Skip to main content
PhytoKeys logoLink to PhytoKeys
. 2021 Apr 16;176:1–19. doi: 10.3897/phytokeys.176.63378

Notes on Allium section Rhizirideum (Amaryllidaceae) in South Korea and northeastern China: with a new species from Ulleungdo Island

Ju Eun Jang 1, Jong-Soo Park 2, Ji-Young Jung 3, Dong-Kap Kim 2, Sungyu Yang 4, Hyeok Jae Choi 1,✉
PMCID: PMC8065018  PMID: 33958935

Abstract

Allium section Rhizirideum is reviewed for South Korea and neighboring northeastern China based on critical observation of wild populations and herbarium materials. Species delimitations are re-evaluated on the basis of morphological and somatic chromosome numbers, resulting in the recognition of five species. Allium dumebuchum from Ulleungdo Island, South Korea, is described as a new species. This species is most similar to A. senescens due to its habits, but is clearly distinguished particularly by its rhomboid scapes in cross-secion, light purple perianth color, entire and narrowly triangular inner filaments, and flowering season from late September. One previously recognized species is placed into synonymy: A. pseudosenescens (under A. senescens). Photographs and a key to species of Allium section Rhizirideum in South Korea and northeastern China are provided in addition to information on nomenclatural types, synonymies, chromosome numbers, distribution, and specimens examined.

Keywords: Chromosome number, DNA barcode, distribution, morphology, new species, synonym, taxonomy

Introduction

With over 900 species (Seregin et al. 2015), Allium L. is one of the largest genera in the Amaryllidaceae (Friesen et al. 2006; Fritsch et al. 2010; Li et al. 2010). It is characterized by bulbs enclosed in membranous to fibrous tunics, free or almost free tepals, and often a subgynobasic style (Friesen et al. 2006). Most taxa produce remarkable amounts of cysteine sulphoxides causing the well-known characteristic odor and taste (Friesen et al. 2006). Allium is distributed naturally in the northern hemisphere and in South Africa, mostly in regions with dry seasons (De Sarker et al. 1997; Friesen et al. 2006; Nguyen et al. 2008; Neshati and Fritsch 2009). The classification of Allium by Friesen et al. (2006) based on molecular phylogenetic analyses includes 15 subgenera and 56 sections. About 23 taxa, excluding cultivated species, are known from the Korean peninsula and neighboring northeastern China (Choi and Oh 2011; Shukherdorj et al. 2018; Choi et al. 2019).

Allium section Rhizirideum G.Don ex W.D.J.Koch is the typical section of subgenus Rhizirideum (G.Don ex W.D.J.Koch) Wendelbo and characterized by having bulbs enclosed in membranous tunics and attached to horizontal rhizomes, a leaf shape ranging from hemicylidrical to plain, and a flower color from white to purple (Sinitsyna et al. 2016). Section Rhizirideum consists of 24 species and is part of the third of three main evolutionary lines of Allium (Fritsch 2001; Fritsch and Friesen 2002; Friesen et al. 2006; Li et al. 2010; Choi et al. 2012b). The distribution area of section Rhizirideum reaches from Europe to East Asia (Sinitsyna et al. 2016). There is a distinct narrowing of the distribution area east of the Ural Mountains approximately along 70° eastern longitude, and most species of section Rhizirideum are distributed in temperate Asia (Sinitsyna et al. 2016). The center of species diversity is situated in the mountain steppes of South Siberia and Mongolia (Sinitsyna et al. 2016). The species of section Rhizirideum share a basic chromosome number of x = 8, and four ploidy levels were found: di-, tetra- penta-, and hexaploids (Sinitsyna et al. 2016).

The taxonomy of the section is complicated because of morphological diversity and hybridization involving polyploidy (Friesen 1988, 1992; Kamelin 2004). Additionally, the nomenclature is confusing, which may be explained by similar morphology of some species and disappearance of many morphological characters in the voucher specimens in herbaria (Sinitsyna et al. 2016; Sinitsyna and Friesen 2018). Recently, Sinitsyna et al. (2016) and Sinitsyna and Friesen (2018) investigated the phylogenetic relationships in the section Rhizirideum based on molecular markers, and organized nomenclature, distribution maps and identification key for all known species of the section. Although there is general agreement regarding the Allium species of section Rhizirideum in South Korea and its neighboring northeastern China (Choi and Oh 2011) studies on materials from these regions are still limited.

Here, we have combined morphological, cytological, and molecular characters to address the taxonomy of Allium section Rhizirideum, and organized nomenclature, distribution maps and identification key for species in South Korea and north-eastern China. The goals of this study are: 1) to review and expand the current knowledge on general morphology (in addition to Choi and Oh 2011; Sinitsyna et al. 2016), somatic chromosome numbers (in addition to Choi and Oh 2011), DNA barcoding, and distribution (in addition to Choi and Oh 2011; Sinitsyna et al. 2016) especially with a focus on the materials from South Korea and north-eastern China, and 2) to describe a new species of section Rhizirideum from Ulleungdo Island, South Korea, A. dumebuchum H.J.Choi. This study together with that of Sinitsyna et al. (2016) and Sinitsyna and Friesen (2018) will provide a sound foundation for a global monograph and the systematic understanding of Allium section Rhizirideum.

Materials and methods

Morphological characters

This revision is based on the use of living and herbarium material, including photographs of type specimens, from the following herbaria: B, CBU, KB, KH, KWNU, LE, LINN, PE (abbreviations are according to Thiers 2020+), and the herbarium of Changwon National University (CWNU). Field surveys were carried out mainly in South Korea and north-eastern China from July 2014 to October 2020. We also observed populations from Far Eastern Russia and Mongolia especially for Allium spirale Willd. and A. senescens L. Materials preserved in 70% ethanol were used especially for observation and measurement of floral parts, cross-sections of leaf and scape. Segments from the middle third of the leaf blade and scape were stained with 2% aceto carmin for observation of the cross-section. Measurements were based on at least 30 samples for quantitative characters.

Principal component analysis

To analyze floral morphology known as a key character to distinguish Allium species (Choi and Oh 2010; Choi and Oh 2011), principal components analysis (PCA) was performed based on 14 characters: flower number per inflorescence, inflorescence length, inflorescence width, pedicel length, inner tepal length, inner tepal width, outer tepal length, outer tepal width, inner filament length, inner filament width, outer filament length, anther length, anther width, and pistil length. The principal components analysis used the {ggfortify} and {ggplot2} packages of the R-project (Tang et al. 2016; Wickham 2016; R Core Team 2020). The specimens used for principal components analysis were indicated with an asterisk (*) in specimens examined for each species.

