Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2021 Apr 8;2(2):100432. doi: 10.1016/j.xpro.2021.100432

Generating mutant Aedes aegypti mosquitoes using the CRISPR/Cas9 system

Hsing-Han Li 1,4, Jian-Chiuan Li 1,4, Matthew P Su 2, Kun-Lin Liu 3, Chun-Hong Chen 1,3,5,6,∗
PMCID: PMC8058568  PMID: 33899015

Summary

Implementation of CRISPR/Cas9 methodologies for mosquito gene editing has not yet become widespread. This protocol details the procedure for Aedes aegypti mosquito gene editing using homology-directed repair and fluorescent marker insertion, which facilitates the generation and screening of mutant mosquito lines for gene function testing. We describe optimized methods for single guide RNA plasmid preparation, homologous recombination donor plasmid construction, embryo microinjection, and precise gene knock-in confirmation. We also provide general guidance for establishing mutant mosquito lines.

For details on the practical use and execution of this protocol, please refer to Li et al. (2020).

Subject areas: Genetics, CRISPR

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • •

    Design and production of target-specific single guide RNA (sgRNA) and donor plasmids

  • •

    Microinjection of sgRNA/donor plasmid/Cas9 mix into mosquito embryos

  • •

    Use of fluorescent markers to hasten the establishment of mutant lines

  • •

    Droplet digital PCR-based genotyping of indels in vivo


Implementation of CRISPR/Cas9 methodologies for mosquito gene editing has not yet become widespread. This protocol details the procedure for Aedes aegypti mosquito gene editing using homology-directed repair and fluorescent marker insertion, which facilitates the generation and screening of mutant mosquito lines for gene function testing. We describe optimized methods for single guide RNA plasmid preparation, homologous recombination donor plasmid construction, embryo microinjection, and precise gene knock-in confirmation. We also provide general guidance for establishing mutant mosquito lines.

Before you begin

Inline graphicTiming: 4–14 days

In the two weeks prior to embryo microinjection, single guide (sgRNA) and donor plasmids must be generated and female mosquitoes prepared for egg laying.

pBFv-AeU6-sgRNA plasmid generation

Inline graphicTiming: 1–2 weeks

We created a pBFv-AeU6 backbone plasmid for single guide RNA (sgRNA) cloning and expression to generate an expression system in vivo driven by the AeU6 promoter in Aedes aegypti.

  • 1.
    The pBFv-AeU6 backbone plasmid was modified from the pBFv-U6.2 plasmid obtained from the Cas9 reagents provided by the Fly Stocks of the National Institute of Genetics (NIG-Fly) in Japan (Kondo and Ueda, 2013). The Drosophila U6.2 promoter was replaced with an Ae. aegypti U6 promoter to generate a pBFv-AeU6 backbone plasmid using an In-Fusion HD Cloning Kit (Clontech).
    • a.
      We took 520 base pairs (bp) of the AeU6 promoter from the AAEL017763 locus of Ae. aegypti genomic DNA, amplified these bps via polymerase chain reaction (PCR) and fused them with a gRNA backbone sequence to obtain an AeU6-gRNA DNA fragment by primer extension. The following primers were used:
      Name Sequence
      AeU6-gRNA-F1 GCTTGATATCGAATTCCTATATAATTTAATTCCACTAGAGT
      AeU6-gRNA-R1 TAGCTCTAAAACGGAGACGAACTCCGTCTCCA
      TTTCACTACTCTTGCCTCTGCTCTTATA
      AeU6-gRNA-R2 TTTCAAGTTGATAACGGACTAGCCTTATTTTA
      ACTTGCTATTTCTAGCTCTAAAACGGAG
      Inline graphicCRITICAL: Primers designed for In-Fusion HD cloning must have two characteristics: (1) the 5′ end of the primer must contain 15 homologous bases to coincide with the end of the DNA fragment to which it will be joined (i.e., the vector or another insert); (2) the 3′ end of the primer must contain sequences specific to the target gene.
      • i.
        Use the following mixtures to run the PCR:
        Reagents Amount
        Genomic DNA (50 ng) 2 μL
        AeU6-gRNA-F1 (50 μM) 1 μL
        AeU6-gRNA-R1 (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd Buffer 10 μL
        FFwd DNA Polymerase (2U/μL) 1 μL
        Nuclease-free water 83 μL
      • ii.
        Use the following program conditions for PCR experiments.
        Step Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 30 sec
        Final extension 72°C 10 min
        Hold 12°C ∞
      • iii.
        The first PCR products act as a template for secondary PCR using AeU6-gRNA-F1 and AeU6-gRNA-R2 primers.
    • b.
      Linearize the pBFv-U6.2 plasmid via double digestion with EcoRI/NotI (NEB).
      • i.
        Prepare the following reagents for restriction enzyme digestion.
        Reagent Amount
        pBFv-U6.2 plasmid 5 μg
        EcoRI (20U/μL) 1 μL
        NotI (10U/μL) 2 μL
        10× NEBuffer 3.1 4 μL
        Nuclease-free water Up to 40 μL
      • ii.
        Incubate at 37°C for 3–4 h for enzyme digestion. Alternatively, the digested plasmid can be incubated for 12–16 h at 37°C.
    • c.
      Purify the PCR products and digested plasmids using the procedures described in the Zymoclean Gel DNA Recovery Kit (Zymo Research, Cat#d4008; https://files.zymoresearch.com/protocols/_d4001t_d4001_d4002_d4007_d4008_zymoclean_gel_dna_recovery_kit.pdf).
    • d.
      Clone fragments using the In-Fusion HD Cloning Kit.
      • i.
        Prepare the following mixtures for In-Fusion PCR:
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        AeU6-gRNA DNA fragment 500 ng
        EcoRI/NotI digested pBFv-U6.2 plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • ii.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C and store at 4°C.
    • e.
      Transform 5 μL of the In-Fusion PCR products into 50 μL of Stellar Competent Cells (Clontech) for colony selection.
      • i.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from single colony) A few
        AeU6-gRNA-F1 (5 μM) 1 μL
        AeU6-gRNA-R2 (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • ii.
        Use the following PCR program conditions:
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
    • f.
      Finally, use Sanger sequencing to confirm that the candidate pBFv-AeU6 backbone plasmids are correct.
    • g.
      Prepare the pBFv-AeU6 backbone plasmid using the QIAGEN Plamid Midi Kit (QIAGEN, Cat#12145) for the future generation of the pBFv-AeU6 sgRNA plasmid (Figure 1).
      Inline graphicPause point: Plasmid can be stored at −80°C more than a year prior to use for the cloning of annealed sgRNA oligo sets.
  • 2.
    Select an optimal target sequence for CRISPR/Cas9 recognition. For this protocol we used the Ae. Aegypti target gene GCTL-3 (AaegL3_AAEL000535, AaegL5_AAEL029058) as an example for gene knock-in. We have described this process in our recent publication (Li et al., 2020).
    Note: The original ID of GCTL-3 was AAEL000535 in AaegL3, but has been changed to AAEL029058 with an annotation and assembly in AaegL5.
    • a.
      Identify specific sgRNA sequences from target genes for CRISPR/Cas9 recognition. This can be done by inputting around 200 bases of the specific coding sequence (CDS) within one exon region into the CRISPR Optimal Target Finder web tool available at the flyCRISPR website. This tool can both identify CRISPR target sites and evaluate their specificity. We suggesting using the finder available at https://flycrispr.org/target-finder/ (Gratz et al., 2014) and adjusting the parameter panels as follows:
      • i.
        Select genome: Aedes aegypti (AaegL3)
      • ii.
        Select guide length (nt): 20
      • iii.
        Find: All CRISPR targets
    • b.
      Balance selecting targets that are as close as possible to the transcription start site with those that minimize the risk of off-target effects.
      • i.
        Try to find any mismatched base pairs within the seed regions of off-target binding sites.
      • ii.
        Exclude target sites with four continuous T bases as this is the termination signal for RNA polymerase III (Gao et al., 2018).

Note: The risk of off-target effects for a specific target site is highly dependent on the genome database edition. The genome database of Ae. aegypti is not a complete assembly and is not completely annotated. For the same target site, we found a significant difference in the risk of off-target effects when using the AaegL3 or AaegL5 editions. In addition to this, the specific strain used can also present risks. For example, a large number of sequence variations have been found when comparing the Higgs and Liverpool A. aegypti strains.

Optional: Other websites such as CHOPCHOP (http://chopchop.cbu.uib.no/) or Benchling (https://benchling.com/) can also be used for sgRNA design and off-target site prediction (Montague et al., 2014).

