Skip to main content
Brain Pathology logoLink to Brain Pathology
. 2012 Feb 21;22(5):677–688. doi: 10.1111/j.1750-3639.2012.00566.x

Characterization of Glioma Stem Cells Through Multiple Stem Cell Markers and Their Specific Sensitization to Double‐Strand Break‐Inducing Agents by Pharmacological Inhibition of Ataxia Telangiectasia Mutated Protein

Alessandro Raso 1, Donatella Vecchio 2, Enrico Cappelli 3, Monica Ropolo 2, Alessandro Poggi 4, Paolo Nozza 5, Roberto Biassoni 6, Samantha Mascelli 1, Valeria Capra 1, Fotios Kalfas 7, Paolo Severi 7, Guido Frosina 2,✉
PMCID: PMC8057648  PMID: 22257080

Abstract

Previous studies have shown that tumor‐driving glioma stem cells (GSC) may promote radio‐resistance by constitutive activation of the DNA damage response started by the ataxia telangiectasia mutated (ATM) protein. We have investigated whether GSC may be specifically sensitized to ionizing radiation by inhibiting the DNA damage response. Two grade IV glioma cell lines (BORRU and DR177) were characterized for a number of immunocytochemical, karyotypic, proliferative and differentiative parameters. In particular, the expression of a panel of nine stem cell markers was quantified by reverse transcription‐polymerase chain reaction (RT‐PCR) and flow cytometry. Overall, BORRU and DR177 displayed pronounced and poor stem phenotypes, respectively. In order to improve the therapeutic efficacy of radiation on GSC, the cells were preincubated with a nontoxic concentration of the ATM inhibitors KU‐55933 and KU‐60019 and then irradiated. BORRU cells were sensitized to radiation and radio‐mimetic chemicals by ATM inhibitors whereas DR177 were protected under the same conditions. No sensitization was observed after cell differentiation or to drugs unable to induce double‐strand breaks (DSB), indicating that ATM inhibitors specifically sensitize glioma cells possessing stem phenotype to DSB‐inducing agents. In conclusion, pharmacological inhibition of ATM may specifically sensitize GSC to DSB‐inducing agents while sparing nonstem cells.

Keywords: brain tumor, cell cycle, glioblastoma, radiotherapy, resistance

INTRODUCTION

Patients with glioblastoma multiforme (GBM) (WHO grade IV) seldom recover. Despite some limited advances in surgical, radio‐ and chemotherapeutic protocols, their average life expectancy is still only 14 months [reviewed in (21)]. The presence of cellular subpopulations with ability to escape therapies and drive tumor progression might partly explain the dismal prognosis. In some cases, these resistant subpopulations express a number of stem cell markers including Prominin 1/CD133 (Prom1) and display stem properties [glioma stem cells (GSCs)], with ability to differentiate into neurons, oligodendrocytes or astrocytes 8, 21. Although it is known that multiple resistance mechanisms may occur in GSC, including multidrug resistance, autophagy and Notch activation [reviewed in (9)], the slow proliferative capability is probably a major one of them. In response to DNA damage, cells activate a temporary arrest of cell cycle (cell cycle checkpoints) allowing for processing of DNA damage before arrival of the replication fork. This response is started by sensing DNA damage by the Mre11‐Rad50‐Nbs1 (MRN) complex and human single strand DNA binding protein (hSSB) 1 with subsequent activation of the ataxia telangiectasia mutated (ATM) and Rad3‐related (ATR) kinases (Figure 1) (5). ATM and ATR, in turn, phosphorylate downstream effector proteins to activate cell cycle checkpoints at the G1/S, intra‐S and G2/M boundaries. Checkpoint proteins 1 and 2 (Chk1 and Chk2) are key downstream players of the DNA damage response. We recently observed that the activation of the DNA damage checkpoint response might be constitutive in GSC (19). The population doubling time was significantly increased while Chk1 and Chk2 were constitutively phosphorylated in untreated GSC compared with nonstem cells. Neither DNA base excision nor single strand break (SSB) repair nor resolution of pH2AX nuclear foci were upregulated in Prom1(+) compared with Prom1(−) cells 8, 19. The slow proliferation and elongated cell cycle may allow GSC increased time to repair therapy‐induced DNA damage before replisome arrival. Inhibiting the DNA damage checkpoint response may thus release the cell cycle brake of GSC, pushing them into proliferation and specifically sensitizing them to radiotherapy. Here we report one possible way to do so.

Figure 1.

Figure 1

The DNA damage response pathway, possible target in glioma stem cells (GSC). After DNA damage is sensed by the Mre11‐Rad50‐Nbs1 (MRN)/human single strand DNA binding protein 1 (hSSB1) complex, the checkpoint transducers ataxia telangiectasia mutated (ATM) and ataxia telangiectasia Rad3‐related (ATR) change their conformation and/or localization, resulting in their activation. In turn, ATM and ATR activate a number of downstream molecules, including the checkpoint kinases 1 (Chk1) and 2 (Chk2). Chk1 and Chk2 are responsible for inhibition of cell division cycle (CDC) 25, a phosphatase required for activation of cyclin‐dependent kinases (Cdk) resulting in cell cycle arrest. KU‐55933 and KU‐60019 are specific inhibitors of ATM. Gö 6976 is a specific inhibitor of Chk1. BML‐277 is a specific inhibitor of Chk2. (Adapted and reprinted by permission from the American Association for Cancer Research—ref. (5).)

MATERIALS AND METHODS

Chemicals

KU‐55933 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA, product code: sc‐202963). KU‐60019 was purchased from Selleck Chemicals (Houston, TX, USA, product code: S1570). Gö 6976 was purchased from Sigma‐Aldrich (St. Louis, MO, USA, product code: G1171). BML‐277 was purchased from Enzo Life Sciences (Lausen, Switzerland, product code: BML‐EI388).

Cell lines and culture conditions

BORRU and DR177 cell lines derived from two adult GBM. BORRU cells had been isolated from a 74‐year‐old male patient and they have been previously described (19). The newly established DR177 cell line was derived from a hemispheric tumor of a 68‐year‐old Caucasian woman. Tissue surplus to diagnostic requirements was processed for isolation of GSC, according to Raso et al (17) with modifications. Briefly, tissue was washed with Dulbecco's modified Eagle's minimal essential medium (DMEM, Gibco‐Invitrogen, Milan, Italy), minced and triturated and cells were seeded at a concentration of 100 000 per mL into tissue culture flasks coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). Cells were grown in a proliferation medium containing DMEM‐F12/NSA and B27 supplement without vitamin A (1:50; Gibco‐Invitrogen), recombinant human fibroblast growth factor (FGF‐2, 10 ng/mL, Peprotech, Rocky Hill, NJ, USA), recombinant human epidermal growth factor (EGF, 20 ng/mL, Peprotech). Medium was routinely changed twice a week. Under these conditions, the cells adhered and grew in flasks into a monolayer and they maintained intact self‐renewal capacity. In the absence of matrigel, cells predominantly grew forming suspended neurospheres. Removal of growth factors and addition of 10% fetal calf serum (FCS) to the proliferation medium, after approximately 2 weeks, induced GSC differentiation, giving acquisition of astrocytic/neuronal morphology and increasing expression of the differentiation markers synaptophysin (SYN) and glial fibrillary acidic protein (GFAP) (Table 1).

Table 1.

Immunocytochemical and karyotypical characterization of DR177. Abbreviation: EGF‐FGF = epidermal growth factor‐fibroblast growth factor; FCS = fetal calf serum; ND = not done

Immunocytochemical Karyotypical
Antibody Clone Conditions Chr 72,XX,+del(1p),+del(1p),+rea(4)
EGF/FGF FCS X
SYN 27G12 (Novocastra) − + Y −
GFAP GA5 (Novocastra) + +++ 1 +2del(1p)
MAP2a,b AP20 (Thermo Scientific) ++ ++ 2 +
CD56 1B6 (Novocastra) +++ ND 3 ++
Vimentin V9 (Novocastra) +++ +++ 4 +der(4)
Nestin polyclonal (Chemicon) +++ +++ 5 +
Neu‐N NEU‐N (Chemicon) − − 6
Neu‐68 DA2 (Novocastra) − − 7 ++++++
Neu‐200 N52.1.7 (Novocastra) − − 8
p53 DO‐7 (Novocastra) ++ ND 9 −
Ki‐67 MM1(Novocastra) +++ +++ 10
EMA GP1.4 (Novocastra) − − 11 +
CD15 BY87 (Novocastra) − ND 12 +++
CD31 1A10 (Novocastra) − − 13
CD57 NK‐1 (Novocastra) +++ +++ 14 +++
CD34 QBEnd 10 (Novocastra) − − 15 ++
CD56 NCAM (Novocastra) +++ ND 16
p‐S100 polyclonal (Novocastra) +++ +++ 17 +
18
19 ++
20 ++
21 ++
22

Note to Immunocytochemical data: +++, >70% positive cells; ++, 30–70% positive cells; +, <30% positive cells; −, negative reaction. Novocastra mAbs were purchased from Leica Biosystems (Newcastle, U.K.); anti‐MAP2a,b mAb was purchased from Thermo Fisher Scientific (Fremont, CA, USA); Chemicon mAbs were purchased from Millipore (Billerica, MA, USA). Note to Karyotypical data: −, loss of whole chromosome; +, gain of whole chromosome.

Morphological characterization and p53 status

Cells were cultured in the presence of growth factors (stem conditions) or FCS (differentiating conditions) for 14 days and photographed with an inverted microscope (Olympus Europa Holding, Hamburg, Germany) equipped with a 20× objective in transmitted light.

Mutational screening of the p53 tumor suppressor gene (OMIM # 191117) was performed on the entire coding sequence. Four contiguous amplicons ranging from 347 to 615 bp with high primer overlap were directly sequenced on cDNA using the CEQ DTCS‐Quick Start kit (Beckman Coulter, Fullerton, CA, USA) and subsequently analyzed with the CEQ2000XL DNA Analysis System (Beckmann Coulter). These four segments included a minimal promoter sequence beginning 47 bp upstream from the transcription start site (5′UTR). The results were compared with the functional database of the p53 protein (IARC TP53 database; http://www‐p53.iarc.fr).

Immunocytochemical and karyotypical characterization

Cytospins containing up to 5 × 105 cells/slide were prepared and fixed with 4% paraformaldehyde and incubated with antibodies (Ab) as summarized in Table 1. Cells were stained with hematoxylin and eosin (H&E). Slides tested with polyclonal Ab were sequentially incubated with a rabbit anti‐mouse Ab (Dako, Glostrup, Denmark) and alkaline phosphatase anti alkaline phosphatase (APAAP) complex (Dako), for 30 minutes at room temperature (RT). Slides tested with monoclonal Ab were visualized by incubating with the Envision Labelled Polymer‐AP (Dako) for 30 minutes at RT. Alkaline‐phosphatase substrate (Fuchsin, Dako) was subsequently added as chromogen. Quantification of cells positive for a specific marker was carried out by counting all the stained cells within 20 randomly selected fields per specimen, and the percentage was calculated based on the total number of the counted nuclei. The karyotype was determined using conventional cytogenetic analysis as described (22). Two different passages were analyzed.

Flow cytometry

The reactivity of monoclonal anti‐Prom1 Ab was assessed by indirect immunofluorescence and flow cytometric analysis. In detail, 104 adherent cells were harvested with 0.5 mM ethylenediaminetetraacetic acid (EDTA) in phosphate‐buffered saline (PBS), washed, suspended in buffer [2% bovine serum albumin (BSA) in PBS] and stained with anti‐Prom1 (clone: AC133; Miltenyi Biotech, Paris, France) followed by a phycoerythrin (PE)‐conjugated anti‐isotype‐specific goat anti‐mouse antiserum (Southern Biotechnology Associated, Birmingham, AL, USA) as second‐step reagent. The PE‐conjugated second reagent Ab alone was used as negative control and all samples were analyzed for single‐color cytofluorimetric analysis (FACSCalibur Becton Dickinson, Mountain View, CA, USA). Cells were gated by forward and side scatter parameters and results are expressed as logarithm of red fluorescence intensity (arbitrary units) vs. number of events. For each analysis, 10 000 events were counted.

For cell cycle analysis, 90 000 cells were plated in 35 mm dishes, exposed to 1 µM KU‐55933 for 30 minutes, irradiated with 5 Gy and incubated for 192 hours. Cells were then harvested by PBS‐EDTA treatment, washed with PBS, fixed in 70% ethanol/water and permeabilized with 0.0015% NP40, washed and stained with 50 µg/mL propidium iodide (PI) solution containing 100 units/mL RNase type A, 10 mM EDTA. Samples were run on CyAn ADP cytofluorimeter (Beckman‐Coulter, Brea, CA, USA) and analyzed by the ModFit 3.2 computer program (Verity Software House, Topsham, ME, USA).

Quantitative reverse transcription‐polymerase chain reaction (RT‐PCR)

The minimum information for publication of quantitative real‐time PCR experiments (MIQE) (6) is provided as follows. Total RNA was extracted from 106 cells by using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) combined with silica column purification system (Invitrogen, Carlsbad, CA, USA) to optimize the isolation of high‐quality RNA. Quantification and quality assurance were performed using the NanoDrop spectrophotometer (NanoDrop Technologies Wilmington, DE, USA) and the Agilent 2100 bioanalyzer (Agilent Technologies, Waldbronn, Germany), respectively. Double‐stranded cDNA synthesis was performed using a two‐step cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) with Oligo(dT) 20 priming. Expression of stemness genes was assessed by quantitative PCR (qPCR) using in‐house designed systems following a fine‐tuning procedure (18). Amplifications were carried out in singleplex runs on 25 µL using Express‐Sybr GreenER qPCR‐SuperMix Universal (Invitrogen, Carlsbad, CA, USA) and specific primers were developed targeting the following genes: Bmi1 (NM 005180), CD15 (NM002033), Musashi (Msi) 1 (NM 002442), Msi2 (NM 170721), Nanog (NM 024865), Nestin (NM 006617), Oct4 (NM 001159542) and Sox2 (NM 003106). Table 2 lists primers used for marker analysis. Prom1 analysis was performed as previously described (18). qPCR efficiencies of each system were calculated using the equation: E = 10−1/slope and data were considered comparable when the difference between the efficiencies was <0.1 (16). The normalized fluorescent signal was automatically calculated using an algorithm that normalizes the reporter emission signal. The threshold value applied to the algorithm generating the threshold cycle (Ct) was set at 0.05 in all experiments. Nonfluorescent signals were generated by these assays when genomic DNA was used as substrate. The relative quantification of genes transcript was performed according to the comparative method (2‐ΔΔCt, Applied Biosystems User Bulletin no. 2P/N 4303859) using the value emerged by the median of Pmk2 and B2M as the normalizer (Ctref) and BORRU under differentiative conditions (FCS) as tissue control (ΔCtref).

Table 2.

Stemness markers: quantitative PCR (qPCR) systems

No. Gene Sense primers 5′‐3′ sequences Working concentration (nM) Anti‐sense primers 5′‐3′ sequences Working concentration (nM) Amplicon (bp)
1 Prom1 ATTGGCATCTTCTATGGTTT 300 GCCTTGTCCTTGGTAGTGT 300 167
2 Bmi1 ATGCCACAACCATAATAGAAT 300 TTTGAAAAGCCCTGGAACT 150 186
3 CD15 CTCGCAGCACCTGGATTA 150 GCGGTCGAGGAAAAGCA 50 103
4 Msi1 AGCCCAAGATGGTGACTC 500 GTCCACCTTCCCAAACTG 300 107
5 Msi2 GGGTTATCTGCGAACACAGTA 100 CCCTCTGTGCCTGTTGGTA 50 111
6 Nanog CCTATGCCTGTGATTTGTG 600 TTGGGACTGGTGGAAGAA 200 149
7 Nestin CGCACCTCAAGATGTCC 500 GAGCAAAGATCCAAGACGC 100 126
8 Oct4 CCTGGGGGTTCTATTTGG 200 ACGAGGGTTTCTGCTTTG 250 171
9 Sox2 CCAGCTCGCAGACCTAC 500 GAGTGGGAGGAAGAGGTAAC 500 204

ATM assay

BORRU cells were seeded in 25 cm2 flasks and grown under stem or differentiative (FCS) conditions. Cells were irradiated with 5 Gy ionizing radiation and extracted at the indicated times with Cell Extraction Buffer (Life Technologies, Milan, Italy) containing phosphatase inhibitors plus protease inhibitor cocktail (Sigma, St. Louis, MO, USA). Total proteins were separated by SDS‐PAGE on 15% polyacrylamide gels (60 µg per lane) and were transferred to nitrocellulose membranes using iBlot‐Dry Blotting System (Life Technologies) according to the manufacturer's instructions. The membranes were then incubated with mouse monoclonal antibodies against: p53 phospho‐serine 15 specific antibody (Cell Signaling Technology, Danvers, MA, USA), p53‐specific (BIOCI, Airasca, Italy) and β‐actin (Cell Signaling Technology). Peroxidase‐conjugated goat anti‐mouse antibody was used as secondary antibody (Santa Cruz Biotechnology, Heidelberg, Germany). Immune complexes were visualized with the use of a Supersignal West Pico Chemiluminescent Substrate (Euroclone, Milan, Italy) on autoradiography films according to the manufacturer's instructions.

Survival

1500–5000 cells were seeded in 96‐well plates. The day after, cells were preincubated for 30 minutes at 37°C in complete medium with either the indicated ATM inhibitors or solvent [dimethylsulphoxide (DMSO)] and then treated. Treatment with ionizing radiation was performed by a CIS Bio International IBL437C irradiator at a fluence of 0.14 Gy/second. Treatment with camptothecin (CPT), mitomycin C (MMC) and hydroxyurea (HU) was performed by addition of the drug diluted in complete stem medium to the wells. Cells were then incubated at 37°C for 192 hours with no medium change. Survival was evaluated by the In Vitro Toxicology Assay Kit MTT‐based (Sigma, St. Louis, MO, USA). DMSO concentration never exceeded 0.38% v/v.

Statistics

The two‐tailed “Student's”t‐test was used. The nonparametric Wilcoxon paired t‐test was used for analysis of qRT‐PCR data. Statistical significances (P < 0.05; P < 0.01) were indicated with one (★) and two (★★) stars, respectively. Statistical analysis was performed using the statistical software GraphPad Prism 5.01 for Windows.

RESULTS

Establishment and characterization of DR177 glioma cell line

The DR177 cell line was derived from the GBM of a 68‐year‐old Caucasian woman. The culture was continuously passaged in vitro for more than 1 year with no changes in its morphology, proliferation, differentiation patterns as well as subsphere‐forming capacity, thus confirming its long‐term self‐renewal ability. The cells were oval to spindle in shape displaying nuclei with coarse chromatin and eosinophilic cytoplasm (Figure 2A). Mitotic figures were easily seen. The immunocytochemical characterization of DR177 is shown in Table 1 and Figure 2B,C. The stem cell phenotype (cells grown under serum‐free conditions in the presence of EGF and FGF) was associated with high levels of nestin (Figure 2B), while GFAP was only expressed by the neurospheres external layer (Figure 2C). When DR177 cells were cultured under differentiative conditions (absence of EGF‐FGF and presence of FCS), an increase of GFAP (a marker of differentiation to the astroglial lineage) and SYN (a marker of synaptic vesicles plasticity) expression was seen (Table 1). To assess the karyotype of the DR177, two passages were examined (3rd, 10th). The karyotype pattern remained stable in both stages, showing a modal chromosome number of 72, with either numerical or structural aberrations (Table 1).

Figure 2.

Figure 2

Characterization of the DR177 cell line. A. Morphological appearance (hematoxylin and eosin, ×100). B. Nestin expression (×100). C. Glial fibrillary acidic protein (GFAP) (×100).

Comparison of BORRU and DR177 glioma cell lines

BORRU cells derived from adult GBM have been previously described (19). Figure 3 shows a phenotypical comparison of BORRU and DR177 cells. Both BORRU and DR177 cells could be grown under serum‐free conditions in the presence of EGF and FGF (Figure 3A–D); moreover, they could be grown under either adherent conditions (provided culture vessels were matrigel coated—Figure 3A,B) or as suspension cultures in uncoated vessels where they formed relatively uniform round or oval neurosphere colonies (Figure 3C,D). Neither cell line harbored p53 mutations of the coding sequence associated with any loss of function (data not shown).

Figure 3.

Figure 3

Comparison of BORRU and DR177 glioma cell lines. A,B. Phase‐bright of cell cultures under epidermal growth factor‐fibroblast growth factor (EGF‐FGF)/serum‐free conditions in matrigel‐coated vessels (×20). C,D. Phase‐bright of neurosphere colonies under EGF‐FGF/serum‐free conditions in uncoated vessels (×20). E. Relative quantification of stem cell markers (Prom1, Bmi1, CD15, Msi1, Msi2, Nanog, Nestin, Oct4 and Sox2) in stem (EGF‐FGF) or differentiated [fetal calf serum (FCS)] cells. BORRU under differentiative conditions (FCS) were used as tissue control (ΔCtref). Data are the means ± SD of three experiments. F. Cytofluorimetric analysis of Prom1 on cell lines under EGF‐FGF/serum free conditions; gray profiles indicate the positive cell population, white profiles refer to cells incubated with the second reagent only. G. Proliferative activity; 0.5 × 106 cells were seeded under the indicated conditions and counted after 4 and 8 days. Data are the means ± SEM of three independent experiments. H,I. Phase‐bright of differentiated cells under 10% FCS (×20).

Figure 3E shows the relative gene expression of the stem cell markers. Expression of stem cell markers Prom1, Bmi1, CD15, Msi1, Msi2, Nanog, Nestin, Oct4 and Sox2 were determined for BORRU and DR177 cells by qPCR. All markers were expressed at a significantly higher level in BORRU as compared with DR177 cells. Hence BORRU cells displayed a stem cell marker expression phenotype that was significantly more pronounced as compared with DR177 cells. The Prom1 epitope (AC133) was further evaluated by flow cytometry (Figure 3F). The majority of BORRU cells (90%) harbored AC133 while it was present only in 1.33% of DR177. Figure 3G shows that DR177 cells grown under stem conditions (EGF‐FGF) proliferated faster than BORRU cells, especially from 4 to 8 days after seeding. Removal of growth factors and supplementation with 10% FCS resulted in differentiation of BORRU cells after approximately 2 weeks. Under those conditions, BORRU cells acquired astrocytic/neuronal morphology (Figure 3H), the expression of stem markers including Prom1 was ablated (Figure 3E) and their proliferation was arrested (Figure 3G), thus indicating that BORRU cells possess differentiation capacity. The latter was lower in DR177 cells cultured under the same conditions. Few DR177 cells acquired an astrocytic/neuronal morphology, with most of them remaining polygonal or fusiform (Figure 3I), the low expression of stem markers including Prom1 was ablated (Figure 3E) and proliferation was slowed down but not arrested (Figure 3G). Taken together, the above data indicate that DR177 cells possess a less pronounced stem phenotype as compared with BORRU cells.

Specific sensitization of BORRU cells to ionizing radiation and CPT by ATM inhibition

In the DNA damage checkpoint response, DNA damage is detected by the MRN/hSSB1 complex that activates the ATM and/or the ATR proteins (Figure 1). In turn, ATM/ATR unleashes an activation cascade that eventually culminates in cell cycle arrest at different phase passages. We (19) and others (3) have previously observed that the ATM substrates Chk1 and Chk2 are constitutively activated in GSC. In the present study, specific sensitization of BORRU, but not DR177, cells could be achieved by pharmacological inhibition of ATM protein.

2‐morpholin‐4‐yl‐6‐thianthren‐1‐yl‐pyran‐4‐one (KU‐55933) is an ATP‐competitive inhibitor that specifically targets ATM as compared with other phosphatidylinositol 3′‐kinase‐like kinases (Figure 1) (12). Cellular inhibition of ATM by KU‐55933 results in ablation of ionizing radiation‐dependent phosphorylation of a range of ATM targets, including p53, H2AX and Nijmegen breakage syndrome (NBS) 1 protein. The drug has low toxicity up to 10 µM on in vitro cultured GSC (data not shown). We exposed BORRU to 1 µM KU‐55933 30 minutes prior to ionizing radiation treatment and determined survival 192 hours later (Figure 4A). A limited but significant sensitization of BORRU was observed in the presence of KU‐55933, with D37 dropping from 6.4 to 4.2 Gy. Analysis of the cell cycle distribution showed that a significant fraction of irradiated Go/G1 BORRU cells was pushed into G2/M phase after exposure to 1 µM KU‐55933 (P < 0.05; Figure 4C). A limited increase of DR177 cell survival was observed in parallel experiments, with D37 values rising from 7.8 to >10.0 Gy in the absence or presence of KU‐55933, respectively (Figure 4B). No significant variation of cell cycle distribution was observed in DR177 cells exposed to the drug (Figure 4D). We then wished to determine whether the sensitizing effect could be specific of cells with stem properties. We exposed BORRU cells to differentiating conditions (removal of EGF‐FGF and addition of 10% FCS to growth medium for 14 days) (Figure 4E). Under those conditions, the sensitizing effect of 1 µM KU‐55933 was lost and resistance to ionizing radiation increased, with >90% surviving cells after irradiation with 10 Gy, independently of the presence or absence of KU‐55933 (D37: >10 Gy in either case). No effect of KU‐55933 was observed on differentiated DR177 cells whose resistance to ionizing radiation slightly increased as a likely consequence of partial loss of proliferating capacity in comparison with stem culture conditions (D37: >10 Gy in the absence or presence of KU‐55933, respectively; 3, 4). Hence, the above experiments indicate that the sensitizing effect of KU‐55933 is specific for BORRU cells grown under stem conditions.

Figure 4.

Figure 4

Specific sensitization of BORRU stem cells to ionizing radiation by ataxia telangiectasia mutated (ATM) inhibitors KU‐55933 and KU‐60019. A,B. Cells grown under stem conditions were plated in 96‐well plates in complete medium. The day after, cells were exposed to 1 µM KU‐55933 for 30 minutes at 37°C and then irradiated. Survival was evaluated 192 hours later by the MTT‐based assay. Data are the means ± SEM of 19 independent experiments. C,D. Cell cycle distribution under stem conditions; 90 000 cells were plated in 35 mm dishes, exposed to 1 µM KU‐55933 for 30 minutes, irradiated with 5 Gy and incubated for 192 hours. Cells were then harvested, fixed, permeabilized, stained with propidium iodide (PI) and analyzed by cytofluorimetry. Data are the means ± SEM of five independent experiments. E,F. As in (A,B) but with cells differentiated after exposure to 10% FCS for 2 weeks. Data are the means ± SEM of three independent experiments. G,H. As in (A,B) but with 1 µM KU‐60019. Data are the means ± SEM of 15 independent experiments. EGF‐FGF = epidermal growth factor‐fibroblast growth factor. FCS, fetal calf serum.

The ATM inhibitor 2‐[(2R, 6S)‐2, 6‐dimethylmorpholin‐4‐yl]‐N‐[5‐(6‐morpholin‐4‐yl‐4‐oxo‐4H‐pyran‐2‐yl)‐9H‐thioxanthen‐2‐yl]‐acetamide (KU‐60019) is a recently synthesized analogue of KU‐55933 with Ki and IC50 values half of those of KU‐55933 (10). KU‐60019 has been reported to be 10‐fold more effective than KU‐55933 at blocking radiation‐induced phosphorylation of key ATM targets in the established human glioma cell lines U87 and U1242 (10). Like KU‐55933, KU‐60019 displayed low toxicity up to 10 µM on in vitro cultured GSC (data not shown). We confirmed that ionizing‐radiation‐induced phosphorylation of p53 was effectively reduced in BORRU cells in the presence of 1 µM KU‐60019. Wild‐type p53 was expressed at elevated constitutive levels in these cells (Figure 5A). BORRU cells were preincubated with 1 µM KU‐60019 for 30 minutes, irradiated with 5 Gy and the ATM‐dependent p53 phosphorylation at serine 15 was monitored by Western blot analysis (Figure 5A). The phosphorylation of p53 was ablated in the presence of KU‐60019 indicating effective ATM inhibition. Under those conditions, BORRU cells were significantly sensitized to ionizing radiation. Cells were preincubated with 1 µM KU‐60019 30 minutes prior to ionizing radiation treatment and survival was determined 192 hours later (Figure 4G). In comparison with KU‐55933, more pronounced sensitization of irradiated BORRU cells was observed in the presence of KU‐60019, with D37 dropping from 6.4 to 3.2 Gy. Symmetrically, the protecting effect on DR177 was more pronounced in the presence of KU‐60019 than in the presence of KU‐55933 (Figure 4H). The expression of stem cell markers in radiation‐survived BORRU cells was determined by RT‐PCR (Figure 5B). A significant decrease of stem markers expression was observed in cells survived 192 hours after exposure to KU‐60019 and irradiation with 5 Gy [BORRU (EGF/FGF) + KU‐60019 + 5 Gy] as compared with controls [BORRU (EGF/FGF)], supporting the hypothesis that the radiation treatment performed in the presence of KU‐60019 preferentially kills the stem‐like cells.

Figure 5.

Figure 5

Ataxia telangiectasia mutated (ATM) activity and stem cell markers in BORRU cells exposed to KU‐60019 and ionizing radiation. BORRU cells were irradiated with 5 Gy ionizing radiation and extracted at the indicated times. A. The ATM‐dependent Ser15‐p53 phosphorylation was monitored by Western blotting as described under Materials and Methods. Protein loading levels were monitored by probing for actin. B. Relative quantification of stem cell markers (Prom1, Bmi1, CD15, Msi1, Msi2, Nanog, Nestin, Oct4 and Sox2) in control BORRU epidermal growth factor‐fibroblast growth factor (EGF‐FGF) and radiation‐survived BORRU after sensitization with KU‐60019 [(EGF‐FGF) + KU‐60019 + 5 Gy]. BORRU under differentiative conditions [fetal calf serum (FCS)] were used as tissue control (ΔCtref). Data are the means ± SD of three experiments.

We further determined whether ATM inhibition could preferentially sensitize GSC to the DNA topoisomerase I inhibitor CPT that likewise ionizes radiation, induces significant numbers of DNA double‐strand break (DSB). Cells were preincubated with 1 µM KU‐60019 30 minutes prior to CPT treatment and survival was determined 192 hours later. Significant sensitization to CPT was observed in BORRU in the presence of 1 µM KU‐60019, with D37 dropping from >25 nM to 19 nM (Figure 6A) but not in DR177 (D37 of 15 and 13 nM in control and KU‐60019‐treated cells, respectively—Figure 6B). On the contrary, no sensitization of BORRU cells to other types of DNA damage/stress such as interstrand DNA cross‐links induced by mitomycin C (MMC) or replication stress induced by hydroxyurea (HU) was observed (Figure 6C–F), indicating that this phenomenon may be specific for agents inducing DSB.

Figure 6.

Figure 6

Specific sensitization of BORRU stem cells to double‐strand break (DSB)‐inducing drugs by ataxia telangiectasia mutated (ATM) inhibitor KU‐60019. Cells grown under stem conditions were plated in 96‐well plates in complete medium. The day after, cells were exposed to 1 µM KU‐60019 for 30 minutes at 37°C and then treated with (A,B) the DSB‐inducing agent camptothecin (CPT); (C,D) the interstrand crosslinking agent mitomycin C (MMC); (E,F) the nucleotide precursor pool‐depleting agent hydroxyurea (HU). Data are the means ± SEM of at least three independent experiments.

In order to investigate the mechanism of BORRU sensitization following ATM inhibiton, we inhibited Chk1 and Chk2 that are downstream effectors of ATM in the DNA damage response (Figure 1). Exposure to the Chk1 inhibitor Gö 6976 (0.25 µM) resulted in sensitization of both BORRU and DR177 cells to ionizing radiation, with D37 dropping from 6.4 to 3.4 Gy and from 7.8 to 3.7 Gy, respectively (Figure 7A,B). On the contrary, exposure to the Chk2 inhibitor BML‐277 (3 µM) resulted in increased survival of both BORRU and DR177 cells after ionizing radiation with D37 rising from 6.4 to >10 Gy and from 7.8 to >10 Gy, respectively (Figure 7C,D). These results suggest that sensitization by ATM inhibitors may at least partially be linked to fading of Chk1 activity.

Figure 7.

Figure 7

Effects of checkpoint proteins 1 and 2 (Chk1 and Chk2) inhibition in BORRU and DR177 cells. A,B. Cells grown under stem conditions were plated in 96‐well plates in complete medium. The day after, cells were exposed to 0.25 µM Gö 6976 for 30 minutes at 37°C and then irradiated. Survival was evaluated 192 hours later by the MTT‐based assay. Data are the means ± SEM of three independent experiments. C,D. As in (A,B) but with cells exposed to 3 µM BML‐277. Data are the means ± SEM of four independent experiments.

DISCUSSION

Constitutive activation of the DNA damage response may be a major mechanism of resistance in GSC. In 2006, Bao and coworkers (3) pioneeringly demonstrated that Prom1‐bearing tumor cells isolated from both human glioma xenografts and primary patient GBM specimens preferentially activated the DNA damage response to radiation and that the radio‐resistance of Prom1(+) GSC could be reversed with a specific inhibitor of the Chk1 and Chk2 checkpoint kinases. Three years later, we confirmed the enhanced activation of Chk1 and Chk2 kinases in untreated Prom1(+) compared with Prom1(−) cells and we observed a significant increase of the population doubling time in stem compared with nonstem cells (19). The elevated constitutive expression of wild‐type p53 observed in GSC in the present study (Figure 5A) is consistent with the said observations. Hence, GSC display elongated cell cycle and enhanced basal activation/expression of checkpoint proteins that might contribute to their radio‐resistance. Accordingly, GSC might be sensitized to DNA‐damaging agents by selected cell cycle checkpoint inhibitors. We investigated here the possibility to specifically sensitize GSC to ionizing radiation via ATM inhibition.

The BORRU and DR177 lines were used. These GSC lines display different phenotypes with respect to a number of stemness features. To date, the identification methodology of GSC has built on the assumption that these express the cell‐surface protein Prom1 which is considered as one of the most important markers in both normal and tumoral neuronal progenitor cells [reviewed in (23)]. In our experience, high mRNA levels of Prom1 are associated with both poor outcome and presence of metastasis in pediatric medulloblastoma (18). Moreover, loss of Prom1 expression goes hand in hand with cell differentiation, lending support to the current Prom1 hypothesis. Notwithstanding, the clinical significance of GSC that express Prom1 remains poorly understood and the function of Prom1 is still an open question. Analysis of the available evidences indicate that Prom1‐positive GSC likely drive only an as yet unquantified percentage of human GBM (9). Further, Prom1 expression can be regulated by environmental conditions such as hypoxia (15) and its current evaluation using primary antibodies seems to be prone to failure (11). During assessment of Prom1 expression in either tumor samples by immunohistochemistry or in cell lines by flow cytometry, we observed several discordant results with those obtained by qPCR. One possible explanation is that commercially available anti‐AC133 and AC141 antibodies suffer from the limitation to detect glycosylated epitopes only on the Prom1 protein 4, 11. We conclude that a stemness phenotype cannot be defined on the basis of the expression pattern of the single Prom1 marker and that the gene expression profile of a panel of several stemness markers should be measured. Accordingly, we measured a panel of nine different markers (Prom1, Bmi1, CD15, Msi1, Msi2, Nanog, Nestin, Oct4 and Sox2) associated with the stem phenotype 1, 14, 24. Albeit both BORRU and DR177 cell lines were associated with certain stemness features, in particular the capacity to grow as neurospheres under serum‐free conditions, their overall stem phenotypes differed widely. BORRU cells grew slower than DR177, expressed higher levels of all nine stem cell markers, and displayed more elevated differentiation capacity evaluated by both acquisition of astrocytic/neuronal morphology and concomitant proliferation arrest (Figure 3). Hence, although both BORRU and DR177 present cardinal features of GSC (differentiation capacity, expression of stem markers and growth as neurospheres under serum‐free conditions), BORRU displays those features at a significantly higher level compared with DR177.

The serine/threonine protein kinase ATM is a central player of the DNA damage checkpoint response (Figure 1). Activation of ATM results in phosphorylation of many downstream targets which modulate numerous damage response pathways, most notably p53, Chk1 and Chk2. Mutations of ATM cause the human autosomal recessive disorder ataxia telangiectasia, which is characterized by extreme cellular sensitivity to ionizing radiation and failure of cells to arrest the cell cycle after the induction of DNA damage. ATM inhibition may thus cause cellular chemo‐ and radio‐sensitization. KU‐55933 inhibits ATM with an IC50 of 13 nmol/L and a Ki of 2.2 nmol/L. ATM inhibition by KU‐55933 results in reduced or null ionizing radiation‐dependent phosphorylation of a number of ATM targets including p53, H2AX and NBS1 (12). Here we report that a very low nontoxic concentration of KU‐55933 (1 µM) specifically sensitizes to ionizing radiation glioma cells with elevated expression of stem cell markers (BORRU) as determined by the MTT assay. No clonogenic assay was possible in these studies as BORRU cells display low colony‐forming ability (<5%). Sensitization was concomitant to specific pushing of BORRU cells into the G2/M phase of the cell cycle (Figure 4C). The sensitizing effect of KU‐55933 was ablated in differentiated BORRU cells whereas no significant variation was observed in differentiated DR177 (Figure 4E,F). GSCs are more reliant on ATM than differentiated cells for radio‐protection probably because upon differentiation, proliferation is arrested by ATM‐independent mechanisms, making cells refractory to ionizing radiation toxicity (20). An immediate therapeutic implication of the said observations is that therapies aimed to differentiation of GSC may suffer from the serious drawback of enhancing GSC resistance to radiotherapy.

KU‐60019 has been reported to be a 10‐fold more effective ATM inhibitor than KU‐55933 and an effective radio‐sensitizer of human glioma cells (10). A‐T fibroblasts were not radio‐sensitized by KU‐60019, suggesting that the ATM kinase is specifically targeted. Furthermore, KU‐60019 reduces AKT phosphorylation and inhibits migration and invasion (10). Our experiments demonstrate that the ATM‐dependent phosphorylation of p53 is ablated in BORRU cells exposed to 1 µM KU‐60019 (Figure 5A) and that KU‐60019 is a more effective radio‐sensitizer of GSC than KU‐55933, in particular at low radiation doses (Figure 4G). The protecting activity toward nonstem cells by KU‐60019, possibly linked to enhancement of cell proliferation, is more pronounced as well in comparison with KU‐55933. Overall, the specificity of BORRU sensitization to ionizing radiation was significantly more pronounced for KU‐60019 than for KU‐55933. Significant sensitization in the presence of KU‐60019 was further observed in BORRU cells treated with the DSB‐inducing agent CPT, but not in cells treated with MMC or HU that do not induce elevated amounts of DSB (Figure 6). This is consistent with previous findings showing that pharmacological inhibition of ATM sensitizes cells to DNA DSB‐inducing agents but not to other classes of DNA damaging agents such as DNA alkylators or crosslinkers (12). Accordingly, AT cells are specifically sensitive to DNA DSB‐inducing agents only (13).

Experiments targeting components of the DNA damage response downstream of ATM showed that inhibition of Chk1 by the specific inhibitor Gö 6976 (7) had a sensitizing effect on both BORRU and DR177 cells while inhibition of the ATM substrate Chk2 by the specific inhibitor BML‐277 (2) protected both of them from ionizing radiation toxicity (Figure 7). We thus hypothesize that ATM inhibition may accelerate the cell cycle progression of BORRU cells in part through inhibition of Chk1, but this certainly requires further studies. The specific sensitization of BORRU cells to ionizing radiation achievable via pharmacological inhibition of ATM protein prompts to extend these studies to additional glioma tumor cell lines with pronounced stem phenotype and to animal models.

ACKNOWLEDGMENTS

We thank Giorgio Gimelli (IGG, Genova) for performing the karyotipic analysis, Mara Foresta (INRC, Genova) for help with data management and Luca Tedeschi (IGG, Genova) for photography. This work was partially supported by Compagnia S. Paolo, Turin, Italy (Projects 2009.1174 and 2010.1944 “Sensibilizzare i tumori cerebrali alla radio‐ e chemioterapia con inibitori dei checkpoint del ciclo cellulare”) and Associazione Italiana per la Ricerca sui Tumori Cerebrali del Bambino, Genova, Italy.

D.V. is the recipient of a “Young Investigator Programme” fellowship from Fondazione Umberto Veronesi, Milan, Italy.

REFERENCES

  • 1. Abdouh M, Facchino S, Chatoo W, Balasingam V, Ferreira J, Bernier G (2009) BMI1 sustains human glioblastoma multiforme stem cell renewal. J Neurosci 29:8884–8896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Arienti KL, Brunmark A, Axe FU, McClure K, Lee A, Blevitt J et al (2005) Checkpoint kinase inhibitors: SAR and radioprotective properties of a series of 2‐arylbenzimidazoles. J Med Chem 48:1873–1885. [DOI] [PubMed] [Google Scholar]
  • 3. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB et al (2006) Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444:756–760. [DOI] [PubMed] [Google Scholar]
  • 4. Bidlingmaier S, Zhu X, Liu B (2008) The utility and limitations of glycosylated human CD133 epitopes in defining cancer stem cells. J Mol Med 86:1025–1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bolderson E, Richard DJ, Zhou BB, Khanna KK (2009) Recent advances in cancer therapy targeting proteins involved in DNA double‐strand break repair. Clin Cancer Res 15:6314–6320. [DOI] [PubMed] [Google Scholar]
  • 6. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M et al (2009) The MIQE guidelines: Minimum information for publication of quantitative real‐time PCR experiments. Clin Chem 55:611–622. [DOI] [PubMed] [Google Scholar]
  • 7. Chen CC, Kennedy RD, Sidi S, Look AT, D'Andrea A (2009) CHK1 inhibition as a strategy for targeting fanconi anemia (FA) DNA repair pathway deficient tumors. Mol Cancer 8:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Frosina G (2009) DNA repair and resistance of gliomas to chemotherapy and radiotherapy. Mol Cancer Res 7:989–999. [DOI] [PubMed] [Google Scholar]
  • 9. Frosina G (2011) Frontiers in targeting glioma stem cells. Eur J Cancer 47:496–507. [DOI] [PubMed] [Google Scholar]
  • 10. Golding SE, Rosenberg E, Valerie N, Hussaini I, Frigerio M, Cockcroft XF et al (2009) Improved ATM kinase inhibitor KU‐60019 radiosensitizes glioma cells, compromises insulin, AKT and ERK prosurvival signaling, and inhibits migration and invasion. Mol Cancer Ther 8:2894–2902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Hermansen SK, Christensen KG, Jensen SS, Kristensen BW (2011) Inconsistent immunohistochemical expression patterns of four different CD133 antibody clones in glioblastoma. J Histochem Cytochem 59:391–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Hickson I, Zhao Y, Richardson CJ, Green SJ, Martin NM, Orr AI et al (2004) Identification and characterization of a novel and specific inhibitor of the ataxia‐telangiectasia mutated kinase ATM. Cancer Res 64:9152–9159. [DOI] [PubMed] [Google Scholar]
  • 13. Jaspers NG, de Wit J, Regulski MR, Bootsma D (1982) Abnormal regulation of DNA replication and increased lethality in ataxia telangiectasia cells exposed to carcinogenic agents. Cancer Res 42:335–341. [PubMed] [Google Scholar]
  • 14. Kaneko Y, Sakakibara S, Imai T, Suzuki A, Nakamura Y, Sawamoto K et al (2000) Musashi1: An evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev Neurosci 22:139–153. [DOI] [PubMed] [Google Scholar]
  • 15. Ogden AT, Waziri AE, Lochhead RA, Fusco D, Lopez K, Ellis JA et al (2008) Identification of A2B5+CD133‐ tumor‐initiating cells in adult human gliomas. Neurosurgery 62:505–514. Discussion 514–515. [DOI] [PubMed] [Google Scholar]
  • 16. Pfaffl MW (2001) A new mathematical model for relative quantification in real‐time RT‐PCR. Nucleic Acids Res 29:e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Raso A, Negri F, Gregorio A, Nozza P, Mascelli S, De Marco P et al (2008) Successful isolation and long‐term establishment of a cell line with stem cell‐like features from an anaplastic medulloblastoma. Neuropathol Appl Neurobiol 34:306–315. [DOI] [PubMed] [Google Scholar]
  • 18. Raso A, Mascelli S, Biassoni R, Nozza P, Kool M, Pistorio A et al (2011) High levels of PROM1 (CD133) transcript are a potential predictor of poor prognosis in medulloblastoma. Neuro Oncol 13:500–508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Ropolo M, Daga A, Griffero F, Foresta M, Casartelli G, Zunino A et al (2009) Comparative analysis of DNA repair in stem and nonstem glioma cell cultures. Mol Cancer Res 7:383–392. [DOI] [PubMed] [Google Scholar]
  • 20. Tatard VM, Xiang C, Biegel JA, Dahmane N (2010) ZNF238 is expressed in postmitotic brain cells and inhibits brain tumor growth. Cancer Res 70:1236–1246. [DOI] [PubMed] [Google Scholar]
  • 21. Van Meir EG, Hadjipanayis CG, Norden AD, Shu HK, Wen PY, Olson JJ (2010) Exciting new advances in neuro‐oncology: the avenue to a cure for malignant glioma. CA Cancer J Clin 60:166–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Viaggi S, Abbondandolo A, Carbone M, Ottaggio L, Sessarego M, Zupo S, Zunino A (2004) Uncommon cytogenetic findings in a case of splenic marginal zone lymphoma with aggressive clinical course. Cancer Genet Cytogenet 148:133–136. [DOI] [PubMed] [Google Scholar]
  • 23. Wan F, Zhang S, Xie R, Gao B, Campos B, Herold‐Mende C, Lei T (2010) The utility and limitations of neurosphere assay, CD133 immunophenotyping and side population assay in glioma stem cell research. Brain Pathol 20:877–889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zhang M, Song T, Yang L, Chen R, Wu L, Yang Z, Fang J (2008) Nestin and CD133: valuable stem cell‐specific markers for determining clinical outcome of glioma patients. J Exp Clin Cancer Res 27:85. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Brain Pathology are provided here courtesy of Wiley

RESOURCES