Somatic chromosome numbers

Root tips were pre-treated in distilled water on ice for 24 h in total darkness at 4 °C and then fixed in Carnoy’s fluid (3 parts absolute ethanol: 1 part glacial acetic acid, v/v) overnight at 4 °C. The root tips were macerated in 1M hydrochloric acid at 60 °C for 3–5 min. After washing 3–5 times to eliminate residual hydrochloric acid and staining with feulgen for 5 min, the material was squashed for observation in 2% aceto carmin. Observations and photographing of chromosome micrographs were made using an Olympus BX43 (Tokyo, Japan).

DNA barcoding

In this study, we investigated the application of concatenated cpDNA regions of ndhJ-trnF, trnH-psbA, psbD-trnT, and psbJ-petA in barcoding analyses of Allium section Rhizirideum and related taxa (Table 1). In order to analyze the relationship among the species using these four cpDNA regions, we extracted each cpDNA region from complete chloroplast genome sequences stored in NCBI GenBank (https://www.ncbi.nlm.nih.gov/; Fig. 6). The species in subgen. Butomissa were selected as outgroup referred from wide phylogenetic study of Allium (Li et al. 2010). Detailed information on sample collection, voucher specimens and Genbank accession numbers of each sample is provided in Table 2.

Table 1.

List of the markers used for the DNA barcoding and phylogenetic analysis.

Fragment Marker Sequence 5’ → 3’ Reference
ndhJ-trnF ndhJ ATGCCYGAAAGTTGGATAGG Shaw et al. (2007)
TabE GGTTCAAGTCCCTCTATCCC Taberlet et al. (1991)
trnH-psbA trnHGUG CGCGCATGGTGGATTCACAATCC Tate and Simpson (2003)
psbA GTTATGCATGAACGTAATGCTC Sang et al. (1997)
psbD-trnT psbD CTCCGTARCCAGTCATCCATA Shaw et al. (2007)
trnTGGU-R CCCTTTTAACTCAGTGGTAG
psbJ-petA psbJ ATAGGTACTGTARCYGGTATT Shaw et al. (2007)
petA AACARTTYGARAAGGTTCAATT

Figure 6.

Figure 6.

Phylogenetic tree of Allium section Rhizirideum and related taxa based on concatenated alignments of four cpDNA regions (ndhJ-trnF, trnH-psbA, psbD-trnT, and psbJ-petA). The numbers above branches are bootstrap values (BS > 50%) by maximum likelihood method. The samples of section Rhizirideum and the new species are in blue and red blods, respectively. The accession numbers from Genbank were indicated after the scientific names.

Table 2.

List of Allium species sequenced in this study.

Taxon Locality Voucher information GenBank number
psbJ-petA ndhJ-tabE psbA-trnH psbD-trnT
A. angulosum Kazakhstan: Burlinsky, Zharsuat H.J.Choi 200923 MW478175 MW478211 MW478247 MW478283
A. austrosibiricum Mongolia: khovd, Munkhkhairkhan, Khuren khesuu H.J.Choi 160730-001 MW478174 MW478210 MW478246 MW478282
Mongolia: khovd, Munkhkhairkhan H.J.Choi 160730-002 MW478173 MW478209 MW478245 MW478281
A. dumebuchum South Korea: Gyeongbuk, Ulleungdo, Nari H.J.Choi 190917-01 MW478172 MW478208 MW478244 MW478280
South Korea: Gyeongbuk, Ulleungdo, Nari H.J.Choi 190917-02 MW478171 MW478207 MW478243 MW478279
A. minus South Korea: Gyeonggi, Yangju, Jangheung H.J.Choi 151006-01 MW478170 MW478206 MW478242 MW478278
South Korea: Gyeonggi, Yangju, Jangheung H.J.Choi 151006-02 MW478169 MW478205 MW478241 MW478277
A. prostratum Mongolia: Ulaanbaatar, Uvor Gunt davaa H.J.Choi 140708 MW478168 MW478204 MW478240 MW478276
Mongolia: Govi-Altai H.J.Choi 160811 MW478167 MW478203 MW478239 MW478275
A. senescens Mongolia: Ulaanbaatar, Sanzai 2014-MON-010 MW478166 MW478202 MW478238 MW478274
Mongolia: Tuv, Mungunmorit H.J.Choi 160706 MW478165 MW478201 MW478237 MW478273
A. spirale Russia: Primorskiy kray, Terneysky H.J.Choi et al. 140826-01 MW478157 MW478193 MW478229 MW478265
Russia: Primorskiy kray, Terneysky H.J.Choi et al. 140826-02 MW478156 MW478192 MW478228 MW478264
Russia: Primorskiy kray, Khasansky, Schultz H.J.Choi et al. 150819-01 MW478153 MW478189 MW478225 MW478261
Russia: Primorskiy kray, Khasansky, Schultz H.J.Choi et al. 150819-02 MW478152 MW478188 MW478224 MW478260
Russia: Primorskiy kray, Sukhanovka H.J.Choi et al. 150817-01 MW478155 MW478191 MW478227 MW478263
Russia: Primorskiy kray, Sukhanovka H.J.Choi et al. 150817-02 MW478154 MW478190 MW478226 MW478262
Russia: Primorskiy kray, Khasansky 2015RUSV017-01 MW478164 MW478200 MW478236 MW478272
Russia: Primorskiy kray, Khasansky 2015RUSV017-02 MW478163 MW478199 MW478235 MW478271
South Korea: Gangwon, Goseong H.J.Choi 191010-01 MW478159 MW478195 MW478231 MW478267
South Korea: Gangwon, Goseong H.J.Choi 191010-02 MW478158 MW478194 MW478230 MW478266
South Korea: Gangwon, Gangneung H.J.Choi 190919-001-01 MW478162 MW478198 MW478234 MW478270
South Korea: Gangwon, Gangneung H.J.Choi 190919-001-02 MW478161 MW478197 MW478233 MW478269
South Korea: Gangwon, Goseong NAPI-10-139-01 MW478151 MW478187 MW478223 MW478259
South Korea: Gangwon, Goseong NAPI-10-139-02 MW478150 MW478186 MW478222 MW478258
South Korea: Gangwon, Goseong NAPI-10-139-03 MW478149 MW478185 MW478221 MW478257
South Korea: Gangwon, Gangneung H.J.Choi 190919-002 MW478160 MW478196 MW478232 MW478268
A. spurium South Korea: Gyeongbuk, Bonghwa, Cheongnyangsan H.J.Choi 200831-01 MW478144 MW478180 MW478216 MW478252
South Korea: Gyeongbuk, Bonghwa, Cheongnyangsan H.J.Choi 200831-02 MW478143 MW478179 MW478215 MW478251
China: Jilin, Erdaobaihe H.J.Choi 190908-001-01 MW478146 MW478182 MW478218 MW478254
China: Jilin, Erdaobaihe H.J.Choi 190908-001-02 MW478145 MW478181 MW478217 MW478253
China: Jilin, Linjiang H.J.Choi 190429-01 MW478148 MW478184 MW478220 MW478256
China: Jilin, Linjiang H.J.Choi 190429-02 MW478147 MW478183 MW478219 MW478255
A. thunbergii South Korea: Gangwon, Goseong H.J.Choi 190901 MW478142 MW478178 MW478214 MW478250
A. tuberosum China: Jilin, Erdaobaihe H.J.Choi 190908-002-01 MW478141 MW478177 MW478213 MW478249
China: Jilin, Erdaobaihe H.J.Choi 190908-002-02 MW478140 MW478176 MW478212 MW478248