  • 3.
    Generate sgRNA fragments by annealing oligonucleotides and then cloning into the BsmBI site of the pBFv-AeU6 backbone plasmid for pBFv-AeU6-sgRNA plasmid generation.
    • a.
      Select a target site without a PAM sequence (NGG) when designing sgRNAs.
    • b.
      Add an additional G base to the 5′ end of the sgRNA sequence (provided it is not already a G base).
      Inline graphicCRITICAL: The G in the sense sequence corresponds to the first nucleotide of the sgRNA which is necessary for efficient U6-driven expression.
    • c.
      Using the sgRNA sequence as a template, design the oligonucleotides for sgRNA fragment generation as follows:
      • i.
        Sense oligonucleotide: 5′–AAAT (sgRNA or G-sgRNA) –3′
      • ii.
        Anti-sense oligonucleotide: 3′– (sgRNA or C-sgRNA) CAAA–5′
        Example: GCTL-3 target site (sgRNA sequence is underlined)
        Genomic sequence: 5′–GCCCAGTTGGTGTAGTTGACGGG–3′
        Sense oligonucleotide: 5′–AAATGCCCAGTTGGTGTAGTTGAC–3′
        Anti-sense oligonucleotide: 5′–AAACGTCAACTACACCAACTGGGC–3′
        Note: This target site was created based on the AaegL3 edition of the genome database.
    • d.
      Dilute the oligonucleotide to 100 μM in 1× Tris-EDTA (TE) buffer and set up an annealing reaction.
      • i.
        Prepare the following reagents for oligonucleotide annealing reactions:
        Reagents Amount
        Sense oligo (from 100 μM stock) 18 μL
        Anti-sense oligo (from 100 μM stock) 18 μL
        10× FFwd buffer 4 μL
      • ii.
        Heat the mixture to 95°C and allow the sample to slowly cool to 23°C –25°C.
    • e.
      Linearize the pBFv-AeU6 backbone plasmid by BsmBI digestion (NEB).
  • 4.
    Ligate the annealed oligonucleotides to the BsmBI cut pBFv-AeU6 backbone plasmid to generate the required pBFv-AeU6-sgRNA plasmid.
    • a.
      Prepare 10 μL total volume of the ligation mixture using the following reagents:
      Reagents Amount
      Annealed oligo set 2 μL
      BsmBI digested pBFv-AeU6 backbone plasmid (50 ng/μL) 2 μL
      10× T4 DNA ligase buffer 1 μL
      T4 DNA ligase (200U/μL) 1 μL
      Nuclease-free water 4 μL
    • b.
      Incubate at 4°C for 6 h for the ligation reaction. Afterward, transform 3 μL of the ligation product into 50 μL of DH10B Competent Cells for colony selection.
      • i.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        sgRNA sense oligo (5 μM) 1 μL
        pFBv-com reverse primer (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • ii.
        Use the following pFBv-com reverse primer sequence:
        5′ −GGAAACAGCTATGACCATGA−3′
      • iii.
        Use the following PCR program conditions
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
    • c.
      Finally, use Sanger sequencing to confirm that the candidate pBFv-AeU6-sgRNA plasmid is correct.
    • d.
      Prepare the pBFv-AeU6-sgRNA plasmid using the EndoFree Pasmid Maxi Kit (QIAGEN, Cat#12362) for future embryo microinjection (Figure 2).
      Inline graphicCRITICAL: Following plasmid cloning for embryo microinjection, we recommend that plasmids should be obtained using an endotoxin-free kit in order to achieve high-quality, low toxicity DNA. Furthermore, we strongly recommend to use either midi- or maxi-prep kits, as mini-plasmid preparation is inadequate for embryo microinjection. Minipreps kit based on columns without endotoxin removal capabilities, isopropanol precipitation, and ethanol washing of DNA can leave substantial levels of toxic contaminants.
      Inline graphicPause point: Plasmid can be stored at −80°C more than a year before being used for embryo microinjection.

Figure 1.

Figure 1

Cloning strategy for the pBFv-AeU6 backbone plasmid

Figure 2.

Figure 2

sgRNA design and cloning strategy for the pBFv-AeU6-sgRNA plasmid

pCR2-TOPO-attp-loxp-Pub-eGFP HR donor plasmid generation

Inline graphicTiming: 1–2 weeks

In order to improve efficiency while screening multiple mutant lines, we generated a fluorescent marker donor plasmid, pCR2-TOPO-attp-loxp-Pub-eGFP, for genome insertion. The plasmid needs HR to replace the gene knock-out with the knock-in. This fluorescent marker HR donor plasmid introduces two pairs of site-specific sequence elements recognized by recombinase. The first is the loxp sequence to remove the fluorescent marker cargo via Cre recombinase, and the second is the attP sequence, to allow for cargo exchange by PhiC31 integrase.

