planarians. Dev Cell. 2017;40(3):248–63 e4. 10.1016/j.devcel.2016.12.024 [DOI] [PubMed] [Google Scholar]
  • 19.Wurtzel O, Cote LE, Poirier A, Satija R, Regev A, Reddien PW. A Generic and Cell-Type-Specific Wound Response Precedes Regeneration in Planarians. Dev Cell. 2015;35(5):632–45. 10.1016/j.devcel.2015.11.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wenemoser D, Lapan SW, Wilkinson AW, Bell GW, Reddien PW. A molecular wound response program associated with regeneration initiation in planarians. Genes & Development. 2012;26(9):988–1002. 10.1101/gad.187377.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kakugawa S, Langton PF, Zebisch M, Howell S, Chang TH, Liu Y, et al. Notum deacylates Wnt proteins to suppress signalling activity. Nature. 2015;519(7542):187–92. 10.1038/nature14259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Scimone ML, Cote LE, Reddien PW. Orthogonal muscle fibres have different instructive roles in planarian regeneration. Nature. 2017;551(7682):623–8. 10.1038/nature24660 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Scimone ML, Lapan SW, Reddien PW. A forkhead transcription factor is wound-induced at the planarian midline and required for anterior pole regeneration. PLoS genetics. 2014;10(1):e1003999. 10.1371/journal.pgen.1003999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Vogg MC, Owlarn S, Perez Rico YA, Xie J, Suzuki Y, Gentile L, et al. Stem cell-dependent formation of a functional anterior regeneration pole in planarians requires Zic and Forkhead transcription factors. Developmental Biology. 2014;390(2):136–48. 10.1016/j.ydbio.2014.03.016 [DOI] [PubMed] [Google Scholar]
  • 25.Vasquez-Doorman C, Petersen CP. zic-1 Expression in planarian neoblasts after injury controls anterior pole regeneration. PLoS genetics. 2014;10(7):e1004452. 10.1371/journal.pgen.1004452 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Oderberg IM, Li DJ, Scimone ML, Gavino MA, Reddien PW. Landmarks in Existing Tissue at Wounds Are Utilized to Generate Pattern in Regenerating Tissue. Curr Biol. 2017;27(5):733–42. 10.1016/j.cub.2017.01.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Roberts-Galbraith RH, Newmark PA. Follistatin antagonizes activin signaling and acts with notum to direct planarian head regeneration. Proc Natl Acad Sci U S A. 2013;110(4):1363–8. 10.1073/pnas.1214053110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gavino MA, Wenemoser D, Wang IE, Reddien PW. Tissue absence initiates regeneration through Follistatin-mediated inhibition of Activin signaling. eLife. 2013;2:e00247. 10.7554/eLife.00247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gehrke AR, Neverett E, Luo YJ, Brandt A, Ricci L, Hulett RE, et al. Acoel genome reveals the regulatory landscape of whole-body regeneration. Science. 2019;363(6432). 10.1126/science.aau6173 [DOI] [PubMed] [Google Scholar]
  • 30.Tewari AG, Stern SR, Oderberg IM, Reddien PW. Cellular and Molecular Responses Unique to Major Injury Are Dispensable for Planarian Regeneration. Cell Rep. 2018;25(9):2577–90 e3. 10.1016/j.celrep.2018.11.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nakamura T, Takio K, Eto Y, Shibai H, Titani K, Sugino H. Activin-binding protein from rat ovary is follistatin. Science. 1990;247(4944):836–8. 10.1126/science.2106159 [DOI] [PubMed] [Google Scholar]
  • 32.Hemmati-Brivanlou A, Kelly OG, Melton DA. Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell. 1994;77(2):283–95. 10.1016/0092-8674(94)90320-4 [DOI] [PubMed] [Google Scholar]
  • 33.Hill JJ, Davies MV, Pearson AA, Wang JH, Hewick RM, Wolfman NM, et al. The myostatin propeptide and the follistatin-related gene are inhibitory binding proteins of myostatin in normal serum. J Biol Chem. 2002;277(43):40735–41. 10.1074/jbc.M206379200 [DOI] [PubMed] [Google Scholar]
  • 34.Gilson H, Schakman O, Kalista S, Lause P, Tsuchida K, Thissen JP. Follistatin induces muscle hypertrophy through satellite cell proliferation and inhibition of both myostatin and activin. Am J Physiol Endocrinol Metab. 2009;297(1):E157–64. 10.1152/ajpendo.00193.2009 [DOI] [PubMed] [Google Scholar]
  • 35.Arnold CP, Benham-Pyle BW, Lange JJ, Wood CJ, Sánchez Alvarado A. Wnt and TGFbeta coordinate growth and patterning to regulate size-dependent behaviour. Nature. 2019;572(7771):655–9. 10.1038/s41586-019-1478-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kenny NJ, Namigai EK, Dearden PK, Hui JH, Grande C, Shimeld SM. The Lophotrochozoan TGF-beta signalling cassette—diversification and conservation in a key signalling pathway. Int J Dev Biol. 2014;58(6–8):533–49. 10.1387/ijdb.140080nk [DOI] [PubMed] [Google Scholar]
  • 37.Wankell M, Kaesler S, Zhang YQ, Florence C, Werner S, Duan R. The activin binding proteins follistatin and follistatin-related protein are differentially regulated in vitro and during cutaneous wound repair. J Endocrinol. 2001;171(3):385–95. 10.1677/joe.0.1710385 [DOI] [PubMed] [Google Scholar]
  • 38.Jazwinska A, Badakov R, Keating MT. Activin-betaA signaling is required for zebrafish fin regeneration. Curr Biol. 2007;17(16):1390–5. 10.1016/j.cub.2007.07.019 [DOI] [PubMed] [Google Scholar]
  • 39.Dogra D, Ahuja S, Kim HT, Rasouli SJ, Stainier DYR, Reischauer S. Opposite effects of Activin type 2 receptor ligands on cardiomyocyte proliferation during development and repair. Nat Commun. 2017;8(1):1902. 10.1038/s41467-017-01950-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Edgecombe GD, Giribet G, Dunn CW, Henjol A, M. Kristensen RM. Rouse GW, et al. Higher-level metazoan relationships: recent progress and remaining questions. Organisms Diversity & Evol. 2011;11(2):151–72. [Google Scholar]
  • 41.Lee SJ, Reed LA, Davies MV, Girgenrath S, Goad ME, Tomkinson KN, et al. Regulation of muscle growth by multiple ligands signaling through activin type II receptors. Proc Natl Acad Sci U S A. 2005;102(50):18117–22. 10.1073/pnas.0505996102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell. 2000;103(2):295–309. 10.1016/s0092-8674(00)00121-5 [DOI] [PubMed] [Google Scholar]
  • 43.Morvan F, Rondeau JM, Zou C, Minetti G, Scheufler C, Scharenberg M, et al. Blockade of activin type II receptors with a dual anti-ActRIIA/IIB antibody is critical to promote maximal skeletal muscle hypertrophy. Proc Natl Acad Sci U S A. 2017;114(47):12448–53. 10.1073/pnas.1707925114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Newfeld SJ, Wisotzkey RG, Kumar S. Molecular evolution of a developmental pathway: phylogenetic analyses of transforming growth factor-beta family ligands, receptors and Smad signal transducers. Genetics. 1999;152(2):783–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kahlem P, Newfeld SJ. Informatics approaches to understanding TGFbeta pathway regulation. Development. 2009;136(22):3729–40. 10.1242/dev.030320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Munz B, Hubner G, Tretter Y, Alzheimer C, Werner S. A novel role of activin in inflammation and repair. J Endocrinol. 1999;161(2):187–93. 10.1677/joe.0.1610187 [DOI] [PubMed] [Google Scholar]