Total genomic DNA was extracted from silica gel-dried leaf materials using the DNeasy Plant Mini Kit (Qiagen, Seoul, South Korea). We conducted PCR with a ProFlex 96-Well PCR System (Applied Biosystems, Foster City, CA, USA). Each reaction mixture contained AccuPower PCR PreMix (Bioneer, Daejeon, South Korea), ca. 10 ng (1μL) of genomic DNA, and 100 pM of primers in a total volume of 20 µL. Conditions included an initial denaturation at 94 °C for 5 min, followed by 30 amplification cycles comprising 94 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min, with a final extension at 72 °C for 7 min. After the PCR products were visualized on 2% agarose gels, they were treated with a MG PCR Purification kit (MGmed), and sequenced with the ABI 3730xl Analyzer, using the ABI BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA, USA). The obtained sequences were manually determined and aligned by using MAFFT with Geneious Prime 2019.2.3 (Biomatters Ltd., Auckland, NZ). The DNA sequences generated in this study have been deposited in GenBank (Table 2).

The phylogenetic analyses were conducted using Maximum Likelihood (ML) by using W-IQ-TREE (Trifinopoulos et al. 2016), based on user-friendly web servers for IQ-TREE (Nguyen et al. 2015). The concatenated sequence dataset was tested to find the best-fit model by using W-IQ-TREE with the Akaike criterion and new model selection procedures. TIM+R3+F were confirmed as best-fit models for the sequences. Maximum likelihood analysis was performed with default settings in W-IQ-TREE (Fig. 6).

Results

Morphological characters

Our data indicate that several morphological characters are of taxonomic utility in Allium section Rhizirideum. Among these, the shape and size of leaf, scape and various floral parts are useful diagnostic traits at the specific level (Table 3; Fig. 1; Choi and Oh 2010; Choi and Oh 2011). According to the PCA results, first combined five principal components accounted for 83.65% of the total variation among traits in the studied taxa. The PC1 accounted for 52.94% of variance, while PC2 accounted for 13.54% of total variability. The first two principal components were strongly associated with the inflorescence length, outer tepal length and inner filament width. The anther length and inner tepal width were mostly contributed to PC1, while the pedicel length and flower number were contributed only to PC2. PC1 versus PC2 in scatter plot showed that A. dumebuchum and A. minus were distinctly separated from A. senescens, A. spirale, and A. spurium (Fig. 2).

Table 3.

Comparison of major characters of Allium section Rhizirideum in South Korea and northeastern China.

Character A. dumebuchum A. spirale A. spurium A. minus A. senescens
Rhizome oblique to horizontal horizontal horizontal oblique horizontal
Leaf sheath exposed buried buried exposed exposed
Leaf blade texture fleshy, glaucous leathery, lustrous leathery, lustrous fleshy, glaucous fleshy, glaucous
length (cm) 19.5–38.0 20.0–45.0 15–30.0 11.4–24.5 23.0–45.0
width (mm) 3.8–13.0 4.0–10.0 1.5–4.0 2.8–4.5 5.0–15.0
Scape cross-section rhomboid flattened-winged rhomboid to subterete subterete subterete
length (cm) 23.4–49.0 33.0–65.0 10.0–40.0 11.7–20.5 25.8–70.0
diameter (mm) 2.5–5.6 4.0–5.1 1.5–2.5 1.5–1.6 3.0–5.5
Pedicel length (mm) 9.8–11.2 6.0–12.4 7.6–11.1 8.7–11.1 8.0–13.0
Perianth shape semi-radially spreading campanulate campanulate radially spreading radially spreading
color light purple reddish purple strong purple or pale purple pale purple pale purple
Inner tepal shape elliptical to ovately-elliptical ovately-elliptical ovately-elliptical elliptical elliptical
length (mm) 5.2–7.2 4.0–6.8 3.9–6.3 4.0–4.8 4.3–6.4
width (mm) 3.4–4.5 2.0–4.2 2.2–3.4 1.2–1.9 1.8–2.9
Outer tepal Shape ovately-elliptical ovately-elliptical ovately-elliptical ovate-oblong ovately-elliptical
length (mm) 4.8–6.1 3.1–5.0 2.9–5.2 3.7–4.6 3.1–5.2
width (mm) 2.1–3.7 1.3–3.0 1.1–2.3 1.1–1.7 1.1–2.5
Filament exsertion exserted exserted exserted non-exserted exserted
length (mm) 6.2–8.4 5.3–8.8 5.0–7.0 3.2–4.4 4.6–6.9
Inner filament margin entire entire entire entire entire or 2-toothed
shape narrowly triangular subulate subulate broadened for ca. 1/2 in length broadened for ca. 1/2 in length
Anther length (mm) 2.2–2.5 1.7–2.2 1.7–2.0 1.3–1.4 1.5–2.0
width (mm) 0.9–1.1 0.7–1.0 0.6–0.8 0.6–0.8 0.7–0.9
Ovary length (mm) 3.2–3.8 2.0–3.4 1.8–2.8 2.1–2.4 2.4–3.1
width (mm) 3.2–3.7 1.8–3.1 1.5–2.7 1.8–2.0 2.6–2.8
Capsule length (mm) 5.4–5.6 5.0–5.3 4.8–5.1 3.5–3.7 4.5–5.5
width (mm) 5.6–5.8 4.5–5.0 4.5–5.0 3.6–4.0 4.5–5.6
Seed length (mm) 3.7–3.8 3.0–3.3 2.8–3.2 2.0–2.2 3.0–3.5
width (mm) 2.4–2.6 2.0–2.2 2.0–2.3 1.3–1.5 2.2–2.4
Flowering season late Sep. to Oct. Aug. to Sep. Jul. to Aug. May to Jul. Jul. to Aug.
Chromosome number (2n) 2n = 32 2n = 16, 32 2n = 16, 32 2n = 16 2n = 32

Figure 1.