  • 5.
    Modify the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid from the pCR2-TOPO plasmid of the Invitrogen TOPO-TA Cloning Kit.
    • a.
      Step 1: Cloning eGFP-CDS and SV40-polyA fragments.
      The eGFP-CDS and SV40-polyA fragments were generated from the pMOS1_AePUb-Den3-4miR_3xp3-eGFP plasmid. They were then cloned into the SpeI/XhoI sites of pCR2-TOPO to generate a pCR2-TOPO-eGFP-SV40 transition plasmid using the In-Fusion HD Cloning Kit (Yen et al., 2018).
      • i.
        Create the SpeI/NheI/AvrII/NotI_eGFP-CDS_NruI fragment using the following PCR primers. The first PCR product, F1R1, acts as the template for the secondary PCR using the F2 and R1 primers.
        Name Sequence
        pCR2 fusion-1
        eGFP-SV40_eGFP-F1
        CCTAGGATTTGCGGCCGCATGGTG
        AGCAAGGGCGAGGAGCTGTT
        pCR2 fusion-1
        eGFP-SV40_eGFP-F2
        GCTCGGATCCACTAGTGCTAGCTCT
        ACCTAGGATTTGCGGCCGCATGGTGA
        pCR2 fusion-1
        eGFP-SV40_eGFP-R1
        TATGGCTGATTATGATCTCGCGATAT
        TACTTGTACAGCTCGTCCATGCCG
      • ii.
        Create the SV40-polyA_NdeI/XhoI fragment using the following PCR primers:
        Name Sequence
        pCR2 fusion-1
        eGFP-SV40_SV40-F1
        TCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGC
        pCR2 fusion-1
        eGFP-SV40_SV40-R1
        TAGATGCATGCTCGAGATCATATGG
        TACGCGTATTCGATAAGCTTTAAG
      • iii.
        Prepare 100 μL total volume of the following reagents for the PCR:
        Reagents Amount
        pMOS1_AePUb-Den3-4miR_3xp3-eGFP plasmid (50 ng/μL) 1 μL
        Forward primer (50 μM) 1 μL
        Reverse primer (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd buffer 10 μL
        FFwd DNA polymerase (2U/μL) 1 μL
        Nuclease-free water 84 μL
      • iv.
        Set the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 1 min
        Final extension 72°C 10 min
        Hold 12°C ∞
      • v.
        Purify PCR products using the Zymoclean Gel DNA Recovery Kit.
      • vi.
        Linearize the pCR2-TOPO plasmid via double digestion by SpeI/XhoI at 37°C for 3−4 h.
        Reagent Amount
        pCR2-TOPO plasmid 5 μg
        SpeI (10U/μL) 2 μL
        XhoI (20U/μL) 1 μL
        10× NEBuffer 2.1 4 μL
        Nuclease-free water Up to 40 μL
      • vii.
        Purify linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • viii.
        Prepare 20 μL total volume of the following reagents for In-Fusion PCR to generate the pCR2-TOPO-eGFP transition plasmid.
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        SpeI/NheI/AvrII/NotI_eGFP-CDS_NruI fragment 400 ng
        SV40-polyA_NdeI/XhoI fragment 400 ng
        SpeI/XhoI digested pCR2-TOPO plasmid 1 μg
        Nuclease-free water Up to 20 μL
      • ix.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • x.
        Transform 10 μL of the In-Fusion PCR reaction products into 100 μL of Stellar Competent Cells for colony selection.
      • xi.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        pCR2 fusion-1 eGFP-SV40_eGFP-F2 (5 μM) 1 μL
        pCR2 fusion-1 eGFP-SV40_SV40-R1 (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • xii.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 1 min
        Final extension 72°C 5 min
        Hold 12°C ∞
      • xiii.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-eGFP-SV40 transition plasmid is correct.
    • b.
      Step 2: Pub-promoter cloning
      1382 bp of the Pub promoter was generated from the pMOS1_AePUb-Den3-4miR_3xp3-eGFP plasmid, amplified via PCR and cloned into the AvrII/NotI sites of the pCR2-TOPO-eGFP-SV40 transition vector using the In-Fusion HD Cloning Kit.
      • i.
        Generate the Pub promoter fragment using the following PCR primers:
        Name Sequence
        pCR2 fusion-2
        AePUb-pro-F1
        GCTAGCTCTACCTAGGTATCTTTAC
        ATGTAGCTTGTGCATTGAATCC
        pCR2 fusion-2
        AePUb-pro-R1
        GCTCACCATGCGGCCGCGTTGAAA
        TCTCTGTTGAGCAGAAAAAGAAACGAG
      • ii.
        Prepare 100 μL total volume of the following reagents for PCR:
        Reagents Amount
        pMOS1_AePUb-Den3-4miR_3xp3-eGFP plasmid (50 ng/μL) 1 μL
        pCR2 fusion-2 AePUb-pro-F1 (50 μM) 1 μL
        pCR2 fusion-2 AePUb-pro-R1 (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd buffer 10 μL
        FFwd DNA polymerase (2U/μL) 1 μL
        Nuclease-free water 84 μL
      • iii.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 2 min
        Final extension 72°C 10 min
        Hold 12°C ∞
      • iv.
        Purify PCR products using the Zymoclean Gel DNA Recovery Kit.
      • v.
        Linearize the pCR2-TOPO-eGFP-SV40 transition plasmid via double digestion with AvrII/NotI at 37°C for 12–16 h.
        Reagent Amount
        pCR2-TOPO-eGFP-SV40 transition plasmid 5 μg
        AvrII (4U/μL) 2.5 μL
        NotI (10U/μL) 1 μL
        10× NEBuffer 3.1 4 μL
        Nuclease-free water Up to 40 μL
      • vi.
        Purify the linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • vii.
        Prepare 15 μL total volume of the following reagents for In-Fusion PCR to generate the pCR2-TOPO-Pub-eGFP-SV40 transition plasmid:
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        NheI/AvrII_Pub-promoter_NotI DNA fragment 500 ng
        AvrII/NotI digested pCR2-TOPO-eGFP-SV40 transition plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • viii.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • ix.
        Transform 5 μL of In Fusion PCR products into 50 μL of Stellar Competent Cells for colony selection.
      • x.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        pCR2 fusion-2 AePUb-pro-F1 (5 μM) 1 μL
        pCR2 fusion-2 AePUb-pro-R1 (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • xi.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 2 min
        Final extension 72°C 5 min
        Hold 12°C ∞
      • xii.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-Pub-eGFP-SV40 transition plasmid is correct.
    • c.
      Step 3: Cloning sequences, recognized by recombinase (attP and loxp), and three reading frames with stop sequences.
      The DNA fragments containing two site-specific recombinase sequences, attP and loxp, and three reading frames with stop sequences were generated by PCR primer extension, and then each one was cloned into the 5′ and 3′ ends of the Pub-eGFP-SV40 cargo.
      • i.
        Generate the 5′ end attP-stop-loxp fragment containing an extra restriction enzyme, XmaI, using the following PCR primers. The first PCR product, F1R1, acts as the template for secondary PCR using the F2 and R2 primers.
        Name Sequence
        pCR2 fusion-3
        5′-attP-loxp-F1
        CGGGAGTAGTGCCCCAACTGG
        GGTAACCTTTGAGTTCTCTCAGT
        TGGGGGCGTAGGGTCG
        pCR2 fusion-3
        5′-attP-loxp-F2
        ATCCACTAGTGCTAGCCTGACCC
        GGGCCCAGGTCAGAAGCGGTTT
        TCGGGAGTAGTGCCC
        pCR2 fusion-3
        5′-attP-loxp-R1
        GTTATTTATTAATCACTAATCAT
        TACAACCCCTTGTGTCATGTCGG
        CGACCCTACGCCCC
        pCR2 fusion-3
        5′-attP-loxp-R2
        TGTAAAGATACCTAGGATAACT
        TCGTATAGCATACATTATACGAAG
        TTATTTATTAATC
      • ii.
        Prepare 100 μL total volume of the following reagents for PCR:
        Reagents Amount
        Forward primer (50 μM) 1 μL
        Reverse primer (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd buffer 10 μL
        FFwd DNA polymerase (2U/μL) 1 μL
        Nuclease-free water 85 μL
      • iii.
        Set the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 30 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • iv.
        Purify PCR products using the Zymoclean Gel DNA Recovery Kit.
      • v.
        Linearize the pCR2-TOPO-Pub-eGFP-SV40 transition plasmid via double digestion with NheI/AvrII at 37°C for 12–16 h.
        Reagent Amount
        pCR2-TOPO-Pub-eGFP-SV40 transition plasmid 5 μg
        NheI (10U/μL) 1 μL
        AvrII (4U/μL) 2.5 μL
        10× NEBuffer 1.1 4 μL
        Nuclease-free water Up to 40 μL
      • vi.
        Purify the linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • vii.
        Prepare 15 μL total volume of the following reagents for In-Fusion PCR to introduce the NheI/XmaI-attP-stop-loxp-AvrII DNA fragment into the 5′ end of the Pub-eGFP-SV40 cargo.
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        NheI/XmaI-attP-stop-loxp-AvrII DNA fragment 500 ng
        NheI/AvrII digested pCR2-TOPO-Pub-eGFP-SV40 transition plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • viii.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • ix.
        Transform 5 μL of the In-Fusion PCR products into 50 μL of Stellar Competent Cells for colony selection.
      • x.
        Conduct colony selection using the following primers for colony PCR:
        Name Sequence
        pCR2-TOPO vector colony check F CGTATGTTGTGTGGAATTGTG
        AePUb-pr colony check R CTTTCTTGTCTGGCTCAGCT
      • xi.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        pCR2-TOPO vector colony check F (5 μM) 1 μL
        AePUb-pr colony check R (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • xii.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • xiii.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-Pub-eGFP transition plasmid containing the XmaI-attP-stop-loxp sequence at the 5′ end of the Pub-eGFP-SV40 cargo is correct.
      • xiv.
        Generate the 3′ end loxp-stop-attP fragment, also containing an extra restriction enzyme, NdeI, using the following PCR primers. The first PCR product, F1R1, acts as the template for secondary PCR using the F2 and R2 primers.
        Name Sequence
        pCR2 fusion-3
        3′-loxp-attP-F1
        CGGGAGTAGTGCCCCAACT
        GGGGTAACCTTTGAGTTCTCT
        CAGTTGGGGGCGTAGGGTCG