  • 47.Song W, Cheng D, Hong S, Sappe B, Hu Y, Wei N, et al. Midgut-Derived Activin Regulates Glucagon-like Action in the Fat Body and Glycemic Control. Cell Metab. 2017;25(2):386–99. 10.1016/j.cmet.2017.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Song W, Owusu-Ansah E, Hu Y, Cheng D, Ni X, Zirin J, et al. Activin signaling mediates muscle-to-adipose communication in a mitochondria dysfunction-associated obesity model. Proc Natl Acad Sci U S A. 2017;114(32):8596–601. 10.1073/pnas.1708037114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Fincher CT, Wurtzel O, de Hoog T, Kravarik KM, Reddien PW. Cell type transcriptome atlas for the planarian Schmidtea mediterranea. Science. 2018;360(6391). 10.1126/science.aaq1736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Scimone ML, Wurtzel O, Malecek K, Fincher CT, Oderberg IM, Kravarik KM, et al. foxF-1 Controls Specification of Non-body Wall Muscle and Phagocytic Cells in Planarians. Curr Biol. 2018;28(23):3787–801 e6. 10.1016/j.cub.2018.10.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Baguñà J, Saló E, Auladell C. Regeneration and pattern formation in planarians. III. Evidence that neoblasts are totipotent stem cells and the source of blastema cells. Development. 1989;107:77–86. [Google Scholar]
  • 52.Newmark P, Sánchez Alvarado A. Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Dev Biol. 2000;220(2):142–53. 10.1006/dbio.2000.9645 [DOI] [PubMed] [Google Scholar]
  • 53.Reddien PW, Oviedo NJ, Jennings JR, Jenkin JC, Sánchez Alvarado A. SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells. Science. 2005;310:1327–30. 10.1126/science.1116110 [DOI] [PubMed] [Google Scholar]
  • 54.Eisenhoffer GT, Kang H, Sánchez Alvarado A. Molecular analysis of stem cells and their descendants during cell turnover and regeneration in the planarian Schmidtea mediterranea. Cell Stem Cell. 2008;3(3):327–39. 10.1016/j.stem.2008.07.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Bardeen CR, Baetjer FH. The inhibitive action of the Roentgen rays on regeneration in planarians. J Exp Zool. 1904;1:191–5. [Google Scholar]
  • 56.Dubois F. Démostration de la migration des cellules de régénération des planaries par le méthode des greffes et des irradiations combinées. Séance. 1948:1316–8. [Google Scholar]
  • 57.Hayashi T, Motoishi M, Yazawa S, Itomi K, Tanegashima C, Nishimura O, et al. A LIM-homeobox gene is required for differentiation of Wnt-expressing cells at the posterior end of the planarian body. Development. 2011;138(17):3679–88. 10.1242/dev.060194 [DOI] [PubMed] [Google Scholar]
  • 58.Schad EG, Petersen CP. STRIPAK Limits Stem Cell Differentiation of a WNT Signaling Center to Control Planarian Axis Scaling. Curr Biol. 2020;30(2):254–63 e2. 10.1016/j.cub.2019.11.068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wurtzel O, Oderberg IM, Reddien PW. Planarian Epidermal Stem Cells Respond to Positional Cues to Promote Cell-Type Diversity. Dev Cell. 2017;40(5):491–504 e5. 10.1016/j.devcel.2017.02.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Rink JC, Gurley KA, Elliott SA, Sánchez Alvarado A. Planarian Hh signaling regulates regeneration polarity and links Hh pathway evolution to cilia. Science. 2009;326(5958):1406–10. 10.1126/science.1178712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Yazawa S, Umesono Y, Hayashi T, Tarui H, Agata K. Planarian Hedgehog/Patched establishes anterior-posterior polarity by regulating Wnt signaling. Proc Natl Acad Sci U S A. 2009;106(52):22329–34. 10.1073/pnas.0907464106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Glazer AM, Wilkinson AW, Backer CB, Lapan SW, Gutzman JH, Cheeseman IM, et al. The Zn finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis. Dev Biol. 2010;337(1):148–56. 10.1016/j.ydbio.2009.10.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.DeRobertis E, Sasai Y. A common plan for dorsoventral patterning in Bilateria. Nature. 1996;380(6569):37–40. 10.1038/380037a0 [DOI] [PubMed] [Google Scholar]
  • 64.Orii H, Watanabe K. Bone morphogenetic protein is required for dorso-ventral patterning in the planarian Dugesia japonica. Dev Growth Differ. 2007;49(4):345–9. 10.1111/j.1440-169X.2007.00931.x [DOI] [PubMed] [Google Scholar]
  • 65.Molina MD, Saló E, Cebria F. The BMP pathway is essential for re-specification and maintenance of the dorsoventral axis in regenerating and intact planarians. Dev Biol. 2007;311(1):79–94. 10.1016/j.ydbio.2007.08.019 [DOI] [PubMed] [Google Scholar]
  • 66.Reddien PW, Bermange AL, Kicza AM, Sánchez Alvarado A. BMP signaling regulates the dorsal planarian midline and is needed for asymmetric regeneration. Development. 2007;134(22):4043–51. 10.1242/dev.007138 [DOI] [PubMed] [Google Scholar]
  • 67.Erter CE, Solnica-Krezel L, Wright CV. Zebrafish nodal-related 2 encodes an early mesendodermal inducer signaling from the extraembryonic yolk syncytial layer. Dev Biol. 1998;204(2):361–72. 10.1006/dbio.1998.9097 [DOI] [PubMed] [Google Scholar]
  • 68.Agius E, Oelgeschlager M, Wessely O, Kemp C, De Robertis EM. Endodermal Nodal-related signals and mesoderm induction in Xenopus. Development. 2000;127(6):1173–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Burdine RD, Schier AF. Conserved and divergent mechanisms in left-right axis formation. Genes Dev. 2000;14(7):763–76. [PubMed] [Google Scholar]
  • 70.Hamada H, Meno C, Watanabe D, Saijoh Y. Establishment of vertebrate left-right asymmetry. Nat Rev Genet. 2002;3(2):103–13. 10.1038/nrg732 [DOI] [PubMed] [Google Scholar]
  • 71.Nonaka S, Shiratori H, Saijoh Y, Hamada H. Determination of left-right patterning of the mouse embryo by artificial nodal flow. Nature. 2002;418(6893):96–9. 10.1038/nature00849 [DOI] [PubMed] [Google Scholar]
  • 72.Schier AF. Nodal signaling in vertebrate development. Annu Rev Cell Dev Biol. 2003;19:589–621. 10.1146/annurev.cellbio.19.041603.094522 [DOI] [PubMed] [Google Scholar]
  • 73.Peterson AJ, O’Connor MB. Strategies for exploring TGF-beta signaling in Drosophila. Methods. 2014;68(1):183–93. 10.1016/j.ymeth.2014.03.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Munz B, Smola H, Engelhardt F, Bleuel K, Brauchle M, Lein I, et al. Overexpression of activin A in the skin of transgenic mice reveals new activities of activin in epidermal morphogenesis, dermal fibrosis and wound repair. EMBO J. 1999;18(19):5205–15. 10.1093/emboj/18.19.5205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Wankell M, Munz B, Hubner G, Hans W, Wolf E, Goppelt A, et al. Impaired wound healing in transgenic mice overexpressing the activin antagonist follistatin in the epidermis. EMBO J. 2001;20(19):5361–72. 10.1093/emboj/20.19.5361 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Bryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep. 2017;18(3):762–76. 10.1016/j.celrep.2016.12.063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Weiss J, Harris PE, Halvorson LM, Crowley WF, Jr., Jameson JL. Dynamic regulation of follicle-stimulating hormone-beta messenger ribonucleic acid levels by activin and gonadotropin-releasing hormone in perifused rat pituitary cells. Endocrinology. 1992;131(3):1403–8. 10.1210/endo.131.3.1505470 [DOI] [PubMed] [Google Scholar]
  • 78.Vassalli A, Matzuk MM, Gardner HA, Lee KF, Jaenisch R. Activin/inhibin beta B subunit gene disruption leads to defects in eyelid development and female reproduction. Genes Dev. 1994;8(4):414–27. 10.1101/gad.8.4.414 [DOI] [PubMed] [Google Scholar]
  • 79.Xia Y, Schneyer AL. The biology of activin: recent advances in structure, regulation and function. J Endocrinol. 2009;202(1):1–12. 10.1677/JOE-08-0549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Pearson BJ, Eisenhoffer GT, Gurley KA, Rink JC, Miller DE, Sánchez Alvarado A. Formaldehyde-based whole-mount in situ hybridization method for planarians. Dev Dyn. 2009;238(2):443–50. 10.1002/dvdy.21849 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Gregory P Copenhaver, A Aziz Aboobaker

1 Jun 2020

Dear Dr Reddien,

Thank you very much for submitting your Research Article entitled 'activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

A. Aziz Aboobaker

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: Cloutier, Oderberg, and Reddien

Activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis

PGENETICS-D-20-00448

In this manuscript, Cloutier and colleagues investigate the mechanism through which planarian Activin-2 affects body polarity and regeneration. Building upon prior work from the Reddien group and others, this manuscript shows that activin-2 RNAi causes pleiotropic phenotypes that sometimes include ectopic heads in the posterior of the animal. The authors further show evidence that notum expression is not asymmetrical at 18 hours post-amputation in activin-2 RNAi animals, which may lead to subsequent polarity defects. This work is thorough, with well-designed experiments and beautiful images and thorough quantification throughout. The work adds to our understanding of planarian polarity signaling, particularly after injury. The authors present a strong body of work that should be interesting to the readers of PLoS Genetics. The manuscript should be acceptable for publication once the following concerns are addressed. Nearly all of the listed concerns should be addressable with writing changes or potentially quantification or inclusion of existing results.

Major concerns:

1. At times, the authors misrepresent the novelty of their contribution in this manuscript. For example, they make claims like “Activin signaling was previously not known to regulate regeneration polarity” and “Here we report an unexpected role for Activin signaling in controlling head-versus-tail regeneration in planarians.” They also declare that they are showing a “novel” activin-2 RNAi phenotype. These claims are somewhat misleading. Activin-2 has been previously characterized in Gavino, et al (eLife 2013) and Roberts-Galbraith and Newmark (PNAS 2013) (activin-2=activin in the PNAS paper). Undoubtedly, this new manuscript reports additional phenotypes (ectopic posterior heads), probably due to better penetrance of the RNAi or differences in experimental timing. Additionally, this manuscript reports a more detailed mechanism for this phenotype and takes the prior findings in exciting new directions. But throughout the manuscript, the authors should be clearer about what is new in this work and how it relates to prior research. In particular, the data presented in the PNAS paper implicated Activin signaling in polarity and in inhibition of anterior fates, so this manuscript ties nicely into the prior model.

2. The data that are used to support the argument that Activin-2 is important in Notum asymmetry are sometimes a bit unclear.

A) First, the data presented only support symmetrical notum expression after activin-2 RNAi at 18h post-amputation (Supp. Fig. 4A). Is that correct? I think that the average reader might reasonably conclude that Notum expression is symmetrical throughout regeneration after activin 2 RNAi (e.g. “We conclude that Activin has an essential role in the asymmetric activation of notum… during planarian whole-body regeneration.”). The authors should consider moving the data from Supp. 4A into the main text to avoid this confusion, perhaps with more quantification of the symmetry of expression over time. Words like “transient” to remind the reader of the temporal nature of the phenotype might also be helpful.

B) The data in 3B are also a bit confusing, perhaps because Notum is expressed predominantly in the anterior (normally) and thus posterior RPM is hard to interpret in context. Are data available to show both posterior and anterior RPM (and/or potentially the anterior:posterior ratio) over time?

C) It seems that there is a bit of a logical disconnect between the transience of the symmetrical Notum phenotype and the striking nature of the long-term phenotype (including reexpression of posterior Notum in posterior heads, Fig. 6B). If Notum expression (or rather the symmetry of Notum expression) is back to normal by 24 h post-amputation, how do the authors think that the longer-term phenotypes arise? I think this disconnect could probably be addressed in the text or even in the discussion to help a reader connect the different elements of the phenotype in one coherent model. The model figure (Fig. 7) seems to omit a complexity of the story if polarity is symmetrical at 24 hpa.

3. The authors argue that the activin-2 phenotype with regards to polarity is “regeneration-specific.” However, the authors also state that “subtle anterior shifting of wntP-2 expression domain length could not be excluded.” Have the authors attempted to quantify the expression domains for ndl-3, wntP-2, and ndl-5 (e.g. head to anterior margin of the domain, length of the domain versus length of the animal) at day 20 post-amputation? The images do look somewhat different, which might mean there is also a homeostatic phenotype. Have the authors looked at AP gradient markers at later time points (e.g. 6 weeks). By that time point, there is a dramatic change in animal shape as well as a change in slit expression (Supp. Fig. 2) which indicates that ML polarity is affected homeostatically. My expectation is that AP might be affected then more strongly than at 3 weeks/20 days. If AP effects are not exclusive to regeneration, the language around this point probably need to be altered.

Minor concerns:

1. The authors show that activin-2 RNAi causes muscle disorganization and slit misexpression. The Activin pathway (at least the receptor) has also been shown to have a role in fissioning behavior (Arnold, 2019). Did the authors note any changes in behavior/movement in the activin 2 RNAi animals? Is it possible that muscle function is perturbed in these animals and – if so – could wound closure be affected? If failed would closure results in a wider or more uneven starting point for regeneration, could this contribute to splitting of heads/tails?

2. Did the authors try to “rescue” split heads or tails with slit(RNAi) to determine if the slit domain expansion was causative in other phenotypes?

3. In Fig. 1B, there seems to be extra chat staining in the anterior of the animal (in the middle of the head). Is this often seen in these animals? Do the authors think that this is out of place pharyngeal tissue, brain tissue, or something else? This might be another part of the improved phenotype worth mentioning.

4. The authors do not show expression of activin-2 after pre/postpharyngeal amputation and 18hpa. Is there evidence that activin-2 expression is asymmetric at 18 h? I think this information would be helpful in imagining how activin-2 might affect notum, but I would not recommend holding up the paper for this experiment, given current lab shutdowns for COVID-19.

5. Can the authors please clarify in the figure legend which animals were used for quantification in Fig. 1C? The denominators are not the same, so I think some stained animals were used for some but not all quantification, but I can’t be sure.

6. Is pigmentation affected by long-term activin-2 RNAi (Fig. 2A)?

7. Can the authors clarify the dosage of dsRNA in the methods (concentration or total mass)? Given that this work shows new phenotypes, potentially due to RNAi effectiveness, dosage information would be helpful.

8. The data from irradiation experiments were a bit challenging to interpret, especially since the time points post-irradiation are not 18 hpa. The result in Fig. 5B indicates that the asymmetry phenotype is stem cell independent. But the sub-lethal irradiation experiment with a time frame in which stem cells are largely recovered (Supp. 5C) shows no symmetric expression. Is the argument that sublethal irradiation prevents activin 2 RNAi animals from misspecifying muscle (or accumulating disorganized muscle) and then without muscle disorganization you don’t see symmetric notum expression? I think that, particularly for non-expert readers, the take-home message for these experiments could be clarified.

9. For RNAi experiments in which an interesting phenotype is seen in a minority of animals (e.g. Fig. 1B, 6C, 6E), it would be helpful to include the phenotypes that are most prominent, as well. This will help the reader to interpret data properly and get a feel for the full range of RNAi phenotypes.

Reviewer #2: In the manuscript by Cloutier et al., the authors investigate the roles of activin-2 in establishing regeneration polarity upon regeneration in the planarian S. mediterranea. Following transverse amputation of a planarian, a regeneration polarity decision must be made to appropriately regenerate a head at anterior-facing wounds and a tail at posterior-facing wounds. The expression of notum, a wnt signaling inhibitor, is the first indication of a differentiation between the anterior and posterior wound sites, as notum is preferentially expressed at anterior-facing wounds. This work demonstrates that following knockdown of activin-2, amputated worms regenerate ectopic heads at posterior facing wounds. Activin-2 knockdown worms also experience axis bifurcations at anterior and posterior regenerating blastemas. RNA sequencing analysis shows that activin-2 knockdown worms have symmetric notum expression at anterior and posterior wounds, but no other functionally significant alterations in early wound response gene expression. Interestingly, the authors show that production of new longitudinal muscle cells is required for this symmetric notum expression, suggesting that activin-2 exerts its effects during muscle cell differentiation. Later in regeneration, activin-2 RNAi worms express both anterior and posterior positional control genes at posterior-facing wounds, resulting in the generation of discrete anterior structures in the posterior. This suggests that activin-2 restricts wound-induced notum expression to anterior-facing wounds to promote tail regeneration at posterior-facing wounds and that activin-2 is a regulator of regeneration polarity. This work identifies the first regulator of asymmetric notum activation, providing important insight into the question of how planarians differentiate between anterior and posterior wounds. The data are high quality, however, some key experiments are missing, and/or over-interpreted. While the phenotypes are of interest, the mechanism for the most interesting phenotype, the axis bifurcation, is not thoroughly investigated.

Major Concerns

1. In the Introduction, a summary of known follistatin and activin and TGFB phenotypes known in planarians so far is warranted (which is significant). The current lines about activin and follistatin in planarians (lines 103-107) are vague and not helpful to the reader put your study into context of what is known and what is missing.

2. Need proper phylogenetic analyses of the TGFB family to resolve whether planarian activins are activins or myostatins in order to resolve exactly the issues raised in lines 122-128.

3. Line 168: seems like an over-interpretation to fit the authors “story” as opposed to objectively stating the reality that activin-2 is detected in every major cluster in scRNAseq, and in muscle subclustering, high expression was seen in DV-like and a sub-cluster of circular (not in all circular muscles as described and annotated in S1F).

4. The role of symmetric notum expression in the regeneration of ectopic posterior heads is compelling. However, the association between symmetric notum activation and axis bifurcation during regeneration is still unclear. The model figure as well as the nkx1.1 experiments seem to suggest that axis bifurcation in both anterior and posterior blastemas occurs as a result of symmetric notum activation, but as notum activation in the anterior is normal in activin-2 knockdown worms, it is unclear how bifurcated blastemas form in the anterior. Do the sublethally irradiated worms from Fig 5C eventually regenerate? If so, do the activin-2 knockdown worms with asymmetric notum activation still develop bifurcated blastemas?

5. There appears to be a larger number of cells expressing notum in uninjured activin-2 knockdown worms (Fig 2B) which was not discussed. This raises the question of whether there is a difference in the number of muscle cells expressing positional control genes during regeneration, and whether this contributes to the apparent increase in notum expression contributes to the bifurcations upon regeneration. In the cases where the anterior blastema regenerates as normal, is the number of pole cells normal as well? Quantification of foxD+ pole cells would address this issue across all phenotypes.

6. This paper mentions that Follistatin is required for the missing tissue response and is a regulator of Activin, but did not explore the role of Follistatin in regulating activin-2 during regeneration. The authors report that the missing tissue response is normal in activin-2 knockdown worms based on the expression of neoblast genes in RNAseq (lines 222-227). This should be supported with quantification of proliferation during the first 2dpa. Additionally, if Follistatin does act to inhibit activin-2 as well as activin-1, double RNAi of follistatin with nkx1.1 could be used to test the hypothesis that the bifurcations seen in nkx1.1 knockdown worms are due to a decrease in activin-2 expression.

7. A more in-depth analysis of the muscle cell subsets involved in the activin-2/notum response to injury would be beneficial, particularly given the extensive work previously done by this group on muscle cell subsets. The claim that newly-formed longitudinal muscle fibers are responsible for asymmetric notum activation could be better supported using myoD knockdown worms, where differentiation of new longitudinal muscle fibers is blocked (assuming it is feasible to generate myoD/activin-2 RNAi worms).

Minor Concerns

1. Structural issues (citing fig S3A before S1F). Never mentioning the top of S1F.

2. S1F would be helpful to be next to Fig 1D (or move 1D to supplemental).

3. The implications of the irradiation experiments were not fully discussed in the text. Do these results suggest that longitudinal muscle fibers have anterior/posterior orientation ‘encoded’ by activin signaling during differentiation? This is an interesting point that warrants further discussion.

4. 40 days of RNAi treatment was used to determine the effect of activin-2 knockdown at homeostasis. This ruled out other phenotypes excluding multiple pharynges in uninjured activin-2 knockdown worms. This time frame does not seem long enough to allow for sufficient tissue turnover.

5. Figure 3C: the RNA sequencing experiments are conducted at different time points with tissue at different amputation sites. It was unclear why the different tissue fragments were analyzed, as this was not addressed in the text.

6. The authors state that some genes changing in RNAseq do not look different by FISH in Fig. 3D. However, the images shown look substantially lower in the posteriors of activin-2 RNAi for fst, inhibitin, wnt-1, and wntless, while nlg-1 looks substantially higher.

7. The control and activin-2 RNAi images in Figure 5B are placed in opposite order to the rest of the figures (i.e. control on the right instead of on the left), which is confusing.

Reviewer #3: In the manuscript entitled ‘activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis’ Cloutier et al. report a very inspiring phenotype obtained after silencing Activin-2 in planarians. The authors show that activin-2 RNAi resulted in the regeneration of ectopic posterior heads following amputation. Importantly, they observe that notum, the main element of the Anterior signaling center, is not downregulated at 18h in P wounds, providing a molecular explanation for the ectopic posterior-heads. Activin-2 RNAi animals also showed AP axis splitting, and this was specific of regenerating animals, as it did not occurred during normal homeostasis. The authors conclude that Activin-2 could be one of the signals coming form the pre-existing tissue that controls notum expression (Wnt signalling levels) and thus to date it would be the earliest known step in establishing head-versus-tail identity.

The study is of general interest, as it boards general and important questions related with regeneration and tissue patterning. The experiments are properly planed and in general well exposed and justified. However, some interpretations could be misleading, and a deeper analysis and discussion of the main finding, that is, the maintenance of notum expression in P and the regeneration of poles with different identities, should be performed.

- The authors show that in Act-2 RNAi animals notum is not downregulated at 18h in P, and propose that it could be the cause of the multiple heads/tails in P. They also have some evidences that it could be related with the integrity of circular and longitudinal fibers, according to previous published results (Scimone et al. 2017). However, the present study lacks a more in deep analysis and discussion of the mechanism underlying this phenotype. How can it be that from a homogeneous expression of notum in the 18h P wound, few hours later different A and P organizing centers appear? First, it needs a more detailed description and quantification of the phenotypes, and second, some more experiments could be performed in order to explain how the increase of notum in P at 18h leads to multiple organizing centers with different identity. For instances, the timing of expression of not only notum but wnt1 during P regeneration (only 48 h are shown) could give some clues, as well as the analysis of the longitudinal and circular fibers at the region that must regenerate.

-In the abstract it is stated that ‘Activin-2 is required for this head-versus-tail regeneration decision’. And this appears to be a main conclusion of the study. However, the phenotype shows that Activin-2 seems to be required to restrict a unique axis, but not to decide the identity of the poles. The results show that notum is not downregulated in P, but in fact a tail is regenerated. The interpretation of the results should be more linked to the real observations.

-In the first section and the corresponding Figure 1 the authors describe the appearance of a ‘variable numbers of heads and tails in fragments with both head and tail amputated’. And they show a quantification in Figure 1C. The description and the quantification of the phenotypes observed must be more specific to really understand what is happening in Act-2 RNAi animals. What are really the buds they have in P, or in lateral positions? (SF1). They need to use markers of P and A identity. And how many tails, heads, o tail and heads, appear in P? 2, 3? When there are 3, the one in the middle is always P and the 2 lateral are A? When there are 2, each one has different identity? It’s necessary to show a detailed description and quantification to clarify this point, since it’s important to understand to which extent Act-2 has a role in polarity, or has a role in controlling notum, or in restricting the P organizing center… In fact, these are possibilities that are not properly discussed in the manuscript.

-In the quantification in Figure 1C it seems that A axis bifurcation takes place much later than P axis bifurcation. Why is it like that? In fact, in Figure 6A it is shown that at 72h notum expression is already splited in 2. Thus, why in the graph in Fig 1C there are so few bifurcated heads at 14-21 days? And why the number of splitted A heads increase with time? It should be discussed.

-Supp Fig 1B- In this experiment the animals have been regenerating for 14dpa, but they have been inhibited for 40 days, so the effect seen in the pharynges are due to tissue renewal, not to tissue regeneration. May be also the lateral buds. When analyzing regeneration, the timing of RNAi and amputation must be taken into account, otherwise one could take wrong conclusions. Furthermore, what is the identity of the lateral buds? Is this a common feature of the phenotype?

-The finding that during homeostasis polarity is not affected is very relevant, and it is not properly discussed.

-The analysis of the RNAseq is confusing. 14 genes displayed significantly different expression at 6 -18 hours but the authors argue that the analysis by FISH shows no differences. Where is it this FISH analysis? The genes in Figure 3D do not correspond to the ones in Table 2. And furthermore, if RNAseq analysis shows a differential expression, this result is more quantitative than a FISH, isn’t’ it?

-In Figure 3D, the authors conclude that there is no difference in the expression of those genes, but apparently wnt1 and wntless seem to be downreglated in P wounds in Act-2 RNAi animals. This result would be important for the study, since upregulation of notum could came together with downregulation of wnt1. This is a very important point that should be clearly solved.

-The conclusion of the RNAseq section is that ‘Of all wound-induced genes assessed by FISH and RNA sequencing, only notum was affected at the time point when AP regeneration polarity defects emerged following activin-2 RNAi’. This is a strong conclusion that, according to the previously exposed, lacks more supportive data.

-The RNAseq results show a very interesting result: notum appears to be expressed in P, and thus, coexpressed with wnt1, but it needs to be downregulated at 18h to make a tail. This result must be discussed.

- The authors show that the loss of notum polarity in activin-2 RNAi animals was observed at 21 but not at 7 and 14 days post-RNAi initiation. They hypothesize that ‘activin-2 could be required during muscle cell turnover to maintain regeneration polarity.’ What does it exactly mean? That Act-2 could be necessary for maintenance of the longitudinal/circular fibers integrity? In fact, the defects observed during homeostasis could fit with this hypothesis. But then, to test if this is true the authors should 1) see if after 7 -14-21 days of RNAi, the mRNA levels of act-2 are really downregulated at the same levels, and if it’s the case, then 2) analyze whether the longitudinal/circular muscles are differentially affected in the 3 situations in the region that will be amputated.

The irradiation experiments do not seem to clarify much the mechanism. In Figure 5B- is really the first image Act-2 RNAi, or it is the control, as in the rest of images? In any case, the conclusion is that notum is still expressed after 6000 rads in P, so at 16h the expression of notum does not depend on neoblast. This could be expected. At this timepoint some notum expression could be neoblast dependent and some could be neoblast independent. But what happens at 18h and later? This should be analyzed. Then after several days of low irradiation notum in P is not expressed anymore in act-2 RNAi animals, but what is the conclusion? That a healthy muscle is necessary to regenerate? How is the muscle in these animals? How are the other organs? May be the digestive system is the one related with notum expression, since irradiation affects all tissues.

Additional comments:

Lines 125-126. The authors refer to Kenny et al. for the classification of Activin-2. However, in this study Smed Activins are not included. A specific phylogegentic study of Smed Activins/myostatins should be cited or performed. It is important to be clear about the identity of the activin-2 that is the focus of the study. Even more, considering that in the introduction a comparison with activin/follistatin function in other systems is exposed, to suggest its function in animal regeneration.

Lines 134-137- The authors assume that multiple tails or heads appear at P, but in fact at this point of the study any P marker is analyzed, so the identity of the regenerated fragment cannot be really assessed.

Line 166- Figure S3E should be corrected to Figure S1E

Line 192- It reads after 60 days of RNAi but in the figure legend it reads at 40 days. What is the correct?

The interpretation of the graph in Figure 3C is really hard.

A scheme showing the RNAi and amputation timing of each experiment would be helpful.

Do changes in cell death or proliferation could give some clues about the function of Activin-2 in axial restriction?

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: No: RNAseq data will be released after publication.

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 1

Gregory P Copenhaver, A Aziz Aboobaker

21 Jan 2021

* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. *

Dear Dr Reddien,

Thank you very much for submitting your Research Article entitled 'activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscript

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

A. Aziz Aboobaker

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: Cloutier, McMann, Oderberg, and Reddien

Activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis

PGENETICS-D-20-00448

Most concerns from the prior review were adequately addressed.

Minor concerns:

1. I think that the authors have made some effort to put the work into prior context. I do recommend that the authors clearly state that their activin-2 is the same as activin in a prior publication, so that readers could better evaluate how this paper fits with prior results and models. It should not be incumbent on the reader to look up sequences and supplementary information to sort this out.

2. The authors did add a concentration of dsRNA but not a total volume. Can the authors please add whether 5-8 ug/ul is the concentration of the final liver+dsRNA mix or the initial concentration of dsRNA. If the latter, then the reader may also need to know what volume of dsRNA and what volume of liver mix were used. With the methods as written, an interested reader would not be able to replicate this experiment.

Reviewer #2: In the manuscript by Cloutier et al., the authors have made substantial improvements to the manuscript and work. Particularly appreciated was the amount of experiments performed in request of all of the reviewers, especially considering the difficult times. The clarity of the manuscript, as well as the completeness of the study is much more cohesive and will be of broad interest to the Plos Genetics readership as well as the planarian field. I believe that all of my previous concerns have been addressed by the authors.

Reviewer #3: In the revised version of the manuscript Cloutier et al. have properly answered and addressed the main concerns. The manuscript has improved substantially by including more detailed analysis of the phenotypes, which were necessary for their understanding. The study is now complete, although the interpretation of the data remains confusing:

1- The result sections include several paragraphs that could be integrated into the discussion. This would make it easy for the reader to follow. Also to simplify it, the last section of the results (Local PCG expression changes in activin-2 RNAi animals were associated with ectopic anterior neoblast fate specification) could be moved to supplementary and integrated with the previous one.

2-The results indicate that Activin-2 is restricting notum to the anterior wound at 18h, which is a key stage to specify the identity of the pole in the wounds. The co-expression of wnt1 and notum in posterior wounds leads to the range of defects in posterior regeneration described in the study. The problem is the conclusion about the mechanism of action of Activin-2 . The authors conclude that Activin-2 could be necessary for the establishment of a ‘polarity’ in the longitudinal fibers, which are the ones expressing notum. The main reasons underlying this conclusion are 1) that according to their interpretation, the muscular fibers do not appear affected in the activin-2 RNAi animals; and 2) inhibition of myoD+Activin2 avoids the ectopic expression of notum in posterior. However, 1) in Supp Fig 6 E the muscular fibers do not seem properly organized at 48h of regeneration in Activin-2 RNAi animals (in 21 days RNAi animals they could already be affected according to supp figure 3D). Regarding point 2) myoD inhibition decreases notum expression in anterior and posterior wounds. The quantitative difference between them could be a matter of timing, since, as the authors explain, the expression of notum in posterior wounds is delayed with respect to anterior, and this is a crucial point in the current interpretation of the data. According to the data, an alternative explanation could be that activin-2 is required for the proper regeneration of the muscular fibers (longitudinal and/or circular) and not for the establishment of a supposed polarity. This would also explain the duplication of poles seen in anterior wounds.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 2

Gregory P Copenhaver, A Aziz Aboobaker

3 Mar 2021

Dear Dr Reddien,

We are pleased to inform you that your manuscript entitled "activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

A. Aziz Aboobaker

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: 

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-20-00448R2

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

Acceptance letter

Gregory P Copenhaver, A Aziz Aboobaker

21 Mar 2021

PGENETICS-D-20-00448R2

activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis

Dear Dr Reddien,

We are pleased to inform you that your manuscript entitled "activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Alice Ellingham

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Phylogenetic analysis of Schmidtea mediterranea activin-2.

    Related to Fig 1. (A) Phylogenetic tree for the placement of Schmidtea mediterranea activin-2. Bayesian analysis of TGF- superfamily ligand proteins with a focus on Activins and Myostatins, where BMP-2/4 is used as an outgroup across species. Percent posterior probability is indicated at nodes. Smed (Schmidtea mediterranea), Nve (Nematostella vectenesis), Mmu (Mus musculus), Bfl (Branchiostoma floridae), Sko (Saccoglossus kowalevskii), Lgi (Lottia gigantea). In Mus musculus genes that contribute to Activin proteins are called inhibin, we used this nomenclature in the tree. Protein sequences are provided in S1 Data.

    (PDF)

    S2 Fig. Characterization of the activin-2 RNAi phenotype.

    Related to Fig 1. (A) RNAi control. Transcript abundance for TGF-β ligands and follistatin from bulk sequencing expression data in control and activin-2 RNAi animals. RPM is reads per million. Data is three replicates of a post-pharyngeal fragment. Related to S2 Data. (B) Regenerating activin-2 RNAi animals after 40 days of RNAi, and 14 days post amputation. The three representative images show examples of (Left) anterior axis bifurcation, (Middle) parapharyngeal bulging indicative of ectopic pharyngeal tissue; (Right) posterior axis bifurcation and loss of polarity resulting in ectopic posterior heads. (C) Negative results related to 1C. FISH shows (left) CNS (chat+) and mouth and esophagus (NB.22.1e) and (right) PCG expression (midline slit+; anterior sFRP-1+). Yellow arrow shows ectopic posterior mouth tissue. (D) DAPI shows intact (Left) and regenerated (Right) animals develop ectopic pharynges. Red arrows show anatomy. Phx = pharynx. (E) Intact activin-2 RNAi animals develop ectopic pharynges (Top) and ectopic mouth tissue (Bottom). At 21 days RNAi, 5/7 animals display an anteriorly expanded dd_554 domain, and a 6/7 display posteriorly expanded NB.22.1e domain. At 40 days RNAi, all animals assayed display ectopic pharynges and mouth tissue. (F) Ectopic pharynges express the transcription factor foxA, dd_554, and are connected to the (6G10+) muscularized gut by an NB.22.1e+ esophagus. 6G10 is a muscle antibody, other markers are RNA probes. (G) activin-2 expression at 0 and 24 hours post amputation in a midbody piece. (H) t-SNE representation of clustered cells (dots) colored according to single gene expression or cluster assignment based on global gene expression. (Top left) 50,562 cells [50] obtained by Drop-seq are colored according to major planarian tissue type cluster assignment. (Top right) Each cell is colored and sized by the average normalized expression of activin-2. (Bottom) Muscle cells obtained by Smart-seq2 [51] are colored according to planarian muscle cluster assignment. activin-2 expression is plotted on these cells. (I) (Top left) activin-2 is expressed in collagen-2+ muscle cells in the body-wall (Bottom left) activin-2 is expressed in mp-1+ muscle cells in the pharynx (Top right) activin-2 is expressed in the intestine. (Bottom right) activin-2 is highly expressed in an inner muscle wall of the pharynx, interior to slit+ cells. White shows co-localization. Scale bars represent 200 μm, except for high magnification panels in S1F (Left) where they represent 10 μm.

    (PDF)

    S3 Fig. Characterization of the activin-2 RNAi intact animal pattern.

    Related to Fig 2. (A) Graphs show body width/length per animal at different time points. Width quantified at widest point of the animal. (B) Intact activin-2 RNAi animals display proper PCG expression and pole presence at 21 days of activin-2 RNAi along the AP axis by FISH. (Pink) Anterior restricted genes, (Green) posterior restricted genes. act-2 is abbreviation for activin-2. (C) Quantification of PCG domain expression relative to animal length. The length to body ratio for ndl-3 and wntP-2 was blind scored following the landmarks show in the top left. Data are presented as mean +/- SD. A student’s t-test was performed to determine significance with a cutoff of p = 0.05. (D) Intact activin-2 RNAi animal midline (slit+) gene expression at 21 days and 40 days by FISH. (E) Intact animal muscle fibres (6G10+) at 21 days and 40 days activin-2 RNAi by immunofluorescence. 40 day RNAi animals display loss of orthogonal directionality of muscle fibres. (F) Intact activin-2 animal muscle cell gene expression (collagen-2) at 40 days of activin-2 RNAi by FISH. (G) Live images of intact control and activin-2 animals at 60 days of RNAi. (H) (Left) Immunofluorescence (6G10) of control and activin-2 animals showing muscle fibers, (Middle, Right) FISH of control and activin-2 RNAi animals showing central nervous system (chat), and PCGs (ndl-3, wntP-2) at 60 days of RNAi. (I) Intact activin-2 RNAi animals display maintenance of restriction of the anterior pole maker notum at 60 days RNAi by FISH.

    (PDF)

    S4 Fig. Characterization of the activin-2 RNAi animal wound response.

    Related to Fig 3. (A) Heatmap of top 100 muscle specific genes annotated in [19] from bulk sequencing of posterior-facing wounds at 0 hours post amputation after 21 days of either activin-2 or control RNAi (three wound sites per replicate). Each gene is a row, and each replicate is a column. Related to S2 Data. (B) Heatmap of wound induced gene expression from bulk sequencing of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post amputation, and anterior-facing wounds at 18 hours post amputation (three to four wound sites per replicate). Each gene is a row, and each replicate is a column. Related to S2S4 Data. Top: known wound induced genes expressed in muscle (notum, foxD, fst, inhibin-1, wntless, nlg-1, wnt1), epidermis (hadrian), neoblasts (runt-1), and broadly induced (fos-1). Bottom: known neoblast genes, expression increases indicate an increase in cycling cell number (C) Left: in situ hybridization of activin-2 at 18 hpa, Right: carton showing DE-Seq result from bulk sequencing data that there is no significant difference in activin-2 expression at 18 hpa between anterior- and posterior- facing wounds in control animals. (D-E) Wound-induced gene expression at 18 hours post amputation. Magenta denotes anterior-facing wound, and green denotes posterior-facing wound. (D) FISH shows genes that are expected to change given DEseq data. (F) Wound induced foxD expression is correlated to midline (slit+) width. activin-2 RNAi animals have a marked increase in midline (slit+) width by 35 days, and foxD expression at 6 hours post amputation is increased to a similar width (ventral view). (G) foxD expression in activin-2 RNAi animals is specific to longitudinal muscle (myoD+, snail+) at posterior-facing wounds by FISH. Pink number is number of myoD/snail+ cells co-localized with foxD. Yellow number is total foxD+ cells. White number is percent foxD cells that are longitudinal fibers. Scale bars represent 200 μm, except for the high magnification panel in S4G where they represent 10 μm.

    (PDF)

    S5 Fig. Characterization of symmetric wound-induced notum as turnover dependent.

    Related to Fig 5. (A) Wound-induced notum expression at posterior-facing wounds first appears after 21 days of RNAi (18 hpa) by FISH. (B) RT-PCR quantification of activin-2 expression at 7, 14, and 21 days of activin-2 or control RNAi. Relative expression is plotted as 2-ΔΔCT values. Data are plotted as mean ± S.D. NS if p>0.05. (C) Zoom out of EdU labeling with notum FISH seen in Fig 5A. Anterior- and posterior-facing wounds of activin-2 RNAi are shown. Animals were fed with EdU once at day 15 of activin-2 RNAi. (D) smedwi-1 (neoblast marker) gene expression in different irradiation conditions performed in Fig 5B and 5C. Left: control with no irradiation, Middle: 18 days post 1350 rads, Right: three days post 6000 rads. (E) activin-2 gene expression across conditions performed in Fig 4D and 4E. (F) RT-PCR for of activin-2 for RNAi condition stated. Relative expression is plotted as 2-ΔΔCT values. Data are plotted as mean ± S.D. NS if p>0.05. Magenta denotes anterior-facing wound, and green denotes posterior-facing wound. Scale bars represent 200 μm.

    (PDF)

    S6 Fig. Ectopic anterior fates and ectopic notum is locally expressed.

    Related to Fig 6. (A) Number of pole cells (notum+ and/or foxD+) of (Left) intact animals at 21 days RNAi, (Middle) intact animals at 40 days RNAi, and 72 hpa (hours post amputation) animals at 40 days of RNAi. Student’s t-test used to determine statistical significance. NS is >p 0.05 act-2 = activin-2. (B) FISH of poles (notum+ or foxD+) of intact animals at 40 days RNAi. (C) Quantification for Fig 6A. Width of control and activin-2 RNAi animal poles (40 days of RNAi) at 72 hpa. Each datapoint is width of pole/width of wound face. NS >0.05. (D) notum expression at wounds in a head fragment and a midbody fragment after six weeks of nkx1.1 (circular fiber transcription factor) RNAi. Green arrow shows elevation of posterior-facing notum at 18 hours post amputation. (E) Immunofluorescence (6G10) showing muscle fibers at posterior-facing wounds at 48 hpa. (F) Live images of animals showing wound contraction at 30’ post amputation. Holtfreter’s solution inhibits muscle contraction, and was used as a negative control.

    (PDF)

    S7 Fig. Ectopic anterior tissue forms at posterior-facing wounds in activin-2 RNAi.

    Related to Fig 6. (A) FISH shows expression of anterior pole marker (notum), and posterior pole marker (wnt1) in the same posterior-facing wound (Left: also shows anterior-facing wound) of an activin-2 RNAi regenerating fragment at 30 hours post amputation. Left: Magenta arrows show wnt1 cells proximal to posterior-facing wound. Green arrows show notum+ cells. White arrows denote cells that co-express notum and wnt1. 19 total animals were examined with varying FISH patterns; representative images of this experiment are shown here and in 7C. (B) FISH shows expression of anterior pole marker (notum), anterior PCG (sFRP-1), and posterior PCG (wntP-2) in the same posterior-facing wound (B). (C) FISH shows expression of anterior pole marker (notum), and posterior pole marker (wnt1) in the same posterior-facing wound of an activin-2 RNAi regenerating fragment at 48 hours. (D) Heatmap shows posterior PCGs and markers from bulk sequencing of posterior-facing wounds at 0, 6, 18, 24, and 48 hours post amputation, and anterior-facing wounds at 18 hours post amputation. Each gene is a row, and each replicate is a column. Related to S2 Data. (E) foxD and notum are co-expressed in the ectopic anterior pole at the posterior-facing wound of an activin-2 RNAi animal fragment at 72 hours post amputation. (F) Lower magnification of image shown in Fig 7C denotes close proximity between ovo+ eye progenitors and the anterior PCG sFRP-1 at a posterior-facing wound of an activin-2 RNAi animal at 48 hours post amputation. Scale bars, 200 μm.

    (PDF)

    S1 Data. This file contains a list of protein sequences used in the phylogenetic analysis presented in S1 Fig.

    Each sequence is annotated with species and available information of deposited location. This file also contains the trimmed input for Bayesian analysis from row 21–68.

    (XLSX)

    S2 Data. This file contains bulk RNA-sequencing analysis for regenerating control and activin-2 RNAi animals.

    The DESeq tool was used to calculate log2FC and padj for each condition. Each transcript is annotated with best BLAST hits.

    (XLSX)

    S3 Data. This file contains a list of contigs that are the union of FISH validated wound induced genes found in Wurtzel et al 2015 and Wenemoser et al 2012.

    Each transcript is annotated with best BLAST hits.

    (XLSX)

    S4 Data. This file contains a list of contigs that are the genes from S3 Data which significantly differ in S2 Data specifically at times 6 hpa and/or 18 hpa.

    The cutoff for this table is padj<0.001. Rows from S2 Data meeting these specifications were transposed into this table. Each transcript is annotated with best BLAST hits.

    (XLSX)

    Attachment

    Submitted filename: Cloutier_Reply to reviewers.pdf

    Attachment

    Submitted filename: Cloutier_Reviewer reply.docx

    Data Availability Statement

    All data is deposited and available at NCBI GSE148376.


    Articles from PLoS Genetics are provided here courtesy of PLOS

    RESOURCES