Figure 1.

Comparative photographs of the inflorescence, cross-section of leaf and scape, flower, and tepal and filament arrangement of Allium section Rhizirdeum in South Korea and northeastern China A–EA. dumebuchum (H.J.Choi 201008-001) F–JA. spirale (H.J.Choi 191010-01) K–OA. spurium (H.J.Choi 200831-01) P–TA. minus (H.J.Choi 080063) U–YA. senescens (H.J.Choi 080119).

Figure 2.

Figure 2.

Principal components analysis plot of five Allium species of section Rhizirideum in South Korea and northeastern China. dum = A. dumebuchum; min = A. minus; sen = A. senescens; spi = A. spirale; spu = A. spurium.

Somatic chromosome numbers

The somatic chromosome numbers of Allium species investigated were counted as diploid (2n = 2x = 16; Fig. 3C, D) or tetraploid (2n = 4x = 32; Fig. 3A, B, E, F). Among studied species, A. spirale and A. spurium showed polyploidy (Table 3).

Figure 3.

Figure 3.

Mitotic metaphase chromosomes and their voucher plants of Allium species AA. dumebuchum (H.J.Choi 190917-01) BA. spirale (H.J.Choi 191010-01) CA. spirale (H.J.Choi 190910) DA. spurium (H.J.Choi 080390) EA. spurium (H.J.Choi s.n.) FA. senescens (H.J.Choi 080119, voucher plant: Fig. 2 of Choi and Oh 2010).

Phylogenetic relationships

Total combined dataset of four chloroplast regions was comprised of 93 samples, including 58 from chloroplast genome. The aligned dataset was 6,046 bp long (4,086 bp in newly sequenced samples) with 556 parsimony-informative site and 4,881 constant site. The dataset consists of ndhJ-trnF, trnH-psbA, psbD-trnT, and psbJ-petA with 923 bp, 609 bp, 1,121 bp, and 1,095 bp, respectively.

Our phylogenetic tree revealed a similar topology, not showing distinct monophyly, to the previous study (Li et al. 2010; Hauenschild et al. 2017). Nevertheless, subgen. Rhizirideum is monophyletic, despite subgen. Cepa and Allium being polyphyletic (Fig. 6). Section Rhizirideum especially constructed a clade supported high bootstrap value (Fig. 6). Allium species in section Rhizirideum, excluding A. dumebuchum, dispersed to several clades, showing a confusing phylogenetic relationship. Especially, A. dumebuchum revealed monophyly in the tree with high support value and specific morphological characters (Figs 1, 2 and 4), even though it does not show a distinct phylogenetic relationship among the species in section Rhizirideum.

Figure 4.

Figure 4.

Allium dumebuchumA habit B inflorescence C underground structure (r = rhizome) D tepal and filament arrangement E Flower F pistil G capsule H seed. Photos by H.J.Choi: H.J.Choi 201008-001 (A, B, D–F) and H.J.Choi 070001 (C, G, H).

Taxonomic treatment

Key to the species of Allium section Rhizirideum in South Korea and northeastern China

1a Leaf sheaths buried under ground; leaf blades leathery, lustrous; perianths campanulate; inner tepals ovate-elliptical; inner filaments entire at margin 2
1b Leaf sheaths exposed above ground; leaf blades fleshy, glaucous; perianths radially spreading; inner tepals elliptical; inner filaments entire or toothed at margin 3
2a Leaf blades 4–10 mm wide; scapes clearly flattened-winged in cross-section A. spirale
2b Leaf blades 1.5–4 mm wide; scapes rhomboid in cross-section A. spurium
3a Leaf blades 2.8–4.5 mm wide; scapes subterete in cross-section, 11.7–20.5 mm long; inner tepals 4.0–4.8 mm long, 1.2–1.9 mm wide; outer tepals 3.7–4.6 mm long, 1.1–1.7 mm wide; filaments non-exserted, 3.2–4.4 mm long; capsules 3.5–3.7 mm long, 3.6–4 mm wide; seeds 2.0–2.2 mm long, 1.3–1.5 mm wide; flowering from May to July (2n = 2x = 16) A. minus
3b Leaf blades 3.8–15 mm wide; scapes subterete to rhomboid in cross-section, 23.4–70 mm long; inner tepals 4.3–7.2 mm long, 1.8–4.5 mm wide; outer tepals 3.1–6.1 mm long, 1.1–3.7 mm wide; filaments exserted, 4.6–8.4 mm long; capsules 4.5–5.6 mm long, 4.5–5.8 mm wide; seeds 3.0–3.8 mm long, 2.2–2.6 mm wide; flowering from July to October (2n = 4x = 32) 4
4a Scapes rhomboid in cross-section; perianths light purple; inner filaments narrowly triangular, entire at margin; inner tepals 3.4–4.5 mm wide; ovaries 3.2–3.7 mm wide; flowering from late September to October A. dumebuchum
4b Scapes subterete in cross-section; perianths pale purple; inner filaments broadened for ca. 1/2 in length, entire or 2-toothed at margin; inner tepals 1.8–2.9 mm wide; ovaries 2.6–2.8 mm wide; flowering from July to August A. senescens
Allium dumebuchum

H.J.Choi sp. nov.

33B1FC43-6CF2-5B81-AFB3-A0D18D3ABDC7

urn:lsid:ipni.org:names:77216563-1

Figs 1A–E , 4

Diagnosis.