        pCR2 fusion-3
        3′-loxp-attP-F2
        ATCCACTAGTGCTAGCCTGACC
        CGGGCCCAGGTCAGAAGCGGTT
        TTCGGGAGTAGTGCCC
        pCR2 fusion-3
        3′-loxp-attP-R1
        GTTATTTATTAATCACTAATCAT
        TACAACCCCTTGTGTCATGTCG
        GCGACCCTACGCCCC
        pCR2 fusion-3
        3′-loxp-attP-R2
        TGTAAAGATACCTAGGATAACT
        TCGTATAGCATACATTATACGA
        AGTTATTTATTAATC
        Note: We disrupted the NdeI site of the pCR2-TOPO-(5′-attP-stop-loxp)-Pub-eGFP-SV40 transition plasmid, and created a NdeI site in the 3′ end loxp-stop-attP fragment.
      • xv.
        Prepare 100 μL total volume of the following reagents for PCR:
        Reagents Amount
        Forward primer (50 μM) 1 μL
        Reverse primer (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd buffer 10 μL
        FFwd DNA polymerase (2U/μL) 1 μL
        Nuclease-free water 85 μL
      • xvi.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 30 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • xvii.
        Purify PCR products using the Zymoclean Gel DNA Recovery Kit.
      • xviii.
        Linearize the pCR2-TOPO-Pub-eGFP-SV40 transition plasmid containing the XmaI-attP-stop-loxp sequence at the 5′ end of the Pub-eGFP-SV40 cargo via double digestion by NdeI/XhoI at 37°C for 3−4 h.
        Reagent Amount
        pCR2-TOPO-(5′-attP-stop-loxp)-Pub-eGFP-SV40 transition plasmid 5 μg
        NdeI (20U/μL) 1 μL
        XhoI (20U/μL) 1 μL
        10× NEBuffer 2.1 4 μL
        Nuclease-free water Up to 40 μL
      • xix.
        Purify the linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • xx.
        Prepare 15 μL total volume of the following reagents for In-Fusion PCR to introduce the loxp-stop-attP-NdeI/XhoI DNA fragment into the 3′ end of the Pub-eGFP-SV40 cargo.
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        loxp-stop-attP-NdeI/XhoI DNA fragment 500 ng
        NdeI/XhoI digested pCR2-TOPO-(5′-attP-stop-loxp)-Pub-eGFP transition plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • xxi.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • xxii.
        Transform 5 μL of the In-Fusion PCR products into 50 μL of Stellar Competent Cells for colony selection.
      • xxiii.
        Conduct colony selection using the following primers for colony PCR:
        Name Sequence
        SV40-polyA colony check F GTGGTTTGTCCAAACTCATCAA
        pCR2-TOPO vector colony check R ACGTTGTAAAACGACGGCCAG
      • xxiv.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        SV40-polyA colony check F (5 μM) 1 μL
        pCR2-TOPO vector colony check R (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • xxv.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • xxvi.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-attP-loxp-Pub-eGFP plasmid containing two pairs of the attP-stop-loxp sequence at the 5′ and 3′ ends of the Pub-eGFP-SV40 cargo is correct.
      • xxvii.
        Prepare the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid using the QIAGEN Plamid Midi Kit (QIAGEN, Cat#12145) for the future cloning of the pCR2-TOPO-[Gene of Interest]-attP-loxp-Pub-eGFP HR donor plasmid (Figure 3).
        Inline graphicPause point: This plasmid can be stored at −80°C more than a year before being used for the future cloning of HR flanking sequences.
  • 6.
    Generate the pCR2-TOPO-[Gene of Interest]-attP-loxp-Pub-eGFP HR donor plasmid by cloning the left (L) and right (R) HR flanking sequences of the Gene of Interest into the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid.
    • a.
      Step 1. Design the HR flanking sequences (Figure 4).
      Cas9 cutting site
      NNNNNNNNNNNNNNNNNˆNNNNGG
      <- - - - LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL RRRRRRRRRRRRRRRRRRR - - - ->
      500 - 1000 bp 500 - 1000 bp
      (L = left homology arm, R = right homology arm)
      Example: GCTL-3 target site CCCGTCˆAACTACACCAACTGGGC
      GGGCAGˆTTGATGTGGTTGACCCG
      L arm <- - - -LLLLLLLLLLLLLLLLL RRRRRRRRRRRRRRRRRRR- - - -> R arm
    • b.
      Step 2. Cloning of the HR flanking sequences cloning.
      • i.
        The L-arm (678 bp) and R-arm (602 bp) HR flanking sequences of the GCTL-3 gene were generated using the following primers for the PCR experiment.
        Name Sequence
        PUb-eGFP HR fusion GCTL-3-Up HR_F1 ATCCACTAGTGCTAGCTCAGTT
        TGCAATAAGCATTCAGCTTGTCTG
        PUb-eGFP HR fusion GCTL-3-Up HR_R1 CTGACCTGGGCCCGGGGACGTG
        CTGTCCCGTTGCGTGCCATATGAA
        PUb-eGFP HR fusion GCTL-3-Down HR_F1 TCTGACCTGGGCATATGAACTA
        CACCAACTGGGCGTTGAATATGCCG
        PUb-eGFP HR fusion GCTL-3-Down HR_R1 TAGATGCATGCTCGAGACAAT
        GGACGTCTTGTGTCCTACTTATCTC
      • ii.
        Prepare 100 μL total volume of the following reagents for PCR:
        Reagents Amount
        Genomic DNA (50 ng) 2 μL
        Forward primer (50 μM) 1 μL
        Reverse primer (50 μM) 1 μL
        dNTPs (10 mM) 2 μL
        10× FFwd buffer 10 μL
        FFwd DNA polymerase (2U/μL) 1 μL
        Nuclease-free water 83 μL
      • iii.
        Use the following PCR program conditions.
        Temperature Time
        Initial denaturation 98°C 5 min
        30 cycles 98°C 30 sec
        55°C 30 sec
        72°C 1 min
        Final extension 72°C 10 min
        Hold 12°C ∞
      • iv.
        Purify PCR products using the Zymoclean Gel DNA Recovery Kit.
        Inline graphicCRITICAL: If the HR flanking sequences contain the interferential restriction enzyme sites for HR cloning, you must pay particular attention to the cloning procedures.
      • v.
        Clone the down strand HR (R-arm) DNA fragment into the NdeI/XhoI sites of the pCR2-TOPO-attP-loxp-Pub-eGFP vector.
      • vi.
        Linearize the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid via double digestion with NdeI/XhoI at 37°C for 3−4 h.
        Reagent Amount
        pCR2-TOPO-attP-loxp-Pub-eGFP plasmid 5 μg
        NdeI (20U/μL) 1 μL
        XhoI (20U/μL) 1 μL
        10× NEBuffer 2.1 4 μL
        Nuclease-free water Up to 40 μL
      • i.
        Purify the linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • ii.
        Prepare 15 μL total volume of the following reagents for In-Fusion PCR to introduce the down strand HR (R-arm) DNA fragment into the 3′ end of the attP-loxp-Pub-eGFP cargo of the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid.
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        NdeI-down strand HR (R-arm)-XhoI DNA fragment 500 ng
        NdeI/XhoI digested pCR2-TOPO-attP-loxp-Pub-eGFP plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • iii.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • iv.
        Transform 5 μL of the In-Fusion PCR products into 50 μL of Stellar Competent Cells for colony selection.
      • v.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        SV40-polyA colony check F (5 μM) 1 μL
        pCR2-TOPO vector colony check R (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • i.
        Use the following PCR program conditions:
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • ii.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP plasmid containing the down strand HR (R-arm) sequence at the 3′ end of the attP-loxp-Pub-eGFP-SV40 cargo is correct.
      • iii.
        After the down strand HR fragment has been created, clone the up strand HR (L-arm) DNA fragment into the NheI/XmaI sites of the pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP transition plasmid.
      • iv.
        Linearize the pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP transition plasmid via double digestion with NheI/XmaI at 37°C for 3−4 h.
        Reagent Amount
        pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP transition 5 μg
        NheI (10U/μL) 2 μL
        XmaI (10U/μL) 2 μL
        10× NEBuffer CutSmart 4 μL
        Nuclease-free water Up to 40 μL
      • v.
        Purify the linearized plasmids using the DNA Clean & Concentrator-5 Kit.
      • vi.
        Prepare 15 μL total volume of the following reagents for In-Fusion PCR to introduce the up strand HR (L-arm) DNA fragment into the 5′ end of the attP-loxp-Pub-eGFP cargo of the pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP plasmid.
        Reagent Amount
        5× In-Fusion HD Enzyme Premix 3 μL
        NheI-up strand HR (L-arm)-XmaI DNA fragment 500 ng
        NheI/XmaI digested pCR2-TOPO-(R arm)-attP-loxp-Pub-eGFP plasmid 1 μg
        Nuclease-free water Up to 15 μL
      • vii.
        Incubate at 37°C for 15 min, followed by 15 min at 50°C, and store at 4°C.
      • viii.
        Transform 5 μL of the In-Fusion PCR products into 50 μL of Stellar Competent Cells for colony selection.
      • ix.
        Prepare the following reagents for colony PCR:
        Reagents Amount
        Bacteria (from a single colony) A few
        pCR2-TOPO vector colony check F (5 μM) 1 μL
        AePUb-pr colony check R (5 μM) 1 μL
        dNTPs (2.5 mM) 1 μL
        10× PCR buffer 1 μL
        Taq DNA polymerase (5U/μL) 0.1 μL
        Nuclease-free water 5.9 μL
      • i.
        Use the following PCR program conditions.
        Step Temperature Time
        Initial denaturation 95°C 3 min
        30 cycles 95°C 20 sec
        55°C 20 sec
        72°C 20 sec
        Final extension 72°C 5 min
        Hold 12°C ∞
      • ii.
        Finally, use Sanger sequencing to confirm that the candidate pCR2-TOPO-GCTL-3-attP-loxp-Pub-eGFP HR donor plasmid is correct.
      • iii.
        Prepare the pCR2-TOPO-GCTL-3-attP-loxp-Pub-eGFP HR donor plasmid using the EndoFree Pasmid Maxi Kit (QIAGEN, Cat#12362) for future embryo microinjection (Figure 5).
        Inline graphicPause point: This plasmid can be stored at −80°C more than a year before being used for embryo microinjection.

Figure 3.

Figure 3

Cloning procedure for the pCR2-TOPO-attP-loxp-Pub-eGFP plasmid using the In-Fusion HD Cloning Kit

Figure 4.

Figure 4

Design of the HR flanking sequences for the GCTL-3 gene

The HR region L-arm is highlighted in pink and the R-arm in yellow. Design of the HR flanking sequences for the GCTL-3 gene. The HR region L-arm is highlighted in pink and the R-arm in yellow. Green represents sgRNA target site. Red represents PAM sequence (NGG).

Figure 5.

Figure 5

Cloning procedure for the pCR2-TOPO-GCTL-3-attP-loxp-Pub-eGFP HR donor plasmid

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial

ECOS 10B Competent Cells (DH10B strain) YB Biotech Cat#FYE508-80VL
Stellar Competent Cells Clontech Cat#639649

Chemicals, peptides, and recombinant proteins

Taq DNA polymerase Bernardo Scientific Cat#TA110150
T4 DNA ligase NEB Cat#M0202L
Restriction enzyme NEB n/a
FFwd DNA polymerase Bernardo Scientific Cat#FF110350

Critical commercial assays

In-Fusion HD Cloning Kit Clontech Cat#639649
TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36497
EndoFree Plasmid Max Kit (10) QIAGEN Cat#12362
QIAGEN Plasmid Midi Kit (100) QIAGEN Cat#12145
Zymoclean Gel DNA Recovery Kit Zymo Research Cat#D4008
DNA Clean & Concentrator-5 Kit Zymo Research Cat#D4014
GeneAmp PCR System 9700 Applied Biosystems n/a
Applied Biosystems 3730XL DNA Analyzer Thermo Fisher Scientific n/a
Ver C Bulletin Cat#10033173
EasyPure Genomic DNA Mini Kit Bioman Scientific Cat#EP-500
Ribonuclease A from bovine pancreas Sigma Cat#R5503
Proteinase K from Tritirachium album Sigma-Aldrich Cat#P2308
Phenol:chloroform:IAA (25:24:1) pH 8.0 Sigma Cat#P3803
Droplet Digital™ PCR (ddPCR™) Technology Bio-Rad n/a

Experimental models:Mosquitoes

Aedes aegypti (Higgs strain) Omar Akbari Lab n/a

Oligonucleotides

Integrated DNA Technologies IDT n/a

Recombinant DNA

pBFv-U6.2 plasmid NIG n/a
Invitrogen TOPO TA Cloning Kit Thermo Fisher Cat#K451022

Other

Electric controlled pneumatic microinjector Narishige Cat#IM-31
Flaming/Brown Micropipette Puller Sutter Instrument Company Cat#P-97
Aluminosilicate glass Sutter Instrument Company Cat#AF100-64-10
Millex-GV Millipore Cat#SLGVR04NL
Halocarbon oil 700 Sigma Cat#H8898
Filter paper-110 mm Advantec Cat#CT-01110

Materials and equipment

10× Injection buffer (storage at 25°C)

Reagent Final concentration Amount
Sodium phosphate (0.1 M) 0.1 mM 50 μL
KCL (2 M) 2 mM 125 μL
ddH2O n/a 4825 μL
pH 6.8 n/a
Total n/a 5 mL

Injection mix (storage at −20°C)

Reagent Final concentration Amount
pBFv-AeU6 sgRNA plasmid (1 μg/μL) 200 ng/μL 2 μL
HR donor plasmid (2.5 μg/μL) 500 ng/μL 2 μL
Cas9 protein (2 μg/μL) 400 ng/μL 2 μL
Injection buffer (10×) 1× 1 μL
ddH2O n/a 3 μL
Total n/a 10 μL

Alternatives: If more than one sgRNA plasmid is used simultaneously, increase the final concentration of the sgRNA plasmid mix to N × 100 ng/μL, where N represents the number of sgRNA plasmids injected.

Preparation of female mosquitoes for egg laying

Inline graphicTiming: 1 week

  • 1.

    Prepare 50−100 wild-type female adult Ae. aegypti for egg laying— preferably young mated female mosquitoes less than 14 days old.

  • 2.

    Feed mated female mosquitoes a blood meal three days prior to embryo injection (day -3).

Step-by-step method details

Once injection plasmids have been prepared, it becomes possible to generate mutant strains via microinjection of mosquito embryos.

Note: This protocol is an optimized and amalgamated version of previously reported protocols (Jasinskiene et al., 2007; Kistler et al., 2015; Lobo et al., 2006).

Microinjection of mosquito embryos

Inline graphicTiming: 2−4 h

  • 1.
    Prepare microinjection needles containing the injection mix.
    • a.
      Using a micro-pipette puller, create multiple glass needles with unbroken tips.
      • i.
        The optimal puller program differs according to the choice of glass needle; for the suggested micro-pipette type we recommend using the following settings: HEAT = 517; PULL = 20; VEL = 110; TIME = 250.
    • b.
      Before loading the injection mix into the needle, centrifuge the solution (excluding the Cas9 protein) at 16,000 × g for 10 min at 4°C to remove impurities.
    • c.
      Load 1 μL of the injection mix into the needle while avoiding bubble formation.
    • d.
      Using two overlapping microscope slides, carefully break the tip of the glass needle (Figure 6).
      • i.
        Place the needle horizontally into a micromanipulator.
      • ii.
        Move the microscope plate slowly towards the needle tip until it is sufficiently broken so that the injection mix can drip. Monitor the slide movement using a microscope.
        Inline graphicCRITICAL: Pay particular attention to the glass needle tip after breaking. If it is too blunt, microinjection will be difficult.
  • 2.
    Prepare embryos for injection (Figure 7).
    • a.
      Allow the prepared female mosquitoes to lay eggs 40−50 min prior to microinjection. We suggest aspirating 12−15 females into vials containing wet filter paper before leaving the vial in darkness for at least 40 min. Wild-type female should lay over 100 eggs each during this time period.
    • b.
      Using forceps, gently align 20−60 embryos on wet filter paper (Figure 7, left panel). Embryos should optimally appear light gray (Figure 7, right panel, red circle).
      Inline graphicCRITICAL: In step 2b, take under 20 min to align the embryos to prevent melanization.
      Note: For this step we suggest using a maximum of 15 wild-type females per 28.5 × 95 mm Drosophila vial to collect eggs.
      Note: We do not recommend using embryos collected from females blood fed more than five days prior to the start of the experiment. In our experience, the yolk of these eggs is too thick and easily blocks the needle.
    • c.
      Dehydrate mosquito eggs delicately using filter paper before utilizing Scotch double sided tape to minimize egg movement. Tape should be placed over the anterior section of the eggs, as the posterior section must remain clear for injection.
    • d.
      Add approximately 200−500 μL oil to cover all embryos.
      Inline graphicCRITICAL: In step 2c, dehydrated mosquito eggs should not be exposed to air for more than five minutes before oil is added to prevent embryo melanization.
  • 3.
    Inject embryos with injection mix (Figure 8).
    • a.
      Using a micromanipulator, allow the needle to penetrate the posterior section of each embryo. Typical injection volume should reach around 500 pL per embryo. For optimal results, do not allow the needle tip to go beyond the yellow dotted line.
    • b.
      Retract the needle from the embryo slowly by moving the microscope plate laterally, minimizing yolk loss.
    • c.
      Repeat this injection procedure for the entire row of embryos.

Inline graphicCRITICAL: Identifiable transparent droplets near the posterior of the egg after injection are a signature of a successful injection; the mixed droplets indicate outflow of yolk.

  • 4.

    Move injected embryos to fresh wet filter paper using forceps and wash the eggs using MilliQ-water to remove excess oil.

  • 5.

    Keep the eggs humid and attached to wet filter paper for four days, then hatch and rear as normal.

Inline graphicCRITICAL: Injected embryos require at least one day for repair. We suggest keeping the eggs on wet filter paper for at least four days before hatching.

Inline graphicPause point: Keep the injected embryos on filter paper for up to a maximum of two weeks.

Figure 6.

Figure 6

Needle preparation for microinjections

Two overlapping microscope slides are used to carefully break the tip of the glass needle.

Figure 7.

Figure 7

Collection and Alignment of Aedes mosquito embryos

Embryos are aligned in identical orientations to facilitate microinjection. The anterior end of the embryo is wide, whilst the posterior end is narrow (Left panel). Light gray mosquito embryos should be selected for alignment (right panel, red circle, scale bar 500 μm).

Figure 8.

Figure 8

Aedes mosquito embryo microinjection

Mixture should be injected into the posterior end of the mosquito eggs, with the needle suggested not to pass the yellow dotted line, scale bar 100 μm.

Generation of mutant mosquitoes - day 5

Inline graphicTiming: 3–4 months

Establishing heterozygous and homozygous mutants (Figure 9).

  • 6.

    After injected eggs have hatched and as the larvae are reared to adulthood, collect and sort male and female pupae prior to emergence to prevent mating from occurring.

  • 7.

    Prepare crosses between adult micro-injected and wild-type mosquitoes in cages. Cross micro-injected males with wild-type females and vice versa. Add an excess of wild-type mosquitoes in each cross to increase the likelihood that microinjected mosquitoes will mate; the suggested minimal ratios are one microinjected male to three wild-type females, and one microinjected female to one wild-type male.

Note: Add an excess of wild-type mosquitoes independent of sex to ensure injected individuals mate and produce progeny. To ensure all microinjected females are mated, a 1:1 ratio or excess of males is suggested.

  • 8.

    After allowing mosquitoes to mate for three days, provide all females with a blood meal to allow for egg laying.