This new species is morphologically similar to A. senescens due to its habits. However, it is clearly distinguished from A. senescens, particularly by its rhomboid scapes in cross-secion (vs. subterete), light purple perianth color (vs. pale purple), entire and narrowly triangular inner filaments (vs. sometimes toothed and broadened for ca. 1/2 in length), and flowering season from late September (vs. from July).

Type.

South Korea. Gyeongbuk: Ulleung-gun, Namyang, 37.46702N 130.83665E, elev. 11m, 8 Oct 2020 [fl], H.J.Choi 201008-001* (Holotype: KH; Isotypes: CWNU, KB, KIOM).

Description.

Herbs hermaphroditic. Rhizomes clearly elongated, thick and branched, oblique to horizontal, 14.8–55.4 mm long. Bulbs clustered, cylindrically conical, 9.6–15 mm in diam.; tunics membranous, smooth, white. Leaves 4–9; sheaths slightly exposed above ground, 4–7.8 cm long; blades ascending, slightly tortuous, linear, flat and solid in cross-section, flesh, 19.5–38 cm × 3.8–13 mm, apex obtuse to rounded. Scapes rhomboid and solid in cross-section, drooping before flowering, 23.4–49 cm × 2.5–5.6 mm. Inflorescences umbellate, subglobose, 23–41.5 × 37–53 mm, 48–113 flowered; pedicels terete, subequal in length, 9.8–11.2mm long; bracts 3.2–5 mm long. Flowers bisexual; perianth semi-radially spreading, light purple; inner tepals longer than outer ones, elliptical, apex obtuse, 5.2–7.2 × 3.4–4.5 mm; outer tepals ovately elliptical, apex obtuse, 4.8–6.1 × 2.1–3.7 mm; filaments exserted, 6.2–8.4 mm long, margin entire; inner filaments narrowly triangular; anthers elliptical, reddish, 2.2–2.5 × 0.9–1.1 mm long; ovary obovoid, reddish, 3.2–3.8 × 3.2–3.7 mm, ovules 2 per locule; style terete, exserted; stigma smooth. Capsules cordiform, trigonous, 5.4–5.6 × 5.6–5.8 mm. Seeds oval, semi-circular in cross-section, 3.7–3.8 × 2.4–2.6 mm.

Phenology.

Flowering from late September to October; fruiting from late October to November.

Distribution and habitat.

Endemic to South Korea (Ulleung-do Island; Fig. 5). Open slope of rocky area.

Figure 5.

Figure 5.

Distribution map of Allium dumebuchum and its related species section Rhizirideum in Korea and northeastern China (revised from Sinitsyna et al. 2016).

Etymology.

The specific epithet, “dumebuchum” is based on the name of traditional vegetable for this species in South Korea.

Vernacular name.

The Korean name of the new species is “Du-me-bu-chu (두메부추)”.

Conservation status.

The new species is endemic to Ulleungdo Island, and usually grows along the coast at altitudes of -23–171m a.s.l. From the present study, the extent of occurrence (EOO) and the area of occupancy (AOO) of this species have been calculated to be 47,683 km2 and 48 km2, respectively. Currently, there is no information on population size and trend data. However, this new species is only known from a single location of Ulleungdo Island, and mainly occurs on the coast which is critically threatened by extensive construction and repair of coastal roads (Choi et al. 2012a). Therefore, decline in habitat area, habitat extent, and quality of habitat for this species have been continuously observed. Thus, Allium dumebuchum should be considered as Critically Endangered [CR B1ab(iii)] according to the IUCN Red List categories and criteria (IUCN 2021).

Notes.

Allium dumebuchum, occurring in Ulleungdo Island of South Korea, has usually been misidentified as A. senescens (Choi and Oh 2010; Choi and Oh 2011). However, this new species remarkably distinguished itself from its related species of section Rhizirideum (e.g., A. spirale, A. spurium, A. minus, and A. senescens) in having clearly bigger floral parts that bloom from late September (Table 3; Fig. 1). The PCA results based on quantitative floral characters of five related species in section Rhizirideum clearly identified A. dumebuchum from others (Fig. 2). This new species is a tetraploid (2n = 4x = 32) taxon along with A. senescens, and A. minus is a diploid (2n = 2x = 16), whereas A. spirale and A. spurium showed polyploidy (Table 3; Fig. 3). Moreover, molecular phylogenetic analyses using chloroplast markers (ndhJ-trnF, trnH-psbA, psbD-trnT, and psbJ-petA) also clearly indicate that A. dumebuchum is genetically distinct from other species of section Rhizirideum (Fig. 6).

Additional specimens examined

(Paratypes). South Korea. Gyeonggbuk: Ulleungdo Isl., Namyang valley, 11 Sep. 2006, ParkSH 61820 (KH); Ulleungdo Isl., Tonggumi, 26 Sep. 1995, S-4255 (KH); Ulleungdo Isl., Namyang, 15 Aug. 2009, Ulleung68-090815-002 (KH); Ulleungdo Isl., Namyang, 22 Aug. 2011, JMC12750 (KH); Ulleungdo Isl., Namyang, 29 Oct. 2013, 2013KBV091 (KH); Ulleungdo Isl., Namyang, 5 Sep. 2003, SCHONG2003100 (KH); Ulleungdo Isl., Chusan, 2 Sep. 2009, JMC11306 (KH); Ulleungdo Isl., Dodong, 18 Sep. 2007, H.J.Choi 070001 (KH); Ulleungdo Isl., Sadong, 23 Aug. 2005, 1073 (KB); Ulleungdo Isl., Sadong, 23 Aug. 2005, KH1283 (KB); Ulleungdo Isl., Nari, 25 Sep. 2001, J.S.Kim s.n. (KB); Ulleungdo Isl., Hyeonpo, 4 Oct. 2011, 19-1 (KB); Ulleungdo Isl., Nari, 17 Sep. 2019, H.J.Choi 190917-01 (CWNU); Ulleungdo Isl., Namyang, 8 Oct. 2020, H.J.Choi 201008-002 (CWNU); Ulleungdo Isl., Namyang, 8 Oct. 2020, H.J.Choi 201008-003 (CWNU); Ulleungdo Isl., Sadong, 12 Oct. 2005, NAPI-20101161 (KB); Ulleungdo Isl., 11 Jul. 2013, H.J.Choi s.n. (KB); Ulleungdo Isl., 23 Aug. 2005, 1406 (KB); Ulleungdo Isl., 3 Sep. 2008, SK2008-019-096 (KB); Ulleungdo Isl., 15 Oct. 2009, ksh84 (KB).

Allium spirale

Willd., Enum. Pl. Suppl. 17 (1814)

2B8E3F2F-F2CC-5711-9B45-6882C8DBFAC5

Fig. 1F–J

Type.

Russia (Far East), specimen without collection date and number (Holotype: B photo!).

Notes.

Allium spirale is occasionally confused with A. senescens because of its more or less similar growth habit (Choi and Oh 2011), but the most distinctive characters include clearly flattened-winged scapes (Fig. 1H), campanulate perianth (Fig. 1I) and ovate tepals (Fig. 1J).

Specimens examined.

China. Jilin: Gyoha, Ipbeopsan, 2 Sep. 2006, Jilin23-060902-007 (KH); hunchun, 17 Aug. ?, S.J.Lee et al. s.n. (KH); baisan, changbaisan, 22 Aug. 2010, An-C1273 (KH); Yongjeong, Nampyeong, 8 Sep. 2007, H.J.Choi & J.W.Han 070014 (KH); Dandong, Aprokgang, 6 Sep. 2007, H.J.Choi & J.W.Han 070012 (KH); Tungwi, 26 Aug. 1960, Jilin Teaching Uni. 399 (PE); Tungwi, 14 Jul. 1960, Yeop 183 (PE); Near O-mu Hsien, 28 Aug. 1931, H.W.Kung 2195 (PE); Shu-yi Valley, Ching-po Lake, Ning-gu-ta, 5 Sep. 1931, F.H.Chen 541 (PE); Erdaobaihe, 10 Sep. 2019, H.J.Choi 190910* (CWNU); Wharyoung, 8 Sep. 1959, 700828 (PE). Heilongjiang: Mudanjiangshi, Jingbo lake, 21 Aug. 2001, ChoiHJ-065 (KH); Harbin, 22 Aug. 2001, G.W.Park s.n. (KH); Qinggang, Aug. 1953, North-eastern group 571 (PE); Saertu, ?, s.n. (PE). Liaonong: Xiaodonggou, Benxi, 26 Aug. 1965, Liu et al. 1319 (PE); Daeryeon, 14 Sep. 1951, Wang et al. 965 (PE); Héngsan, Daeryeon, 11 Aug. 2008, B.U.Oh et al. s.n. (CBU). Russia. Primorsky: Mts. Sikhote-Alin, 26 Aug. 2014, 2014CNU001 (KH); Khasan, Lotos lake, 17 Aug. 2015, 2015RUSV017-01 (KH); Bukhta Ekspeditsii, 17 Aug. 2015, H.J.Choi et al. 150817-01 (KB); Bukhta Ekspeditsii, 19 Aug. 2015, H.J.Choi et al. 150819-01* (KB); Bukhta Ekspeditsii, 26 Aug. 2014, H.J.Choi et al. 140826-01 (KB); Khasansky, Perevoznaya, 10 Sep. 2013, 5-14 (KB); Khasansky, Shakhterskiy, 11 Sep. 2013, 8-13 (KB); ?, 4 Aug. 2014, RUS14-3-4 (KB). South korea. Gangwon: Goseong, Ganseong, 12 Oct. 2010, NAPI-10-139-01 (KH); Goseong, Ganseong, 10 Oct. 2019, H.J.Choi 191010-01 (CWNU); Gangneung, Gangmun, 19 Sep. 2019, H.J.Choi 190919-001-01* (CWNU); Gangneung, Gangmun, 19 Sep. 2019, H.J.Choi 190919-002 (CWNU); Gangneung, Yeongok, 02 Oct. 2011, KYC1965 (KH); Yangyang, Sonnyang, 04 Sep. 2011, NAPI 2012-0020 (KH); Goseong, Hyeonnae, 15 Sep. 1965, T.B.Lee et al. s.n. (KH); Goseong, Ganseong, 10 Sep. 2008, NAPID2008013 (KB); Goseong, Geojin, 10 Sep. 2008, J.O.Hyun s.n. (KB); Gangneung, Sacheon, 15 Nov. 2013, 2013-282 (KB); Goseong, Jugwang, 22 Sep. 2014, KYC2014-207 (KB); Gangneung, Gangmun, 8 Aug. 2015, H.J.Choi s.n. (KB).

Allium spurium

G.Don, Mem. Wern. Nat. Hist. Soc. vi. 59 (1827)

1A1C8F46-D02E-5200-913F-7D0C5E4CA977

Fig. 1K–O

  • Allium dauricum N.Friesen, Fl. Sibir. (Arac.-Orchidac.) 58 (1987). Type: Russia. Transbaicalia Orientalis, pagum Kyra, in valle fuvii Bukukum, in prato substepposo, 31 Aug. 1964, G.Peschkova & L.Ovczinnicova s.n. (Holotype: LE!; Isotypes: NSK).

Type.

Russia (Siberia, location in doubt). Type specimen not designated (protologue).

Notes.

Allium spurium is occasionally confused with A. spirale because of its more or less similar growth habit, but the most distinctive characters include narrower leaf blades and scapes and smaller floral parts (Table 3; Fig. 1L–N). This species is newly recorded for South Korea, and the new vernacular name ‘Gak-si-du-me-bu-chu’ is given. Besides, Cheongnyangsan of South Korea is the disjunct southernmost limit for geographical distribution of A. spurium (Fig. 5).

Specimens examined.

China. Jilin: Helong, 8 Sep. 2007, H.J.Choi s.n. (KH); Helong, 9 Sep. 2007, H.J.Choi s.n. (KH); Baishan, Linjiang, 29 Apr. 2019, H.J.Choi 190429-01 (CWNU); Erdaobaihe, 08 Sep. 2019, H.J.Choi 190908-001-01* (CWNU). North Korea. Hambuk: Yonsa, 25 Aug. 1958, C.K.Gen s.n. (LE). Hamnam: Sinpo, 3 Oct. 2002, B.U.Oh 020062 (CBU); Hungnam, 21 Aug. 1956, C.K.Gen s.n. (LE). Phyonbuk: Huchang, 22 Aug. 1897, Komarov s.n. (LE); Jasong, 27 Aug. 1897, Komarov s.n. (LE). South Korea. Gyeongbuk: Bonghwa, Cheongnyangsan, 31 Aug. 2020, H.J.Choi 200831-01* (CWNU).

Allium minus

(S.O.Yu, S.Lee & W.Lee) H.J.Choi & B.U.Oh, Brittonia 62(3): 200 (2010)

D83EBFCF-86C6-5FAC-A2C8-892F523088F8

Fig. 1P–T

  • A. senescens L. var. minus S.OYu, S.Lee & W.Lee, J. Korean Pl. Taxon. 11: 32 (1981) [‘minor’]. Basionym.

Type.

South Korea. Gangwon: Inje, Wolhaksam-ri, 26 May 1979, B.S.Gil s.n. (Neotype: KH!; Oh et al. 2018).

Notes.

This species was originally published as a variety of Allium senescens, Allium senescens var. minus ‘minor’. However, this Korean endemic taxon has been revealed as a biologically distinct species. It is remarkably well distinguished from its relatives of the section Rhiziridum by having much narrower and shorter leaf blades and scapes, smaller floral organs, non-exerted filaments and earlier flowering season from May to late July (Table 3; Fig. 1; Choi and Oh 2010; Choi and Oh 2011). Considering these major differences, Choi and Oh (2010) proposed the rank of species for this taxon as more appropriate than that of variety. Although it is cultivated as a vegetable in South Korea, its natural populations are only known from the type locality so far (Fig. 5). However, this species proved to have been extinct in the natural habitat in this study.

Specimens examined.

South Korea. Gangwon: Inje, 26 May 1979, B.S.Gil 0022887 (KWNU); Inje, ?, W.T.Lee 0022892 (KWNU); Inje, Wolhaksam-ri, 18 May 2008, H.J.Choi 080063* (KH). Gyeonggi: Yangju, Jangheung, 6 Oct. 2015, H.J.Choi 151006-01 (CWNU).

Allium senescens

L., Sp. Pl. 1: 299 (1753)

ED42E485-5B1C-5045-B2A4-D9140B36F97C

Fig. 1U–Y

  • Allium pseudosenescens H.J.Choi & B.U.Oh, Brittonia 62(3): 200 (2010). Type: China. Heilongjiang, Tahe, Talin Linchang, H.J.Choi 080119 (Holotype: KH!; Isotypes: KH!).

Type.

Russia. From Siberia (forebaical region), LINN 419.25 (Lectotype: LINN photo!).

Notes.

Allium senescens, originally described from the Baikal area of Russia, is certainly one of the most popular ornamental Allium species of the world, and is naturally distributed in southern Russia, Mongolia and north-eastern China (Sinitsyna et al. 2016; Sinitsyna and Friesen 2018). The existing records of this species in South Korea (Choi and Oh 2010; Choi and Oh 2011) are all the result of misidentification of herbarium materials, the identity of which we have verified to be A. dumebuchum. Allium pseudosenescens is newly proposed as an additional synonym of A. senescens in this study.

Specimens examined.

China. Heilongjiang: ?, 1959, Wang 163 (PE); Tahe, Talin Linchang, 31 Jul. 2008, H.J.Choi 080119 (KH); Xifeng Linchang, Tahe, 1 Aug. 2008, H.J.Choi 080278 (KH); Dashinganryeong, Aug. 1954, Linxingzu 07577 (PE). Mongolia. Bulgan, Khogno Khaan Mountain Nature Reserve, 29 Jul. 2000, Sun Byung-Yun 32008 (KH); Sukhbaatar, Tumentsogt, 17 Jul. 2011, Mongolia_V2012007 (KH); Ulaanbaatar, Sanzai, 09 Jul. 2014, 2014-MON-010 (KB); Tuv, Mungunmorit, 06 Jul. 2016, H.J.Choi 160706* (CWNU); sanzai, 8 Jul. 2014, 2014-MON-010 (KB).

Supplementary Material

XML Treatment for Allium dumebuchum
XML Treatment for Allium spirale
XML Treatment for Allium spurium
XML Treatment for Allium minus
XML Treatment for Allium senescens

Acknowledgements

Research for this article was supported by a research project (A study on the floral morphology of Korean Allium species; Grant Number KNA-21-C-27) from the Korea National Arboretum, South Korea. This study is a part of the Ph.D. dissertation of the first author.

Citation

Jang JE, Park J-S, Jung J-Y, Kim D-K, Yang S, Choi HJ (2021) Notes on Allium section Rhizirideum (Amaryllidaceae) in South Korea and northeastern China: with a new species from Ulleungdo Island. PhytoKeys 176: 1–19. https://doi.org/10.3897/phytokeys.176.63378