  • 9.

    After three more days, transfer females into individual vials containing wet filter paper. Allow females to lay eggs onto the filter paper.

  • 10.

    Hatch the generation 1 (G1) eggs using separate containers for each individual female. Screen mosquito larvae for fluorescent markers either throughout the whole body (for markers driven by the Pub promoter) or specific to the eyes, peripheral nerves, and siphon tubes (for markers driven by the 3xP3 promoter).

  • 11.

    Outcross adults emerging from screened larvae with control mosquitoes for five generations, screening for fluorescence during the larval stage of each generation.

Note: Fluorescent mosquitoes can be collected and tested using digital droplet PCR (ddPCR), genotyping PCR, sequencing, or other methods to screen for precise gene knock-in or potential off-target effects (please see details provided in the next step).

Inline graphicPause point: Store eggs on dry filter paper for up to a maximum of three months.

Figure 9.

Figure 9

Schema of mutant mosquito generation

sgRNA: single guide RNA. G: generation. ddPCR: droplet-digital PCR. qPCR: reverse transcription polymerase chain reaction.

Precise gene knock-in mutant line confirmation by ddPCR

Inline graphicTiming: 1 week

We originally tried to amplify the junction sequences of the integration between the marker cargo and flanking regions of the target gene (GCTL-3). Unfortunately, this attempt ultimately failed. Based on this experience, we tried to answer a basic question: How can we ensure the precise integration of a marker cargo? We thus utilized ddPCR technology as part of the gene knock-in mutant line screening procedure to check the copy number variation (CNV) of the target site and eGFP cargo.

  • 12.
    Isolate genomic DNA from a single fluorescent mosquito.
    Note: The following procedure for genomic DNA isolation is modified and optimized from Bioman Scientific Company’s suggested protocols.
    • a.
      Add a single fluorescent mosquito (male or virgin female) to 200 μL of Cell Lysis Solution (Bioman Scientific) and homogenize with a small Homogenizer.
    • b.
      Incubate the lysate at 65°C for 30 min.
    • c.
      Add 2 μL Proteinase K solution (Stock: 10 mg/mL) to the lysate. Mix well by inverting and incubate at 55°C incubator with an inverting or shaking mixer for at least three h and up to 12−16 h.
    • d.
      Allow the 55°C lysate sample to cool to 23°C–25°C, and then add 1 μL RNase A solution (Stock: 4 mg/mL) to the Proteinase K-treated lysate and mix well by inversion. Incubate the mixture at 37°C for 30 min.
    • e.
      Add 67 μL of Protein Precipitation Solution (Bioman Scientific) to the RNase A-treated lysate sample and vortex vigorously at high speed for 20 s.
    • f.
      Extract with 40 μL Phenol/Chloroform/IAA (PCI) and then centrifuge at 15000 × g for 10 min at 23°C–25°C.
      Inline graphicCRITICAL: Insect genomic DNA is very delicate at this point. Mix well with PCI via gentle inversion, and avoid vortexing as this can cause fragmentation.
    • g.
      Carefully remove the supernatant containing the DNA (leaving the protein pellet and PCI behind) and transfer to a clean 1.5 mL Eppendorf tube.
    • h.
      Add 250 μL of isopropanol to the supernatant and gently mix the solution by inversion.
    • i.
      Centrifuge for 15 min at 15000 × g. The DNA will be visible as a small white pellet. Carefully decant the supernatant.
    • j.
      Add 250 μL of 70% EtOH to wash the DNA pellet and incubate for 5 min. Centrifuge for 5 min at 15000 × g.
    • k.
      Decant the supernatant and dry the pellet for 5−10 min in a DNA Speed Vacuum machine.
    • l.
      Resuspend in 20 μL nuclease-free H2O and keep at 4°C for long term storage.
    • m.
      Calculate the genomic DNA concentration using a NanoDrop 2000 Spectrophotometer.
      Note: DNA concentrations of single male and single virgin female mosquitoes are about 60 ng/μL and 130 ng/μL, respectively.
  • 13.
    Design the primer/probe sets for the ddPCR assay (Figure 10).
    Inline graphicCRITICAL: Confirm the sequence of the 500 bp at either side of the strand flanking the Cas9 target site sequence before designing the primer/probe sets.
    • a.
      The primer/probe sets of the target genes (GCTL3 and eGFP) were obtained using the Beacon Designer software (PREMIER Biosoft).
      Inline graphicCRITICAL: Design probe sequences located as close as possible to the Cas9 target site region.
    • b.
      The primer/probe set of the reference gene (nk) was obtained from (Hall et al. 2015).
    • c.
      The probe was synthesized following the ZEN quencher technology protocol from the Integrated DNA Technologies (IDT) Company.
      Note: The ZEN quencher developed by IDT can promote a lower background and increase signal detection (available at https://sg.idtdna.com/pages/education/decoded/article/modification-highlight-zen-internal-quencher).
    • d.
      The primer/probe set sequences are:
Name Sequence
GCTL-3_ddPCR-F CATGGAAGGGAAATTCATATGG
GCTL-3_ddPCR-R GGGTGTATTCTTGGTAGGC
GCTL-3_ddPCR-probe 56-FAM-CCGTCAACT-ZEN-ACACCAACTGGGCGT-3IABkFQ
eGFP_ddPCR-F CAACGAGAAGCGCGATCA
eGFP_ddPCR-R CGCGATATTACTTGTACAGCTC
eGFP_ddPCR-probe 56-FAM-CCTGCTGGA-ZEN-GTTCGTGACCGCC-3IABkFQ
Rf-nk_ddPCR- F CGTGGTGCAGATAGTGAACG
Rf-nk_ddPCR- R CATGTTAAGTTTGCCATAAAATTCG
Rf-nk_ddPCR-probe Hex-TGGTGACTT-ZEN-GGGAAGGATGAAGTA-3IABkFQ
  • 14.
    Prepare samples for ddPCR.
    Note: All relative ddPCR reagents and procedures follow the protocols from Bio-Red ddPCR Technology (available at https://www.bio-rad.com/en-tw/applications-technologies/droplet-digital-pcr-ddpcr-technology?ID=MDV31M4VY).
    Note: Detailed information regarding the ddPCR Applications Guide can be obtained at https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_6407.pdf.
    • a.
      Ensure the use of optimal genomic DNA concentrations of 20–40 ng/20 μL per reaction (Ae. aegypti genome size is approximately 1.38 Gbp).
    • b.
      Identify optimal melting temperature (Tm) for primer/probe annealing condition testing with test runs to find the most suitable conditions.
    • c.
      Prepare the following reagents for ddPCR:
      Example: CNV detection of GCTL-3 target site.
      Reagent Amount
      2× ddPCR Supermix for Probes (No dUTP) 10 μL
      GCTL-3_ddPCR-Probe (10 μM) 0.25 μL
      GCTL-3_ddPCR-F (18 μM) 1 μL
      GCTL-3_ddPCR-R (18 μM) 1 μL
      Rf-nk_ ddPCR-Probe (10 μM) 0.25 μL
      Rf-nk_ ddPCR-F (18 μM) 1 μL
      Rf-nk_ ddPCR-R (18 μM) 1 μL
      Restriction enzyme-HaeIII (10U/μL) 0.2 μL
      Nuclease-free water 4.3 μL
      DNA sample (20ng/μL) 1 μL
      Total 20 μL
    • d.
      Incubate the reagent mixtures at 23°C–25°C for 10 min for restriction enzyme digestion of the sample DNA.
      Inline graphicCRITICAL: It is particularly important to fragment the genomic DNA by restriction enzyme digestion prior to droplet generation. This will enable optimal accuracy by separating tandem gene copies, reducing sample viscosity, and improving template accessibility.
      Inline graphicCRITICAL: Each ddPCR amplicon should not involve the expected restriction enzyme sites (e.g., HaeIII for the GCTL-3 ddPCR amplicon).
  • 15.
    Perform droplet generation using a QX200 Droplet Generator (Bio-Red).
    • a.
      All steps follows the guide in the QX200 Droplet Generator Instruction Manual (available at https://www.bio-rad.com/webroot/web/pdf/lsr/literature/10031907.pdf).
    • b.
      The following is a summary of the steps:
      • i.
        Transfer 20 μL of each prepared sample into sample wells (middle row) of the DG8 cartridge.
      • ii.
        Using a multichannel pipette, fill each oil well (bottom row) with 70 μL Droplet Generation Oil.
      • iii.
        Hook the gasket over the cartridge holder using the holes on both sides.
      • iv.
        Open the QX200 Droplet Generator and place the cartridge holder into the instrument.
      • v.
        When droplet generation is complete, the top wells of the cartridge will contain droplets, and the middle and lower wells will be nearly empty, with only a small amount of residual oil.
      • vi.
        Carefully transfer 40 μL of the contents of the top wells (the droplets) of the DG8 cartridge into a single column of a 96-well PCR plate.
      • vii.
        Cover the 96-well plate with one sheet of pierceable foil sealed using PX1 PCR plate sealer (Bio-Red).
      • viii.
        Once the 96-well plate containing the droplets is sealed, place it into the thermal cycler for PCR amplification.
  • 16.
    Run PCR reaction using a T100 Thermal Cycler (Bio-Red).
    • a.
      Put the sealed 96-well plate containing the droplets into the thermal cycler for PCR amplification.
    • b.
      Run the following PCR program.
Cycling step Temperature Time Ramp rate Cycles
Enzyme activation 95°C 10 min 2°C/s 1
Denaturation 94°C 30 s 40
Annealing/extension 57°C 1 min
Enzyme deactivation 98°C 10 min 1
Hold 4°C Infinite 1°C/s 1

Inline graphicCRITICAL: When using each ddPCR primer/probe set for the first time, it is essential to run a gradient annealing temperature to find the optimal conditions.

  • 17.
    Read the droplets using a QX200 Droplet Reader (Bio-Red).
    • a.
      Run a CNV Assay (Figure 11).
      • i.
        Select “Copy Number Variation (CNV)” as the experiment type in the QuantaSoft software when loading wells.
      • ii.
        Double click on the experiment name in the main software window to set the ploidy for reference.
      • iii.
        CNV analysis by ddPCR involves quantifying target and reference loci through the use of duplex target and reference assays. In the QuantaSoft software, copy number is determined by calculating the ratio of target molecule concentration to reference molecule concentration, multiplied by the number of copies of reference loci in the genome (usually 2).
      • iv.
        Apply the CNV formula:

      Figure 11.

      Figure 11

      Select “Copy Number Variation (CNV)” as the experiment type and set the ploidy for reference in QuantaSoft software
    • b.
      Select “1D Amplitude” for threshold design from the Analyze panel (Figure 12).
      • i.
        Display amplitudes and histograms by individual assay (1D Amplitude).
      • ii.
        Select single or multi-well thresholding to group droplets.
      • iii.
        Example: Optimal Tm condition identification for GCTL-3 primer/probe test.
    • c.
      Select Copy Number to display CNV for allele detection (Figure 13).

Figure 12.

Figure 12

Select multi-well thresholding to group droplets of GCTL-3 and Rf-nk

Identify optimal Tm for testing GCTL-3 (blue) and Rf-nk (green) primer/probe annealing conditions by running a gradient annealing temperature from 52°C–62°C. The optimal Tm conditions are when the amplitudes are constant and concentrated (shown from E07_58°C to H07_62°C).

Figure 13.

Figure 13

Display CNV for allele detection by selecting Copy Number

Figure 14.

Figure 14

Primer sets for PCR and sequencing confirmation (red and blue arrows, respectively) for break point detection at the insertion site

Figure 15.

Figure 15

Sequencing analyses of the five potential target sites identified for GCTL-3 knock-in

Figure reprinted with permission from Li et al., 2020.

Use genotyping PCR to confirm the break point site

Inline graphicTiming: 3−4 h

After performing fluorescent marker analysis via ddPCR technology, candidate mutant line break point sites should be confirmed by genotyping. This requires amplifying the junction sequences of the integrations between the marker cargo and flanking regions of target gene (GCTL-3).

  • 18.
    Design appropriate primers for genotyping.
    • a.
      For GCTL-3, we used the following sequences of primer sets for genotyping PCR:
      Region Name Sequence
      L arm breaking point checking GCTL-3_L arm-F1 CGACCATCTTCGATTTGCAGTG
      GCTL-3_L arm-R1 GTGCAGTCAGCAAAGTGACG
      R arm breaking point checking GCTL-3_R arm-F3 CCGACAACCACTACCTGAGC
      GCTL-3_R arm-R3 CCAATATGCAGGGAAAAAGCAGG
      Inline graphicCRITICAL: Primer design for the genotyping PCR amplicon needs to cover the junction sequences of the integrated cargo and the flanking regions of the target gene (GCTL-3).
    • b.
      Prepare the following reagents for the PCR experiment:
      Reagents Amount
      Genomic DNA (50 ng) 2 μL
      Forward primer (50 μM) 1 μL
      Reverse primer (50 μM) 1 μL
      dNTPs (10 mM) 2 μL
      10× FFwd buffer 10 μL
      FFwd DNA polymerase (2U/μL) 1 μL
      Nuclease-free water 83 μL
    • c.
      Set the following PCR program conditions:
      Step Temperature Time
      Initial denaturation 98°C 5 min
      30 cycles 98°C 30 s
      55°C 30 s
      72°C 1 min
      Final extension 72°C 10 min
      Hold 12°C ∞
    • d.
      Purify PCR products following the protocols established by the Zymoclean Gel DNA Recovery Kit.
    • e.
      Confirm the purified PCR products with Sanger sequencing by using designed primers:
      Region Name Sequence
      L arm to Pub promoter GCTL-3_L arm-F2 ATCGGCGCGGTAGAATACTG
      L arm to genome GCTL-3_L arm-R2 TTAGTCAAAAGCGCAATCGGC
      R arm to genome GCTL-3_R arm-F4 ATTCGGGAGAACCGAAAGGA
      R arm to eGFP GCTL-3_R arm-R4 TCTTTATCTGGTGCAAAGTGCT
      Inline graphicCRITICAL: Design a sequencing primer that crosses the breakpoint and donor plasmid of the insertion site and reads from the L and R arms to ensure the marker inserts at the correct site (Figure 14, blue arrows).

Figure 18.

Figure 18

The 5′ end (L arm) and 3′ end (R arm) genomic DNA break points in mutant mosquitoes detected by PCR

Wt: wild-type. KO: knock-out. Figure reprinted with permission from Li et al., 2020.

Off-target confirmation

Inline graphicTiming: 3−4 h

No matter the sgRNA design, it is not possible to fully rule out the possibility of off-target effects in A. aegypti because both genome assembly and annotation are incomplete. All of the genotype confirmed GCTL-3 mutant lines were therefore back crossed with the wild-type strain for three generations to eliminate the chance of off-target effects. Sanger sequencing can be used to check the sequence states of the potential off-target sites.

    • a.
      Use the VectorBase BLAST tool to find potential off-target sites for the sgRNA sequence.
    • b.
      Download the off-target genes.
    • c.
      Design a series of primer sets to amplify approximately 500 bp around the flanking sequences that cover either strand of the off-target site.
    • d.
      Use nest primers to confirm the sequence states with Sanger sequencing.
    • e.
      Example: GCTL-3 target site (Figure 15).

Optional: Other online tools, such as Cas-OFFinder (Bae et al., 2014) (http://www.rgenome.net/cas-offinder/) and CHOP-CHOP (https://chopchop.cbu.uib.no/), not only allow for the use of the Aedes aegypti genome as a reference, but are also able to predict off-target sites based on similarity, likelihood of cleavage based on the position of the mismatches, number of mismatches, etc.

Figure 21.

Figure 21

Fluorescent mosquito larvae

eGFP fluorescence driven by the Pub promoter in G0 mosquito larvae, scale bar 500 μm.

Expected outcomes

  • 1.

    Pre-screened G0 mosaic fluorescent larvae occur at rates of about 30%−80%; the success rates for fluorescent G1 adults is about 1%; the success rates for germline mutant mosquitoes is about 0.2%. The efficiencies of two attempts at GCTL-3 microinjection germline mutant generation are shown in Table 1.

Table 1.

Microinjection results

Generation
G0
G1
G2
Stage
Embryos
Larvae
Adult
Larvae
Larvae-Adult
State Microinjection Survival Fluorescent Eclosion Visible eGFP Germline mutant
Batch A 795 210/795 (26%) 168/210 (80%) 176/795 (22%) 8/795 (1%) 2/795 (0.25%)
Batch B 467 77/467 (16%) 47/77 (61%) 69/467 (14.5%) 2/467 (0.43%) 1/467 (0.21%)
  • 2.
    When using the Pub promoter, only fully fluorescent larvae can transmit the marker to the next generation. Some mosaic groups will disappear during the G2 generation (Figure 16).
  • 3.
    Although we introduced the HR donor plasmid with a fluorescent marker for gene knock-in, we found that the fluorescent marker was not a true indicator of precise integration (Figure 17).
  • 4.
    Run the PCR gel to allow for visualization of the major bands of predicted sizes both in the 5′ and 3′ end break points (Figure 18).

    Figure 19.

    Figure 19

    The 5′ end (L arm) and 3′ end (R arm) genomic DNA break points in mutant mosquitoes detected by PCR; Wt: wild-type
    KO: knock-out. Figure reprinted with permission from Li et al., 2020.
  • 5.
    Sequence the break points (both ends) of the genomic DNA in mutant mosquitoes (Figure 19).