References

  1. Choi HJ, Oh BU. (2010) A new species and a new combination of Allium sect. Rhizirideum (Alliaceae) from northeastern China and Korea. Brittonia 62(3): 199–205. 10.1007/s12228-009-9124-6 [DOI] [Google Scholar]
  2. Choi HJ, Oh BU. (2011) A partial revision of Allium (Amaryllidaceae) in Korea and north-eastern China. Botanical Journal of the Linnean Society 167(2): 153–211. 10.1111/j.1095-8339.2011.01166.x [DOI] [Google Scholar]
  3. Choi HJ, Jang HD, Isagy Y, Oh BU. (2012a) Distribution and conservation status of the Critically Endangered Scrophularia takesimensis, a plant endemic to Ulleung Island, Republic of Korea. Oryx 46(3): 399–402. 10.1017/S0030605312000117 [DOI] [Google Scholar]
  4. Choi HJ, Giussani LM, Jang CG, Oh BU, Cota-Sanchez JH. (2012b) Systematics of disjunct northeastern Asian and northern North American Allium (Amaryllidaceae). Botany 90(6): 491–508. 10.1139/b2012-031 [DOI] [Google Scholar]
  5. Choi HJ, Yang S, Yang JC, Friesen N. (2019) Allium ulleungense (Amaryllidaceae), a new species endemic to Ulleungdo Island, Korea. Korean Journal of Plant Taxonomy 49(4): 294–299. 10.11110/kjpt.2019.49.4.294 [DOI] [Google Scholar]
  6. De Sarker D, Johnson MAT, Reynolds A, Brandham PE. (1997) Cytology of the highly polyploid disjunct species, Allium dregeanum (Alliaceae), and of some Eurasian relatives. Botanical Journal of the Linnean Society 124: 361–373. 10.1111/j.1095-8339.1997.tb02002.x [DOI] [Google Scholar]
  7. Friesen N. (1988) Lukovye Sibiri: sistematika, kariologiia, khorologiia. Nauka–Sibirskoe otd., Novosibirsk.
  8. Friesen N. (1992) Systematics of the Siberian polyploid complex in subgenus Rhizirideum (Allium). In: Hanelt P, Hammer K, Knupffer H. (Eds) The genus Allium: taxonomic problems and genetic resources, proceedings of an international symposium held at Gatersleben.Institut fur Pflanzengenetik und Kulturpflanzenforschung, Gatersleben, 55–66.
  9. Friesen N, Fritsch RM, Blattner FR. (2006) Phylogeny and new intrageneric classification of Allium (Alliaceae) based on nuclear ribosomal DNA its sequences. Aliso 22(1): 372–395. 10.5642/aliso.20062201.31 [DOI] [Google Scholar]
  10. Fritsch RM. (2001) Taxonomy of the genus Allium L.: Contributions from IPK Gatersleben. Herbertia 56: 19–50. [Google Scholar]
  11. Fritsch RM, Friesen N. (2002) Evolution, domestication, and taxonomy. In: Rabinovich HD, Currah L. (Eds) Allium crop science: recent advances.CABI Publishing, Wallingford, 5–30. 10.1079/9780851995106.0005 [DOI]
  12. Fritsch RM, Blattner FR, Gurushidze M. (2010) New classification of Allium L. subg. Melanocrommyum (Webb &Berthel.) Rouy (Alliaceae) based on molecular and morphological characters. Phyton 49: 145–320. [Google Scholar]
  13. Hauenschild F, Favre A, Schnitzler J, Michalak I, Freiberg M, Muellner-Riehl AN. (2017) Spatio-temporal evolution of Allium L. in the Qinghai–Tibet-Plateau region: Immigration and in situ radiation. Plant diversity 39: 167–179. 10.1016/j.pld.2017.05.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. IUCN (2021) The IUCN Red List of Threatened Species. Version 2020-3. https://www.iucnredlist.org [accessed 6 January 2021]
  15. Kamelin RV. (2004) Lektsii po sistematike rastenii. Glavy teoreticheskoi sistematiki rastenii, Izdatel’stvo “AzBuka”, Barnaul.
  16. Li QQ, Zhou SD, He XJ, Yu Y, Zhang YC, Wei XQ. (2010) Phylogeny and biogeography of Allium (Amaryllidaceae: Allieae) based on nuclear ribosomal internal transcribed spacer and chloroplast rps16 sequences, focusing on the inclusion of species endemic to China. Annals of Botany 106(5): 709–773. 10.1093/aob/mcq177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Neshati F, Fritsch RM. (2009) Seed characters and testa sculptures of some Iranian Allium L. species (Alliaceae). Feddes Repertorium 120(5-6): 322–332. 10.1002/fedr.200911112 [DOI] [Google Scholar]
  18. Nguyen NH, Driscoll HE, Specht CD. (2008) A molecular phylogeny of the wild onions (Allium; Alliaceae) with a focus on the western North American center of diversity. Molecular Phylogenetics and Evolution 47(3): 1157–1172. 10.1016/j.ympev.2007.12.006 [DOI] [PubMed] [Google Scholar]
  19. Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. (2015) IQ-TREE: A fast and efective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Oh SH, Ji SJ, Choi HJ. (2018) Neotypification of Allium senescens var. minus (Amaryllidaceae). Phytotaxa 382(1): 148–150. 10.11646/phytotaxa.382.1.9 [DOI] [Google Scholar]
  21. R Core Team (2020) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna.
  22. Sang T, Crawford DJ, Stuessy TF. (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84(8): 1120–1136. 10.2307/2446155 [DOI] [PubMed] [Google Scholar]
  23. Seregin AP, Anaćkov G, Friesen N. (2015) Molecular and morphological revision of the Allium saxatile group (Amaryllidaceae): Geographical isolation as the driving force of underestimated speciation. Botanical Journal of the Linnean Society 178(1): 67–101. 10.1111/boj.12269 [DOI] [Google Scholar]
  24. Shaw J, Lickey EB, Schilling EE, Small RL. (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. American Journal of Botany 94(3): 275–288. 10.3732/ajb.94.3.275 [DOI] [PubMed] [Google Scholar]
  25. Shukherdorj B, Jang JE, Duchoslav M, Choi HJ. (2018) Cytotype distribution and ecology of Allium thunbergii (= A. sacculiferum) with a special reference to South Korean populations. Korean Journal of Plant Taxonomy 48(4): 278–288. 10.11110/kjpt.2018.48.4.278 [DOI] [Google Scholar]
  26. Sinitsyna TA, Friesen N. (2018) Taxonomic review of Allium senescens subsp. glaucum (Amaryllidaceae). Feddes Repertorium 129(1): 9–12. 10.1002/fedr.201700008 [DOI] [Google Scholar]
  27. Sinitsyna TA, Herden T, Friesen N. (2016) Dated phylogeny and biogeography of the Eurasian Allium section Rhizirideum (Amaryllidaceae). Plant Systematics and Evolution 302(9): 1311–1328. 10.1007/s00606-016-1333-3 [DOI] [Google Scholar]
  28. Taberlet P, Gielly L, Pautou G, Bouvet J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. 10.1007/BF00037152 [DOI] [PubMed] [Google Scholar]
  29. Tang Y, Horikoshi M, Li W. (2016) ggfortify: Unified interface to visualize statistical result of popular R packages. The R Journal 8(2): 474–485. 10.32614/RJ-2016-060 [DOI] [Google Scholar]
  30. Tate JA, Simpson BB. (2003) Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany 28(4): 723–737. [Google Scholar]
  31. Thiers B. (2020+) [continuously updated] Index Herbariorum: A global directory of public herbaria and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.org/ih/ [accessed 5.11.2020]
  32. Trifinopoulos J, Nguyen LT, Von Haeseler A, Minh BQ. (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44(W1): W232–W235. 10.1093/nar/gkw256 [DOI] [PMC free article] [PubMed]
  33. Wickham H. (2016) ggplot2: Elegant graphics for data analysis. Springer-Verlag, New York, 216 pp. 10.1007/978-3-319-24277-4_9 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Allium dumebuchum
XML Treatment for Allium spirale
XML Treatment for Allium spurium
XML Treatment for Allium minus
XML Treatment for Allium senescens

Articles from PhytoKeys are provided here courtesy of Pensoft Publishers

RESOURCES