    Figure 20.

    Figure 20

    Sequencing 5′ end (L arm) and 3′ end (R arm) insertion sites
    Figure reprinted with permission from Li et al., 2020.

Limitations

  • 1.

    Some fluorescent markers gradually become less obvious during following generations. For example, in the case of GCTL-3 microinjection, we obtained ten G1 fluorescent mutants but only three fluorescent mutants (Figure 16; larvae labeled♀7 , ♀8 and ♂5) still displayed eGFP fluorescence in G2 larvae. We also found that only non-mosaic fluorescent mutants could maintain the eGFP marker (Figure 16).

  • 2.

    Some non-mosaic fluorescent mutants have one GCTL-3 copy number (heterozygotes) but multiple eGFP copy numbers (Figure 17C).

Figure 16.

Figure 16

Examples of G1 fluorescent larvae

In the case of GCTL-3, three fluorescent G1 groups (♀7, ♀8 and ♂5) maintained eGFP in the G2 generation. In other mosaic groups, eGFP fluorescence disappeared in the following generation. ♂4, ♀2−6 and ♀9 are mosaic fluorescent; ♀7−8 and ♂5 are non-mosaic fluorescent mutants, scale bar 250 μm.

Figure 17.

Figure 17

Detecting CNV of GCTL-3 and eGFP using ddPCR technology

(A) The principle of GCTL-3 and eGFP CNV detection using a specific primer/probe set.

(B) The mosaic fluorescent strains shown GCTL-3 allele diversity in individual G1 offspring from the same G0 parental generation, scale bar 250 µm.

(C) The non-mosaic fluorescent strains demonstrate a precise and constant integration for GCTL-3 gene knock-in. Based on the eGFP CNV detection, multiple integrations also exist in the homology-directed repair (HDR) system, scale bar 250 µm.

Troubleshooting

  • 1.
    In “pCR2-TOPO-attp-loxp-Pub-eGFP HR donor plasmid generation” step:
    • a.
      Problem: Low transformation efficiency.
      • i.
        Transformation with too much In-Fusion reaction mixture (or ligation products) will lead to disruption of the ionic conditions of competent cells. Do not add more than 5 μL of the In-Fusion reaction mixture to 50 μL of competent cells.
      • ii.
        Competent cells are sensitive to the In-Fusion enzyme. Dilute the In-Fusion reaction mixture with TE buffer 3–5 times prior to transformation (add 20–40 μL of TE buffer to 10 μL of the In-Fusion reaction mixture).
      • iii.
        Use fresh or highly transformation efficiency competent cells (≥1 × 108 cfu/μg).
      • iv.
        Regions of homology may not be long enough for efficient cloning of multiple fragments at once. Extend the overlapping homologous region from 15 bp to 20 bp.
    • b.
      Problem: Large numbers of colonies were obtained with no insert.
      • v.
        Vector may be incompletely linearized. Increase the incubation time or enzyme units during restriction enzyme digestion.
      • vi.
        Ensure that the antibiotic plates are fresh and correct.
      • vii.
        Use Competent Cells with few or no recombination effects (DH10B, Stellar or SURE) to enhance the cloning efficiency of HR fragments.
  • 2.

    In “Microinjection of mosquito embryos” step:

Large outflow of mosquito embryo yolk during microinjection will likely lead to reduced egg hatching rates.

  • 3.

    In “Generation of mutant mosquitoes” step:

Fluorescent markers can be viewed in G0 larvae during the pre-screening process. For example, if fluorescence is identifiable (>30% mosquito larvae with some fluorescence) in the abdomens of the mosquito larvae (Figure 20, red circle), it means the pBFv-AeU6-sgRNA plasmid is functioning and there is a high probability of obtaining mutant strains. If no fluorescence is identifiable at the G0 stage, another sgRNA target site should be used.

  • 4.
    In “Precise gene knock-in mutant line confirmation by ddPCR” step:
    • a.
      Raining droplets are usually caused by primer degradation, probe hydrolysis or a disorderly PCR reaction (Figure 21B).
      • i.
        Run a gradient Tm to identify the optimal annealing temperature.
      • ii.
        Use a fresh primer/probe set.
      • iii.
        Redesign another primer/probe set.
    • b.
      Not obtaining negative droplets can be caused by an excess of templates (Figure 21C).
      • iv.
        Dilute the concentration of genomic DNA for ddPCR.
  • 5.

    In “Use genotyping PCR to confirm the break point site” step:

Figure 10.

Figure 10

Design of the ddPCR primer/probe set

(A) Relative position and sequences of the GCTL-3 primer/probe set and target site.

(B) Flanking sequences around the target site after double confirmation using Sanger sequencing.

If you cannot see the major band of the PCR result, you can identify the optimal Tm for the primer annealing conditions by running a gradient annealing temperature from 52°C–62°C. If this is unsuccessful, try another primer set.

Resource availability

Lead contact

Requests for further information, resources, and reagents should be directed to and will be fulfilled by the lead contact, Chun-Hong Chen (chunhong@gmail.com)

Materials availability

All materials generated in this study are available from the lead contact with a completed Materials Transfer Agreement.

Data and code availability

The published article includes all data generated or analyzed during this study.

Acknowledgments

Supervision, project administration, and funding acquisition for all funding sources were done by C.-H.C. This study was supported by the NHRI (National Health Research Institutes, Taiwan; grant no. NHRI-MR-110-GP-12) to C.-H.C. The authors thank the collaborator Shu-Jen Chou (Institute of Plant and Microbial Biology, Academia Sinica, Taipei 115201, Taiwan).

Author contributions

Conceptualization, H.-H.L., J.-C.L., and C.-H.C.; methodology, H.-H.L. and J.-C.L.; investigation, H.-H.L., J.-C.L., and K.-L.L.; resources, C.-H.C.; data curation, H.-H.L.; writing – original draft, H.-H.L., J.-C.L., and M.P.S.; writing – review & editing, H.-H.L., J.-C.L., M.P.S., and C.-H.C.

Declaration of interests

The authors declare no competing interests.

References

  1. Bae S., Park J., Kim J.S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics. 2014;30:1473–1475. doi: 10.1093/bioinformatics/btu048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Gao Z., Herrera-Carrillo E., Berkhout B. Delineation of the exact transcription termination signal for type 3 polymerase III. Mol. Ther. Nucleic Acids. 2018;10:36–44. doi: 10.1016/j.omtn.2017.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Gratz S.J., Ukken F.P., Rubinstein C.D., Thiede G., Donohue L.K., Cummings A.M., O'Connor-Giles K.M. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics. 2014;196:961–971. doi: 10.1534/genetics.113.160713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hall A.B., Basu S., Jiang X., Qi Y., Timoshevskiy V.A., Biedler J.K., Sharakhova M.V., Elahi R., Anderson M.A., Chen X.G. SEX DETERMINATION. A male-determining factor in the mosquito Aedes aegypti. Science. 2015;348:1268–1270. doi: 10.1126/science.aaa2850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Jasinskiene N., Juhn J., James A.A. Microinjection of A. aegypti embryos to obtain transgenic mosquitoes. J Vis Exp. 2007;219 doi: 10.3791/219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Kistler K.E., Vosshall L.B., Matthews B.J. Genome engineering with CRISPR-Cas9 in the mosquito Aedes aegypti. Cell Rep. 2015;11:51–60. doi: 10.1016/j.celrep.2015.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kondo S., Ueda R. Highly improved gene targeting by germline-specific Cas9 expression in Drosophila. Genetics. 2013;195:715–721. doi: 10.1534/genetics.113.156737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Li H.H., Cai Y., Li J.C., Su M.P., Liu W.L., Cheng L., Chou S.J., Yu G.Y., Wang H.D., Chen C.H. C-Type lectins link immunological and reproductive processes in Aedes aegypti. iScience. 2020;23:101486. doi: 10.1016/j.isci.2020.101486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lobo N.F., Clayton J.R., Fraser M.J., Kafatos F.C., Collins F.H. High efficiency germ-line transformation of mosquitoes. Nat. Protoc. 2006;1:1312–1317. doi: 10.1038/nprot.2006.221. [DOI] [PubMed] [Google Scholar]
  10. Montague T.G., Cruz J.M., Gagnon J.A., Church G.M., Valen E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 2014;42:W401–W407. doi: 10.1093/nar/gku410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Yen P.S., James A., Li J.C., Chen C.H., Failloux A.B. Synthetic miRNAs induce dual arboviral-resistance phenotypes in the vector mosquito Aedes aegypti. Commun. Biol. 2018;1:11. doi: 10.1038/s42003-017-0011-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The published article includes all data generated or analyzed during this study.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES