Skip to main content
Antibiotics logoLink to Antibiotics
. 2021 Apr 3;10(4):383. doi: 10.3390/antibiotics10040383

Genome Characterization of Lactiplantibacillus plantarum Strain UTNGt2 Originated from Theobroma grandiflorum (White Cacao) of Ecuadorian Amazon: Antimicrobial Peptides from Safety to Potential Applications

Gabriela N Tenea 1,*, Clara Ortega 1
Editor: João Vilares Neves1
PMCID: PMC8066128  PMID: 33916842

Abstract

The genome characterization of the Lactiplantibacillus plantarum strain UTNGt2, isolated from wild copoazu or white cacao (Theobroma grandiflorum), is described. A total of 31 contigs is assembled with a total length of 3,264,448 bases, with all contigs matching the core genome of different groups in the database. The genome size is 3,540,752 bases with GC content of 44.53% and the genome repeat sequences constitute around 457,386 bases of the assembly. The UTNGt2 matches the Lactiplantibacillus plantarum genome with 99% identity. The genome contains 3115 genes, 3052 protein-coding genes, assigned with the EggNOG database. On the basis of the results, 745 proteins are classified with an unknown function, from which 128 proteins have no match in the BLASTN database. It also contains 57 tRNAs, 5 copies of 5S rRNA, and 1 copy of tmRNA. Based on gene prediction and annotation results, 9.4% of proteins are involved in carbohydrate transport and metabolism and 8.46% in transcription, 2.36% are responsible for defense mechanisms, 0.5% are responsible for the biosynthesis of secondary metabolites, transport, and catabolism, while 25.11% have an unknown function. The genome revealed the presence of genes involved in riboflavin and folate production, the presence of CRISPR/Cas genes, phage sequences, the absence of acquired antibiotics resistance genes, virulence, and pathogenic factors, suggesting that UTNGt2 is a safe strain. Its highly antimicrobial capacity is related to the presence of two bacteriocin clusters (class IIc) of the sactipeptide class (contig 4) and plantaricin E class (contig 22), as detected by the BAGEL 4 webserver. Several RiPP-like peptides (non-bactericidal ribosomally produced and post-translationally modified peptides), polyketides (PKs), and terpenes were predicted. Whole-genome sequencing analysis revealed that the UTNGt2 strain has diverse bacteriocins with a high inhibitory capacity, thus it is a bacteriocinogenic strain. Considering the safety profile, UTNGt2 is a nonpathogenic, nonvirulent strain with valuable biotechnological traits and can be further exploited for its probiotic and antimicrobial potential in the food industry or as a potential producer strain of antimicrobial peptides as an alternative to conventional antibiotics.

Keywords: genome analysis, Lactiplantibacillus plantarum, antimicrobial peptides, food safety, RiPP-like peptides, plantaricin

1. Introduction

Lactic acid bacteria (LAB) are a group of microorganisms ubiquitously distributed in nature [1,2]. Due to their probiotic and antimicrobial characteristics, several LAB species are incorporated in different foods conferring health benefits to consumers, as well they contribute to food safety by inhibiting the proliferation of undesirable spoilage or pathogenic microorganisms [3,4,5,6,7,8].

Lactobacillus species are considered as natural food ingredients, for their use in human nutrition as a starter culture and are recognized as GRAS (Generally Recognized as Safe or Qualified Presumption of Safety) by the FDA Food and Drug Administration and EFSA (European Food Safety Authority) [9,10]. According to EFSA guidelines, the newly isolated strains intended to be used in foods should be characterized in terms of taxonomic identification, pathogenicity state, production of antimicrobials, genome sequencing, and characterization being considered straightforward diagnostic tools [11].

Various Lactobacillus species and strains draw interest for the development of new antimicrobials, functional foods, and the next generation of probiotics. Bacteriocins, produced by lactobacilli are the most promising antimicrobial candidates [11]. Besides, some strains harbor naturally CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) arrays and Cas associated proteins, which grant the capacity to be converted into a tool for genome editing [12]. Most LAB species used as probiotics or antimicrobial producers are of human or animal origin, and recently, several scientific documents indicated the probiotic potential of LAB species isolated from unconventional sources such as fruits, vegetables, juices, and grain products [8,13,14]. Among Lactobacilli, Lactobacillus plantarum is a potential candidate species [1,15,16]. However, to extend the probiotic microorganisms “list” by adding bacteria originated from “unique” sources hold interests, as those species might harbor useful features of the microsystem where they are originated from and might form an attractive alternative to gut bacteria as they are evaluated from a safety perspective [17].

The characterization of the microbiota of wild tropical fruits draws our attention [14]. Theobroma grandiflorum, commonly known as white cacao, Amazonian cacao, or copoazú, is a perennial tree typical of the tropical humid forest, which has its origins in the Brazilian Amazon region and belongs to the Malvaceae family. Few reports have characterized the fruit chemical composition (i.e., high content of fatty acids in seeds) and the antioxidant and antimicrobial capacity, which could be of great interest in the food, pharmaceutical, and cosmetic industry [18,19]. In general, the pulp is used for the preparation of jams, juices, yogurt, nectars, and sweets. In Ecuador, this shrub is grown spontaneously near the Amazonian region (Orellana Provence, city of Napo) and the fruits are exploited by the indigenous population for the preparation of ceremonial drinks after a fermentation process or as part of typical dishes and consumed as fried chunks.

The microbiota of these fruits was not investigated. On the basis of large-scale screening and selection analysis, several Lactobacillus species were selected, and their biotechnological potential was assessed. Among them, the UTNGt2 strain showed high antimicrobial potential inhibiting both E. coli and Salmonella enterica at the exponential growth phase, demonstrating its bacteriolytic mode of action [16,20]. Peptide extracts from the UTNGt2 strain perforate the cytoplasmic membrane, which disturbs the cell integrity, leading to the release of intracellular molecules, and finally to cellular death. On the basis of molecular analysis, we showed that the peptide extract contains more than one peptide or protein-like substance which work together for the overall inhibitory activity. Moreover, coating the tomato fruits with peptide extracts-based suspension proves to be a promising approach to control spoilage growth, thus enhancing the safety of food products [16]. Additionally, the UTNGt2 strain induces spheroplast and filament formation along with cell vacuolation and DNA relaxation as a secondary killing event in Salmonella enterica [21].

Considering the high antimicrobial capacity of the UTNGt2 strain demonstrated in vitro and ex vitro, in the present research, we perform genomic sequencing and characterization to identify specific genetic features related to food safety and highlight specific features for possible application as probiotics and the antimicrobial peptides producer strain. A gene prediction with Prokka and functional annotation with EggNOG is performed to identify the potential involvement of the predicted genes in different biological pathways. By employing different available web server tools, the presence of CRISPR sequences, antibiotic-resistant genes, virulence, and pathogenicity factors is predicted. The detection of biosynthetic gene clusters of antimicrobial compounds is investigated using BAGEL 4 (http://bagel.molgenrug.nl/, accessed on 20 November 2020) web server, a versatile fast genome mining tool valid not only for modified-, and nonmodified bacteriocins, but also for non-bactericidal ribosomally produced and post-translationally modified peptides (RiPPs) [22]. The input FASTA contig is analyzed in parallel using antiSMASH (http://antismash.secondarymetabolites.org, accessed on 2 December 2020), a web server tool for the automatic genomic identification and analysis of biosynthetic gene clusters [23]. This genomic meaning tool allows for the prediction of PKs (polyketide), NRPs (non-ribosomally produced peptides), RiPP-like peptides, terpenes, covering a wide range of known or putative secondary metabolite compounds. Subsequently, the present study aims to get an insight into L. plantarum UTNGt2 genome to predict the functionality of the genes encoding for bacteriocins, for further use as potent antimicrobials producer and complement with the detection of several secondary metabolites for additional use as a probiotic strain.

2. Results and Discussion

2.1. General Genome Overview of UTNGt2 Strain

A total of 3,264,448 bp reads with N50 of 186,152 bases, generated from the genome library were assembled into 31 scaffolds using the SPAdes genome assembler. The assembly summary results are presented in Supplementary Table S1. Before assembly, a k-mer analysis was performed to estimate the genome size of the sample. The mean of the k-mer coverage was 218.8, and the genome size was estimated at 3,540,752 bases with 457,386 bases of genome repeats length and 0.029 overall rates of heterozygosity. The GC content was 44.53%. The genome of reference L. plantarum WCFS1 strain isolated from human saliva was estimated at 3,348,624 bases with 44.5% GC content. To validate the accuracy of the assembly, Illumina reads were mapped to the assembly results (Supplementary Table S2). To assess the completeness of the genome assembly, BUSCO analysis was performed on the basis of evolutionarily informed expectations of gene content from near-universal single-copy orthologs. The recovered matches were classified as complete if their lengths were within the expectation of the BUSCO profile match length. When found more than once, they were classified as duplicates. The matches that were only partially recovered were classified as fragmented, and BUSCO groups for which no matches passed the test of orthologs were classified as missing. The summary of BUSCO analysis results is shown in Supplementary Table S3. Higher complete BUSCOs indicate good assembly. After the complete genome was assembled, BLAST analysis was carried out to identify to which species each scaffold showed similarity. All 31 contigs analyzed matched the core genome of different strains of the genera Lactobacillus with 99% identity (Table 1). Because the BLAST analysis resides on registered information from the database, the assembly results are matched with a relative or evolutionarily distant species due to sequence differences or errors that may occur during the assembly process. Therefore, rather than using it as an absolute criterion for species determination, it was more appropriate to use the analysis to identify patterns. More recently, on the basis of conserved pairwise average amino acid identity, core genome phylogeny, physiological criteria, clade-specific signature genes, and ecology, the genus Lactobacillus was split into 25 genera including Lactiplantibacillus, Fructiplantibacillus, Lactobacillus, among others [24]. Thus, we allocated the study samples according to this new classification and the UTNGt2 was assigned as Lactiplantibacillus plantarum.

Table 1.

Description of the best hit results matches in the NCBI NT database.

Accession Description Query # Query Length I_Pct. (%)
CP013750.1 CP013750.1 Lactobacillus plantarum strain KP plasmid unnamed1, complete sequence 1 87,144 99
CP009236.1 CP009236.1 L. plantarum strain 5–2, complete genome 4 436,043 99
CP025991.1 CP025991.1 Lactiplantibacillus plantarum subsp. plantarum strain LB1-2 chromosome, complete genome 1 63,686 99
CP012343.1 CP012343.1 L. plantarum strain ZS2058, complete genome 1 48,000 99
CP034694.1 CP034694.1 Lactiplantibacillus plantarum strain FBL-3a chromosome, complete genome 17 1,859,159 99
CP031771.1 CP031771.1 Lactiplantibacillus plantarum subsp. plantarum strain E1 chromosome 1 1169 99
CP021932.1 CP021932.1 Lactiplantibacillus plantarum strain TMW 1.1478 chromosome, complete genome 1 249,265 99
CP035143.1 CP035143.1 Lactiplantibacillus plantarum strain SRCM103357 chromosome, complete genome 1 1748 100
CP046262.1 CP046262.1 Lactiplantibacillus plantarum strain KCCP11226 chromosome, complete genome 1 4509 100
CP031702.1 CP031702.1 Lactiplantibacillus plantarum strain IDCC3501 chromosome, complete genome 1 10,237 100
CP032464.1 CP032464.1 Lactiplantibacillus plantarum strain ATG-K6 chromosome, complete genome 1 260,051 99
CP023728.1 CP023728.1 Lactiplantibacillus plantarum strain 10CH chromosome, complete genome 1 243,437 99

Query #: number of the sequenced match; Query Length: query sequence length; I_Pct. (%): percentage of identical matches.

2.2. Phylogenetic Analysis

The target sequence was aligned to the gcType 16S rDNA gene database, then several 16S rDNA sequences were selected to perform phylogenetic analysis on the basis of the alignment results.16S gene completeness was evaluated on the basis of the comparison between the submitted sequence and its most similar sequence in the gcType 16S rDNA gene database. A phylogenetic tree established with 16S rDNA analysis is presented in Supplementary Figure S1. As most of the used phylogenetic methods were developed to infer the phylogeny of a gene, and many genes have undergone horizontal transfer events, to elucidate precise phylogenetic relationships among genomes, a generally accepted process to infer whole-genome phylogeny is to use multiple genes that are thought to be orthologous (or unlikely underwent lateral transfer events) [25]. The genome of UTNGt2 was compared with selected 40 genomes from Firmicutes phylum. A list of reference genomes, species, and lineage is presented in Supplementary Table S4. To perform marker gene-based phylogenetic analysis, 56 marker genes were extracted from the submitted and selected genomes. The alignment results of the 56 marker genes are shown in Figure 1. This analysis placed the UTNGt2 strain in the same clade with Lactobacillus plantarum (GCA_000143745.1), L. plantarum subps. argentoratensis (GCA_0013641165.1), and L. pentosus (GCA_003641185.1).

Figure 1.

Figure 1

Phylogenetic tree based on the multiple alignment result of 56 selected marker genes with the gyType database. Query 1: UTNGt2 strain (red line).

2.3. Gene Prediction and Genome Annotation

The genome contains 3115 genes, 3052 protein-coding genes (CDS), 57 tRNAs, 5 rRNA, and 1 copy of tmRNA. A physical genome map of UTNGt2 in comparison to the reference strain L. plantarum WFCS1 is shown in Figure 2. Prokka was used to predict the location, while BLAST was used to know about the function and identification of assembled sequences against nucleotide and protein sequence database. Based on the EggNOG annotation results, 9.4% of proteins are involved in carbohydrate transport and metabolism, 8.46% in transcription, 2.36% responsible for defense mechanisms, 0.5% responsible for the biosynthesis of secondary metabolites, transport, and catabolism, while 25.11% has an unknown function (Supplementary Table S5). The genes encoding proteins and their predicted functions are displayed in Figure 3. Predicted genes with Prokka in the previous step were aligned with several databases to obtain their corresponding annotations with the aligners. The summary of the annotation results is shown in Table 2. Genes were annotated with the KEGG protein ID first, then mapped to the KO entry, and further mapped to the KEGG pathway. The number of genes in each category is shown in Figure 4. The production of vitamins during the fermentation of raw material by lactobacilli is greatly exploited by food biotechnology. Based on Prokka and EggNOG annotation, UTNGt2 harbored folate (vitamin B9) and riboflavin encoding genes and is deficient in the genes encoding for niacin (B3), pantothenate (B5), and pyridoxine (B6). However, the riboflavin cluster contains 7 genes (ribBA, ribD, ribE, ribH, yitU, and ribF (2 copies)), and the folate cluster contains 6 genes (folB, folC, folD, folE, folK, folP). Early investigation showed the presence of nine folate genes in the reference strain L. plantarum WCFS1 genome. The riboflavin cluster genes were found early in several strains such L. plantarum ATCC8014, KC28, JDM1, and so forth. [1]. Recently, fortifying different natural food matrices with UTNGt2 cells increases Vitamin C content, total polyphenols, and antioxidant capacity (GNT, unpublished results), suggesting that that lactic cells could enhance the bioavailability and antioxidant capacity of these natural matrices, a benefit given by a probiotic strain.

Figure 2.

Figure 2

Circular map view of the L. plantarum UTNGt2 genome generated using CGView Server (http://cgview.ca, accessed on 16 February 2021). The contents are arranged in feature rings (starting with outermost ring): outermost first ring represents the map of reference taxa Lactobacillus plantarum WCFS1; second ring shows the UTNGt2 CDS (coding sequences) with Prokka annotation (both strands combined); tRNA, rRNA, tmRNA are indicated; third ring displays the G + C content; fourth ring G/C skew information in the (+) strand (brown color) and (−) strand (violet color); CRISPR are marked.

Figure 3.

Figure 3

EggNOG category distribution of functional annotation result. Number of genes per category is indicated.

Table 2.

Gene annotation summary performed by aligning gene sequences of the UTNGt2 genome to the sequences from several databases.

Sample Number of Genes Number of CDS CARD MetaCyc PHI CAZy VFDB SwissProt KEGG COG
Gt2 3155 3052 39 (1.27%) 413 (13.49%) 113 (3.69%) 107 (3.50%) 103 (3.36%) 1129 (36.88%) 2989 (97.65%) 2334 (76.25%)

Legend: CARD: Comprehensive Antibiotic Resistance Database; MetaCyc: database that contains pathways involved in both primary and secondary metabolism; PHI: The Pathogen-Host Interaction database is a biological database that contains curated information on genes experimentally proven to affect the outcome of pathogen-host interactions (http://www.phi-base.org/searchFacet.htm?queryTerm, accessed on 25 November 2020); CAZy: Carbohydrate-active enzyme (http://www.cazy.org/), accessed on 25 November 2020; VFDB: virulence factor database, (http://www.mgc.ac.cn/VFs/main.htm, accessed on 25 November 2020); SwissProt: https://www.uniprot.org/statistics/Swiss-Prot (accessed on 25 November 2020); KEGG: Kyoto Encyclopedia of Genes and Genomes; COG: Clusters of Orthologous Groups of proteins. Number of genes and % is shown.

Figure 4.

Figure 4

Mapping of the KEGG proteins according to their function. The number of genes in each category is shown.

2.4. Prediction of Antibiotic Resistance Genes, Virulence Factors, Pathogenicity, and Prophage

On the basis of the CARD protein ID, 39 predicted genes were grouped by Drug Class, Resistance Mechanism, and AMR gene family. The number of genes in each category is shown in Supplementary Figure S2A–C). The UTNGt2 strain harbored several putative resistance genes associated with resistance to lincosamide (6), penam (4), tetracycline (4), fosfomycin (5), fluoroquinolone (8), a macrolide (3), rifamycin (3), and peptide (11). On the basis of RGI tool criteria, any antimicrobial-resistant genes were detected. Recent research on five L. plantarum strains isolated from fermented chicha beverage indicated the presence of aadA gene encode for aminoglycoside modifying enzymes which mediate specifically the resistance against spectinomycin and streptomycin [1]. In the present study, by using CARD analysis, RGI, and Prokka no equivalent intrinsic aminoglycoside resistance genes were predicted. Complementary antibiotic susceptibility (antibiotic disk assay and minimum inhibitory concentration value determination) according to the FEEDAP document [26] indicate that UTNGt2 is susceptible to ampicillin, amoxicillin, gentamycin, erythromycin, penicillin, cefotaxime, and tetracycline (Supplementary Table S6) as any MIC values were higher than the breakpoints. The presence of Tet-R gene in L. plantarum B43 isolated from the human oral cavity was previously investigated [27]. The most common Tet-R genes (tetM, tetW, tetK, tetL, tetS, and tetO) code a RPP (ribosomal protection proteins) or MFS (major facilitating superfamily) efflux protein. Through whole-genome analysis with Prokka and EggNOG annotation, two tetracycline-resistant genes, tetO (COG0408) and tetA (tetracycline-resistant protein class B), have been detected in the UTNGt2 strain. BLASTN analysis indicated 99.75% identity with L. plantarum (WP_024002387.1). Early studies on L. plantarum CCUG 43,738 indicated that the strain displayed atypical phenotypic resistance to tetracycline (MIC, 512 μg/mL) due to the presence of tet(S) gene located on a plasmid [28]. In other studies, the presence of tetW gene in Bifidobacterium animalis subsp. lactis was associated with tetracycline resistance [29]. No acquired resistance genes were found in the UTNGt2 genome, neither mobile elements were detected with PlasmidFinder indicating its stability.

Several genes (a total of 103 genes predicted, from which 11 were not annotated) were predicted as putative virulence factors by VFDB (data not shown). Any of the known virulence genes gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), and ace (adhesion of collagen), were detected in the UTNGt2 genome. The absence of these genes was confirmed by EggNOG annotation results. Two genes (sugC) coding for carbohydrate ABC transporter ATP-binding protein (CUT1 family) with 46.8% and 52.3% identity, a gene coding for putative enolase (eno) with 70% identity, and a putative gene coding for hemolysin III (hlyIII) with 42.4% identity, were predicted in the category of virulence factors, but their expression needs to be further investigated. Early genome comparison of several L. plantarum strains indicated the presence of several putative genes annotated as virulence factors (such as the putative formate acetyltransferase 3-ybiW gene or mdxE-maltodextrin (ABC-transporter protein gene), but they seem to be only spurious partial hits, which may exert other cellular functions [30]. In this study, the mdxE gene, but not 3-ybiW, was annotated with EggNOG in the UTNGt2 genome in the category “G” of carbohydrate transport and metabolism.

Analysis using contigs as input files exhibited that the strain does not contain any pathogenicity factors. The probability of being a pathogen was low (<0.081 out of 1) and the strain was predicted as a nonhuman pathogen. These results were consistent with the qualified presumption of the safety status and agreed with other studies indicating that five L. plantarum strains isolated from a fermented chicha, an indigenous drink from Argentina were safe [1].

PHASTER analysis revealed the presence of four prophages, from which only one intact region was predicted in the contig 6, while the other three were incomplete and detected within contigs 2, 3, and 5 (Supplementary Table S7). The highest intact phage region has 39.9 Kb with the most common: PHAGE_Lactob_Sha1_NC_019489(27). A similar intact phage was detected in L pentosus MP-10 genome [31] and several L plantarum strains [30]. The incidence of prophage DNA (>40) within lactobacilli genomes were reported and their presence highlights the genetic diversity and fitness of the Lactobacillus genome [31], as well as may confer a selective advantage to the cell, promoting its survivability and its resistance to other infecting phages [32]. On the basis of these results, we conclude that the UTNGt2 strain might be considered a safe strain.

2.5. CRISPR/Cas System Prediction

The genome of UTNGt2 strain harbor one CRISPR arrays within contig 1 (begin at 50,489) with 36 bp repeat length and 11 repeats matching a consensus sequence with evidence level 4 according to CRISPRFinder analysis (Table 3). Three additional putative CRISPR arrays were detected within contigs 8 and 9 (evidence level 1). One mandatory CRISPR-associated protein of Type IIA system (Csn2_0_II_A), and three CRISPR-associated endoribonucleases, Cas2_0_I-II-III, Cas1_0_II, and Cas9_0_II of Type IIC system were predicted within contig 1 (Table 4). These genes were annotated with Prokka and EggNOG with the category “L” of Replication, recombination, and repair. Compared with other well-characterized main types such as I and III, the Type II systems are rare in nature and possess three subtypes, II-A, II-B, and II-C, and two variants, II-C1 and II-C2 [33]. The Cas9 proteins represent the signature protein of these systems. Early research indicates that Cas9 has some involvement in new spacer acquisition [34] and may prime potential protospacer sequences for Cas1/Cas2 recruitment [35]. Nonetheless, CRISPR/Cas system may prevent the L. plantarum strains to acquire antimicrobial-resistant genes or pathogenic genes through horizontal transfer genes [1]. By employing CRISPRCasFinder web service, in the reference strain L. plantarum WCFS1, no CRISPR array was detected. Nonetheless, along with the prediction of probiotic capabilities, there is an increasing interest in the manipulation of the genome of probiotic strains via the CRISPR/Cas system for the production of the next generation of robust probiotics with novel functionalities and the capacity to deliver new biomolecules.

Table 3.

CRISPR array system detection with CRISPRFinder within the UTNGt2 genome.

CRISPR_ID Start End Length (bp) Potential Orientation Consensus_Repeat Number of CRISPRs_with_Same_Repeat (CRISPRdb) Repeat_Length Spacers Number Number Repeats Matching Consensus Conservation_Repeats (% Identity) Evidence_Level
contig1_1 50,489 51,250 761 Reverse GTTCTAAACCTGTTTGATATGACTACTATTCAAGAC 3 36 11 12 100.00 4
contig8_1 73,175 73,277 102 Reverse ATGGCGAAGAAGAAGAACCAGAATACGACAAACC 0 34 1 1 97.06 1
contig8_2 150,018 150,117 99 Unknown TGCACTGGTAACTGAGCTGGCGCTG 0 25 1 1 96.00 1
contig9_1 97,887 97,972 85 Reverse AATAAGATACTTTAAGTTTCTTA 0 23 1 1 95.65 1

Table 4.

Cas type detection with the CRISPRFinder webservice.

Sequence ID Cas-Type/Subtype Gene Status System Type Begin End Strand
contig1_50 Csn2_0_IIA Mandatory CAS-TypeIIA CDS 51,275 51,952 -
contig1_51 Cas2_0_I-II-III Accessory CAS CDS 51,949 52,254 -
contig1_52 Cas1_0_II Accessory CAS-TypeIIC CDS 52,232 53,137 -
contig1_53 Cas9_0_II Accessory CAS-TypeIIC CDS 53,331 57,407 -

2.6. Prediction of Bacteriocins and Bioactive Products

Antimicrobial activity against foodborne pathogens was previously described [20]. Cell-free supernatant from UTNGt2 showed high inhibitory potential against Salmonella spp., Shigella spp., E. coli spp., and Enterobacter spp., and the inhibitory activity was proved to be of proteinaceous demonstrated by the presence of different size peptides produced in the extract [20]. Additionally, the potential of this strain to inhibit pathogens and fungi was demonstrated in tomato fruits. In this study, by employing BAGEL 4 webserver, we detected that UTNGt2 harbors two bacteriocin clusters, named as Area of interest (AOI) within contig 4.12 (start at 63,041, end 83,041) of the sactipeptide class (ribosomally synthesized peptides), and contig 22.27 (start at 11,549, end 41,159) of plantaricin E class (Figure 5). The AOIs located in contig 4 consist of two ABC transporter ATP binding proteins, and multiple ORFs (Open Reading Frames), while the AOI of contig 22 resides of plantaricin E/F, plantaricin J (2 protein), plantaricin A, as core proteins. Further, two genes, HlyD and LanT coding for Accessory factor for ABC-transporter PlnH and Bacteriocin ABC-transporter, ATP-binding, and permease protein PlnG were detected downstream of plantaricin E/F (class IIb two-peptide bacteriocin). Three additional ORF regions, orf000033, orf00044, and orf00062 were predicted as Bacteriocin production-related histidine kinase and putative bacteriocin immunity proteins, respectively. Plantaricin A belongs to the alpha/beta Enterocin family, which is a class II bacteriocin with double-glycine leader peptide (Evalue = 3 × 10−29, match = 100.00%). Enterocin X_chain_beta protein sequence from UTNGt2, is a lactococcin-like protein (class IIb), having 53% identity with enterocin X from Enterococcus faecium KU-B5. BLASTN analysis indicated that this peptide was found in Lactiplantibacillus plantarum (WP_027821506.1) with 100% amino acid sequence identity. These peptide does not show any conserved domain. Enterocin X is a thermostable non-lanthionine-containing two-peptide bacteriocin whose full antibacterial activity requires the interaction of two complementary peptides [36]. Early genome analysis of L. plantarum strain CECT8963 isolated from chicha fermented beverage showed different organization of bacteriocin-like genes, neither enterocin X, plantaricin NC8-alpha and NC8-beta, plantaricin A and J were detected [1].

Figure 5.

Figure 5

Organization of bacteriocin cluster genes. Area of interest (AOI) of L. plantarum UTNGt2 of contig 4 and contig 22 (A) and L. plantarum WCFS1 (B). Genes with function determined from left to right (gene name, function, and locus tag): contig 4: Probable ABC transporter permease protein and Probable ABC transporter ATP-binding protein spyM18_0273; GTP 3′,8-cyclase OS = Lactobacillus plantarum (strain ATCC BAA-793/NCIMB 8826/WCFS1); contig 22: orf00005, DNA helicase IV OS from Bacillus subtilis (strain 168); orf0007, orf0008 and orf00011, PlnS (CAAX protease self-immunity); HlyD, accessory factor for ABC-transporter PlnH; LanT, bacteriocin ABC-transporter, ATP-binding and permease protein PlnG; 170.2 Plantaricin_F, plantaricin F; orf00027, P71468_LACPL PlnI (Immunity protein PlnI, membrane-bound protease CAAX family); orf00030, response regulator PlnD; orf00031, response regulator PlnC; orf00033, bacteriocin production related histidine kinase; 167.2 plantaricin A, orf00036-00040, function not determined; orf00044, putative bacteriocin Immunity protein; orf00046, orf00050, not determined function; 97.2 Enterocin_X_chain + beta; orf00053, ComC; Lactococcin; Bacteriocin_IIc; 176.2;Plantaricin_NC8-beta; 171.2; Plantaricin_F; 175.2;Plantaricin_NC8-alpha; 172.2;Plantaricin_J. GlyS: Glycotransferase family 2 protein; 185.2, PlnK putative; 174.2, Plantaricin N (bacteriocin 2c); red blocks: immunity and transport; green arrow: core peptide; pink block: transport and leader cleavage; blue block: peptide modifications; grey blocks: no function determined.

The reference strain L. plantarum WCFS1 strain harbors a single bacteriocin cluster as detected by BAGEL 4 analysis and the orientation of the genes was opposite to the same genes found in UTNGt2. Database hit to plantaricin J, putative plnK, plantaricin A, plantaricin N, and plantaricin E/F along with several ORFs coding for ABC transporters. However, the bacteriocin cluster of UTNGt2 strain is more complex organized harboring several genes coding for different bacteriocins, which might explain its broad inhibitory spectrum [20]. Molecular analysis indicated four products of approximately 22, 32, 35, and 55 kDa in the peptide extract from UTNGt2 [16]. On the basis of EggNOG annotation, two additional genes, lcnD and lacD coding for Lactococcin A secretion protein LcnD and Lactococcin-G-processing and transport ATP-binding protein LagD were detected. BLAST against data core proteins indicated that the UTNGt2 genome sequence hit with rSAM-modified_RiPP_077 (Bit Score = 33.113), rSAM-modified_RiPP_075 (Bit Score = 31.187), bovicin_225_variant (Bit score = 32.7278) from Streptococcus bovis and Blp (Bit score = 30.0314) from Streptococcus pneumoniae TIGR4. These findings were in agreement with our previous results indicating the high inhibitory potential of this strain as more than one peptide act as an antimicrobial unit [21]. By treating Salmonella cells with UTNGt2 peptide extract at the final concentration of 1 X MIC, spheroplast formation was observed, the cells showed changed shape, the inner and outer membranes were intact, but they lost peptidoglycans layer, while by increasing the concentration of peptides (2 X MIC) along with the spheroplasts, some “ghost cells” were noted, indicating that target bacteria were devoid or near-devoid cytoplasm [21]. An early study on conventional antibiotics, such as penicillin G, and beta-lactam, indicated that these convert bacteria into spheroplasts [37,38]. Additionally, the production of ghost cells might be exploited further for the production of the next generation of vaccines.

Microorganisms can produce a diverse range of metabolites known as natural products encoded by different biosynthetic gene clusters. Ribosomal synthesized and post-translationally modified peptides (RiPPs) are defined by a genetically encoded precursor peptide that is tailored by the associated biosynthetic enzymes to form the mature product [39]. These metabolites had various biological functions [40]. Two major metabolites biosynthetic clusters of bacteria enclose polyketide synthases (PKS) and non-ribosomal peptide synthases (NRPS), which are well-known to synthesize a diverse range of products with beneficial applications in medicine and research, such as antibiotics, antifungals, and immunosuppressants [41]. In this study, using AntiSMASH webserver, three metabolites’ regions were detected as follows: region 6.1 (location:1–26,879 nt): T3PKS (Type III polyketide synthase) within contig 6, region 16.1 (location: 26,176–47,057 nt): Terpene, contig 16 and region 22.1 (location: 14,131–26,281 nt): RiPP-like proteins within contig 22. When analyzing the most similar gene clusters by comparison with MiBIG database, several cluster regions were detected (Supplementary Table S8). A comparison between the RIPP gene clusters detected in the UTNGt2 genome and the reference L. plantarum WCFS1 strain is shown in Figure 6. By employing similar web tools, early studies indicated that the genome of L. plantarum strain LL441 does not harbor any putative bacteriocin gene cluster or genes involved in the synthesis of secondary metabolites with an antimicrobial capacity [15]. Thus, the results indicated that the UTNGt2 strain can be used as a bacteriocin producer strain and as a source of bioactive natural products.

Figure 6.

Figure 6

A comparison between the RIPP gene clusters detected in the UTNGt2 genome and the reference L. plantarum WCFS1 strain. Different color marked the difference between the substances produced by each strain. Legend: RiPP-like: other unspecified ribosomally synthesized and post-transcriptionally modified peptide product (RiPP) cluster; RiPP: Ribosomal synthesized and post-translationally modified peptides; T3PKS: Type III polyketide synthase; Terpene: terpene compounds. PK: polyketide; NRP: non-ribosomally produced peptides. Other: cluster containing a secondary metabolite-related protein that does not fit into any other category.

3. Materials and Methods

3.1. Strain and Culture Conditions

Lactiplantibacillus (formally Lactobacillus) plantarum strain UTNGt2 was grown in MRS medium (Merck, Darmstadt, Germany) at 37 °C under static aerobic conditions. The strain was previously identified based on 16S rDNA sequencing and was registered in 2018 (November) with GenBank accession no. KY041688.1.

3.2. NGS de Novo Assembly of UTNGt2

De novo assembly was performed to generate sequences of UTNGt2 sample using Illumina HiSeq X Ten platform as previously described (custom service, Macrogen Inc.; Seoul, Korea) [42]. In brief, the sequencing library was prepared by random fragmentation of the DNA or cDNA sample, followed by 5′ and 3′ adapter ligation according to the protocol provided by the manufacturer (Macrogen Inc.; Seoul, Korea). Sequencing data were converted into raw data for analysis. The overall quality of reads generated by FastQC (v0.11.5, http://www.bioinformatics.babraham.ac.uk/projects/fastqc, accessed on 16 October 2020), total bases, total reads, GC content, and basic statistics were calculated. To reduce biases in the analysis, adapter trimming and quality filtering were performed. Trimmomatic v0.36 (http://www.usadellab.org/cms/?page=trimmomatic, accessed on 16 October 2020) was used to remove adapter sequences. The quality of filtered reads, total bases, total reads, GC content, and basic statistics were calculated. De novo assembly was performed by various k-mer using SPAdes 3.15.1 (http://cab.spbu.ru/software/spades/, accessed on 16 October 2020). K-mer analysis was performed to provide information about coverage, heterozygosity, and estimated genome size (Jellyfish v2.2.10, http://www.genome.umd.edu/jellyfish.html, accessed on 16 October 2020). Using filtered reads, de novo assembly was performed using a De Bruijn graph assembler (http://qb.cshl.edu/genomescope/, accessed on 16 October 2020). The reads were split into multiple K-mers (Oligonucleotides with length “K”, K equal integer), which were further aligned with each other, and the sequences were extended one base at a time based on the overlap information of K-mers. The best k-mer was selected on the basis of various statistics from assembly results (number of contigs, total base of contigs, N50, etc.) and the best-assembled sequence set was determined. The assembled genome was validated using mapping strategy and BUSCO analysis (https://busco.ezlab.org/, BUSCO version 3.0) [43]. The filtered reads were aligned to the assembled genome, and their insert size was estimated for validation. To assess the completeness of the genome assembly, BUSCO analysis was performed based on evolutionarily informed expectations of gene content from near-universal single-copy orthologs. By default, a bacteria database was used for analysis. After the complete genome or draft genome was assembled, BLAST analysis was carried out to identify to which species each scaffold showed similarity.

3.3. Evolutionary Relationship

The total contig sequences in FASTA format were submitted to the gcType whole-genome database through the Global Catalog of Microorganisms genome annotation project pipeline initiative (http://gctype.wdcm.org) [44] for species classification. Based on the web tool analysis strategy, from the submitted genome sequence the 16S rDNA sequence(s) is extracted and aligned to the gcType 16S rDNA gene database using BLAST. BLAST results are sorted in descending order based on the identity (i.e., the top sequence is the one with the highest sequence similarity) and are used to estimate the 16S rDNA gene completeness. Extracted and selected 16S rDNA sequences are further aligned using MAFFT [45]. By default, RAxML (Randomized Axelerated Maximum Likelihood) was employed for phylogenetic analysis of large datasets under maximum likelihood [46]. Its major strength is a fast maximum likelihood tree search algorithm that returns trees with good likelihood scores. Moreover, the submitted genome sequence is aligned to the gcType whole-genome database using Mash [47]. Various genome similarity metrics, Average Nucleotide Identity between the genomes (ANIb), FastANI (fast alignment-free computation of whole-genome Average Nucleotide Identity), orthoANIb, and orthoANIu were calculated between the submitted genome and genome sequences from the database [25,48,49]. By default, for phylogenetic analysis, a multi-marker association method for genome-wide association studies without the need for a population structure correction was assessed [50].

3.4. Gene Prediction and Genome Annotation

After the whole genome or draft genome was assembled, the location of protein-coding sequences, tRNA genes, rRNA genes, and tmRNA genes was identified. Then, their functions were annotated. The following tools were used to predict each functional element: Prodigal for CDS prediction [51], RNAmmer for rRNA prediction (http://www.cbs.dtu.dk/services/RNAmmer/, accessed on 16 October 2020), Aragorn for tRNA/tmRNA prediction (http://www.ansikte.se/ARAGORN/, accessed on 16 October 2020), Signal IP for signal leader peptide prediction (http://www.cbs.dtu.dk/services/SignalP/, accessed on 16 October 2020) and Infernal for non-coding RNA prediction. After gene prediction was completed with the Prodigal prediction of protein-coding sequences, ORFs, and subsequent gene annotation, was performed using the Microbial Genome Annotation Pipeline online server (Prokka v1.14.5), by which coding sequences and rRNAs and tRNAs were predicted [52]. Prokka conducts analysis based on ISfinder, NCBI Background Reference Gene DB, UniProtKB DB, and HMM DB. Genome map of L. plantarum UTNGt2 was predicted using CGView [53]. For comparison, reference strain Lactobacillus plantarum WCFS1 and the complete sequence genome available in the NCBI database were used (NC_004567.2).

3.5. Functional Annotation

For functional annotation, InterProScan v5.0 (https://www.ebi.ac.uk/interpro/search/sequence/, accessed on 16 October 2020) and EggNOG DB (Evolutionary genealogy of genes: Non-supervised Orthologous Groups), provided by EMBL (http://eggnog5.embl.de/#/app/home, accessed on 16 October 2020) were used [54,55]. EggNOG DB is similar to COG DB, which contains genes classified on the basis of their function and annotations. In this analysis, psi-BLAST was used to match the predicted protein sequences with EggNOG DB. Moreover, through the Global Catalog of Microorganisms genome annotation project pipeline (http://gctype.wdcm.org, accessed on 25 November 2020) [44], the predicted genes were annotated automatically by several databases, SwissProt (https://www.uniprot.org/statistics/Swiss-Prot, accessed on 25 November 2020), MetaCyc (a database that contains pathways responsible for both primary and secondary metabolism, as well as associated metabolites, reactions, enzymes, and genes; https://metacyc.org, accessed on 25 November 2020); KEGG (Kyoto Encyclopedia of Genes and Genomes); CAZy: Carbohydrate-active enzyme (http://www.cazy.org/, accessed on 25 November 2020); VFDB (a virulence factor database, http://www.mgc.ac.cn/VFs/main.htm, accessed on 25 November 2020); PHI: The Pathogen-Host Interaction database is a biological database that contains curated information on genes experimentally proven to affect the outcome of pathogen-host interactions (http://www.phi-base.org/searchFacet.htm?queryTerm, accessed on 25 November 2020).

3.6. Prediction of Genes Involved in Food Safety

The genome was assessed for safety using several tools recommended in the EFSA Guidance [11]. CARD (Comprehensive Antibiotic Resistance Database) (http://arpcard.mcmaster.ca/, accessed on 13 January 2021) [56] for identifying antibiotic resistance and virulence factors using RGI tool (Resistance Gene Identifier) (under Perfect hit, Rigorous hit alone, and Perfect, Strict, and Loose hit criteria) was used by importing the contigs with “perfect and strict hits only” and “high-quality coverage” [57]. The ResFinder 4.1 server (https://cge.cbs.dtu.dk/services/ResFinder/, accessed on 13 January 2021) was employed to identify the acquired antimicrobial resistance genes with a selected % ID threshold of 90.00% and the Selected minimum length of 60% and/or chromosomal mutations [58]. PlasmidFinder 2.0 was used to search for mobile elements (https://cge.cbs.dtu.dk/services/PlasmidFinder-2.0/, accessed on 13 January 2021); VFDB (virulence factor database, http://www.mgc.ac.cn/VFs/main.htm, accessed on 13 January 2021) was employed to predict putative virulence factors [59]. CRISPRFinder (https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFinder/Index, accessed on 13 January 2021) was used to detect the CRISPR and Cas genes by importing the contig FASTA sequences and selecting “Perform cas detection” and leaving the rest of the parameters by default [60]. PHASTER (PHAge Search Tool Enhanced Release) (http://phaster.ca, accessed on 15 January 2021) [57] were used to detect and annotate prophage sequences within bacterial genomes. PathogenFinder web server (http://cge.cbs.dtu.dk/services/PathogenFinder/, accessed on 15 January 2021) was used for the prediction of bacterial pathogenicity using as input the contig file in FASTA format [61].

3.7. Prediction of Putative Gene Cluster Coding Bacteriocins and Other Bioactive Compounds

To predict genes coding for bacteriocins and ribosomal synthesized and post-translationally modified peptides (RiPPs), the BAGEL4 webserver 6 was used by importing the contig FASTA sequences [62]. Also, BLAST analysis against the core peptide database was performed. To identify the gene clusters encoding secondary metabolites of all known broad chemical classes, AntiSMASH version 6.01 alfa 1 (Antibiotics and Secondary Metabolite Analysis Shell) [23] webserver (https://docs.antismash.secondarymetabolites.org, accessed on 2 December 2020) was used. The contigs FASTA file of the UTNGt2 was used as the input file, selected by default antiSMASH features: “KnownClusterBlast analysis”: the identified clusters are searched against the MIBiG repository (a hand-curated data collection of biosynthetic gene clusters, which have been experimentally characterized) and “Subcluster Blast analysis”: the identified clusters are searched against a database containing operons involved in the biosynthesis of common secondary metabolite building blocks (e.g., the biosynthesis of non-proteinogenic amino acids) as well as detection of the active sites (active sites of several highly conserved biosynthetic enzymes are detected and variations of the active sites are reported). An overview of the detected regions in the contigs is displayed as recommended [63].

4. Conclusions

Overall, this study reports the whole-genome sequence of Lactiplantibacillus plantarum UTNGt2 strain, being to the best of our knowledge the first genome draft of a lactic bacteria isolated from wild cacao fruit. This unique genome was composed of several genes encoding for proteins with unknown or hypothetical function. On the basis of genomic analysis, various protein families were categorized according to their functions, and cluster genes of secondary metabolites were detected. However, two bacteriocin cluster genes and several RiPP-like peptides, polyketides, and terpenes were detected, thus confirming its promising antimicrobial capacity or a novel therapeutic agent. The genetic variability of L. plantarum UTNGt2 strain was defined by the diversity of hypervariable CRISPR/Cas systems. The production of riboflavin and folate, the absence of acquired antibiotics resistance genes, virulence, and pathogenic factors suggesting that UTNGt2 is a safe strain, thus can be further tested for its probiotic potential and production of bioactive compounds (enzymes, vitamins, amino acids, etc.) for the food industry. Our study illustrated the genome of a strain with valuable traits to be additionally exploited as a natural food preservative or protective cover that might reduce the contamination by pathogenic microorganisms invading the food during manipulation or storage. The dual role, probiotic and antimicrobial, will allow to design novel antimicrobial formulations, peptide- or cell-based, for a novel starter or preservative culture in dairy or no dairy foods, giving, as a result, a fortified product with acceptable organoleptic profile, with improved characteristics such a high inhibitory ability, prolonged shelf-life, or additional bioactive health-promoting features including, enhanced antioxidant capacity and improved vitamins and polyphenols content, inherent to their ecological origin, which could, thus, be explored in various biotechnological applications.

Acknowledgments

The authors are thankful to Technical University of the North, Centre of Research (CUICYT) for funding this research. The authors would like to express their sincere gratitude to D. Brown for carefully reviewing and correcting the manuscript.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10040383/s1, Supplementary Table S1: Assembly summary results; Supplementary Table S2: Mapping overall results; Supplementary Table S3: BUSCO analysis results; Supplementary Table S4: List of reference ID genomes, species, and lineage used for phylogenetic analysis retrieved from the gyType database; Supplementary Table S5: EggNOG category distribution result; Supplementary Table S6: Antibiotic susceptibility of the UTNGt2 strain; Supplementary Table S7: Summary of Prophage regions identified on the UTNGt2 genome using the PHASTER webserver; Supplementary Table S8: Description of the Cluster gene regions of UTNGt2 detected showing similarity on the MIBig database; Supplementary Figure S1: Phylogenetic tree based on the multiple alignment result of the target and selected 16S gene sequences to the gcType 16S rDNA gene database; Supplementary Figure S2: Genes annotated with the CARD protein ID and grouped by Drug Class (B), Resistance Mechanism (B), and AMR gene family (C).

Author Contributions

G.N.T., C.O. contributed to formal investigation and analysis. G.N.T. contribute to conceptualization, methodology, data curation, supervision, project administration, funding acquisition, writing—original draft preparation, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Centre of Research (CUICYT) of the Technical University of the North, Grant No. 2929/2019.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Genome assembly data were deposited in the NCBI Database: BioProject PRIJNA705232 y BioSample SAMN18053630 on 26 February 2021.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Rodrigo-Torres L., Yépez A., Aznar R., Arahal D.R. Genomic insights into five strains of Lactobacillus plantarum with biotechnological potential isolated from chicha, a traditional maize-based fermented beverage from Northwestern Argentina. Front. Microbiol. 2019;10:2232. doi: 10.3389/fmicb.2019.02232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brandt K., Nethery M.A., O’Flaherty S., Barrangou R. Genomic characterization of Lactobacillus fermentum DSM 20052. BMC Genom. 2020;21:1–13. doi: 10.1186/s12864-020-6740-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Barrangou R., Lahtinen S., Ibrahim F., Ouwehand A. Genus Lactobacillus. In: Lahtinen S., Ouwehand A.C., Salminen S., von Wrigh A., editors. Lactic Acid Bacteria: Microbiological and Functional Aspects. 4th ed. CRC Press; Boca Raton, FL, USA: 2011. pp. 77–86. [Google Scholar]
  • 4.Fernández L., Langa S., Martín V., Maldonado A., Jiménez E., Martín R., Rodríguez J.M. The human milk microbiota: Origin and potential roles in health and disease. Pharmacol. Res. 2013;69:1–10. doi: 10.1016/j.phrs.2012.09.001. [DOI] [PubMed] [Google Scholar]
  • 5.Swain M.R., Anandharaj M., Ray R.C., Rani R.P. Fermented fruits and vegetables of Asia: A potential source of probiotics. Biotechnol. Res. Int. 2014;2014:250424. doi: 10.1155/2014/250424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yépez A., Luz C., Meca G., Vignolo G., Mañes J., Aznar R. Biopreservation potential of lactic acid bacteria from Andean fermented food of vegetal origin. Food Control. 2017;78:393–400. doi: 10.1016/j.foodcont.2017.03.009. [DOI] [Google Scholar]
  • 7.Adesulu-Dahunsi A., Jeyaram K., Sanni A. Probiotic and technological properties of exopolysaccharide producing lactic acid bacteria isolated from cereal-based nigerian fermented food products. Food Control. 2018;92:225–231. doi: 10.1016/j.foodcont.2018.04.062. [DOI] [Google Scholar]
  • 8.Goel A., Halami P.M., Tamang J.P. Genome analysis of Lactobacillus plantarum isolated from some Indian fermented foods for bacteriocin production and probiotic marker genes. Front. Microbiol. 2020;11:40. doi: 10.3389/fmicb.2020.00040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Leuschner R.G., Robinson T.P., Hugas M., Cocconcelli P.S., Richard-Forget F., Klein G., Licht T.R., Nguyen-The C., Querol A., Richardson M., et al. Qualified presumption of safety (QPS): A generic risk assessment approach for biological agents notified to the European Food Safety Authority (EFSA) Trends Food Sci. Technol. 2010;21:425–435. doi: 10.1016/j.tifs.2010.07.003. [DOI] [Google Scholar]
  • 10.Laulund S., Wind A., Derkx P.M.F., Zuliani V. Regulatory and safety requirements for food cultures. Microorganisms. 2017;5:28. doi: 10.3390/microorganisms5020028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.EFSA FEEDAP Panel Guidance on the Characterisation of microorganisms used as feed additives or as production organisms. EFSA J. 2018;16:e05206. doi: 10.2903/j.efsa.2018.5206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sun Z., Harris H.M.B., McCann A., Guo C., Argimón S., Zhang W., Yang X., Jeffery I.B., Cooney J.C., Kagawa T.F., et al. Expanding the Biotechnology potential of lactobacilli through comparative genomics of 213 strains and associated genera. Nat. Commun. 2015;6:8322. doi: 10.1038/ncomms9322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Oliveira J., Costa K., Acurcio L., Sandes S., Cassali G., Uetanabaro A., Costa A., Nicoli J., Neumann E., Porto A. In vitro and in vivo evaluation of two potential probiotic lactobacilli isolated from cocoa fermentation (Theobroma cacao L.) J. Funct. Foods. 2018;47:184–191. doi: 10.1016/j.jff.2018.05.055. [DOI] [Google Scholar]
  • 14.Tenea G.N., Jarrin-V P., Yepez L. Microbiota of Wild Fruits from the Amazon Region of Ecuador: Linking Diversity and Functional Potential of Lactic Acid Bacteria with their Origin [Online First]. IntechOpen. [(accessed on 20 January 2021)];2020 Available online: https://www.intechopen.com/online-first/microbiota-of-wild-fruits-from-the-amazon-region-of-ecuador-linking-diversity-and-functional-potenti.
  • 15.Flórez A.B., Mayo B. Genome Analysis of Lactobacillus plantarum LL441 and Genetic Characterisation of the Locus for the Lantibiotic Plantaricin C. Front. Microbiol. 2018;9:1916. doi: 10.3389/fmicb.2018.01916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tenea G.N., Delgado Pozo T.D. Antimicrobial peptides from Lactobacillus plantarum UTNGt2 prevent harmful bacteria growth on fresh tomatoes. J. Microbiol. Biotechnol. 2019;29:1553–1560. doi: 10.4014/jmb.1904.04063. [DOI] [PubMed] [Google Scholar]
  • 17.Pabari K., Pithva S., Kothari C., Purama R.K., Kondepudi K.K., Vyas B.R.M., Kothari R., Ambalam P. Evaluation of probiotic properties and prebiotic utilization potential of Weissella paramesenteroides isolated from fruits. Probiotics Antimicrob. Proteins. 2020;12:1126–1138. doi: 10.1007/s12602-019-09630-w. [DOI] [PubMed] [Google Scholar]
  • 18.Medrano S., Brito Grandes B. Obtención de Deshidratados de Borojo (Borojoa patinoi) y Copoazú (Theobroma grandiflorum) utilizando Procesos Térmicos de Secado con Aire Forzado. INIAP, Estación Experimental Santa Catalina, Departamento de Nutrición y Calidad; Quito, Ecuador: 2009. [(accessed on 6 March 2021)]. Available online: https://repositorio.iniap.gob.ec/handle/41000/974. [Google Scholar]
  • 19.Alviarez G.E., Murillo A.W., Murillo P.E., Rojano B.A., Méndez A.J.J. Caracterización y extracción lipídica de las semillas del cacao amazónico (Theobroma grandiflorum) [(accessed on 6 March 2021)];Cienc. en Desarro. 2016 7:103–109. doi: 10.19053/01217488.4237. Available online: http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0121-74882016000100013&lng=en&tlng=es. [DOI] [Google Scholar]
  • 20.Garzón K., Ortega C., Tenea G.N. Characterization of bacteriocin-producing lactic acid bacteria isolated from native fruits of Ecuadorian Amazon. Pol. J. Microbiol. 2017;66:473–481. doi: 10.5604/01.3001.0010.7037. [DOI] [PubMed] [Google Scholar]
  • 21.Tenea G.N. Peptide extracts from native lactic acid bacteria generate ghost cells and spheroplasts upon interaction with Salmonella enterica, as promising food antimicrobials. BioMed Res. Int. 2020;2020:6152356. doi: 10.1155/2020/6152356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.De Jong A., Van Hijum S.A.F.T., Bijlsma J.J.E., Kok J., Kuipers O.P. BAGEL: A web-based bacteriocin genome mining tool. Nucleic Acids Res. 2006;34:W273–W279. doi: 10.1093/nar/gkl237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Medema M.H., Blin K., Cimermancic P., De Jager V., Zakrzewski P., Fischbach M.A., Weber T., Takano E., Breitling R. antiSMASH: Rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 2011;39:W339–W346. doi: 10.1093/nar/gkr466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zheng J., Wittouck S., Salvetti E., Franz C.M.A.P., Harris H.M.B., Mattarelli P., O’Toole P.W., Pot B., Vandamme P., Walter J., et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020;70:2782–2858. doi: 10.1099/ijsem.0.004107. [DOI] [PubMed] [Google Scholar]
  • 25.Chun J., Oren A., Ventosa A., Christensen H., Arahal D.R., Da Costa M.S., Rooney A.P., Yi H., Xu X.-W., De Meyer S., et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. Int. J. Syst. Evol. Microbiol. 2018;68:461–466. doi: 10.1099/ijsem.0.002516. [DOI] [PubMed] [Google Scholar]
  • 26.EFSA Panel on Additives and Products or Substances used in Animal Feeds Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J. 2012;10:2740. doi: 10.2903/j.efsa.2012.2740. [DOI] [Google Scholar]
  • 27.Zhang Y., Zhang Q. Relationship between tetracycline antibiotic susceptibility and genotype in oral cavity Lactobacilli clinical isolates. Antimicrob. Resist. Infect. Control. 2019;8:1–8. doi: 10.1186/s13756-019-0483-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Huys G., D’Haene K., Swings J. Genetic basis of tetracycline and minocycline resistance in potentially probiotic Lactobacillus plantarum Strain CCUG 43738. Antimicrob. Agents Chemother. 2006;50:1550–1551. doi: 10.1128/AAC.50.4.1550-1551.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bennedsen M., Stuer-Lauridsen B., Danielsen M., Johansen E. Screening for antimicrobial resistance genes and virulence factors via genome sequencing. Appl. Environ. Microbiol. 2011;77:2785–2787. doi: 10.1128/AEM.02493-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Evanovich E., de Souza Mendonça Mattos P.J., Guerreiro J.F. Comparative genomic analysis of Lactobacillus plantarum: An Overview. Int. J. Genom. 2019;2019:1–11. doi: 10.1155/2019/4973214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Abriouel H., Pérez Montoro B.P., Casado Muñoz M.C., Knapp C.W., Gálvez A., Benomar N. In silico genomic insights into aspects of food safety and defense mechanisms of a potentially probiotic Lactobacillus pentosus MP-10 isolated from brines of naturally fermented Aloreña green table olives. PLoS ONE. 2017;12:e0176801. doi: 10.1371/journal.pone.0176801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mercanti D.J., Rousseau G.M., Capra M.L., Quiberoni A., Tremblay D.M., Labrie S.J., Moineau S. Genomic diversity of phages infecting probiotic strains of Lactobacillus paracasei. Appl. Environ. Microbiol. 2015;82:95–105. doi: 10.1128/AEM.02723-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Roberts A., Barrangou R. Applications of CRISPR-Cas systems in lactic acid bacteria. FEMS Microbiol. Rev. 2020;44:523–537. doi: 10.1093/femsre/fuaa016. [DOI] [PubMed] [Google Scholar]
  • 34.Barrangou R., Horvath P. A decade of discovery: CRISPR functions and applications. Nat. Microbiol. 2017;2:17092. doi: 10.1038/nmicrobiol.2017.92. [DOI] [PubMed] [Google Scholar]
  • 35.Nussenzweig P.M., McGinn J., Marraffini L.A. Cas9 cleavage of viral genomes primes the acquisition of new immunological memories. Cell Host Microbe. 2019;26:515–526.e6. doi: 10.1016/j.chom.2019.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hu C.-B., Malaphan W., Zendo T., Nakayama J., Sonomoto K. Enterocin X, a novel two-peptide bacteriocin from Enterococcus faecium KU-B5, has an antibacterial spectrum entirely different from those of its component peptides. Appl. Environ. Microbiol. 2010;76:4542–4545. doi: 10.1128/AEM.02264-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lederberg J. Bacterial protoplasts induced by penicillin. Proc. Natl. Acad. Sci. USA. 1956;42:574–577. doi: 10.1073/pnas.42.9.574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Peach K.C., Bray W.M., Winslow D., Linington P.F., Linington R.G. Mechanism of action-based classification of antibiotics using high-content bacterial image analysis. Mol. BioSyst. 2013;9:1837–1848. doi: 10.1039/c3mb70027e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Harris L.A., Saint-Vincent P.M.B., Guo X., Hudson G.A., DiCaprio A.J., Zhu L., Mitchell D.A. Reactivity-based screening for citrulline-containing natural products reveals a family of bacterial peptidyl arginine deiminases. ACS Chem. Biol. 2020;15:3167–3175. doi: 10.1021/acschembio.0c00685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Harwood C.R., Mouillon J.-M., Pohl S., Arnau J. Secondary metabolite production and the safety of industrially important members of the Bacillus subtilis group. FEMS Microbiol. Rev. 2018;42:721–738. doi: 10.1093/femsre/fuy028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen R., Wong H.L., Burns B.P. New approaches to detect biosynthetic gene clusters in the environment. Medicines. 2019;6:32. doi: 10.3390/medicines6010032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tenea G.N., Hurtado P., Ortega C. A novel Weissella cibaria strain UTNGt21O isolated from wild Solanum quitoense fruit: Genome sequence and characterization of a peptide with highly inhibitory potential toward gram-negative bacteria. Foods. 2020;9:1242. doi: 10.3390/foods9091242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Seppey M., Manni M., Zdobnov E.M. BUSCO: Assessing genome assembly and annotation completeness. Meth. Mol. Biol. 2019;1962:227–245. doi: 10.1007/978-1-4939-9173-0_14. [DOI] [PubMed] [Google Scholar]
  • 44.Wu L., Ma J. The Global Catalogue of Microorganisms (GCM) 10K type strain sequencing project: Providing services to taxonomists for standard genome sequencing and annotation. Int. J. Syst. Evol. Microbiol. 2019;69:895–898. doi: 10.1099/ijsem.0.003276. [DOI] [PubMed] [Google Scholar]
  • 45.Katoh K., Standley D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Stamatakis A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ondov B.D., Treangen T.J., Melsted P., Mallonee A.B., Bergman N.H., Koren S., Phillippy A.M. Mash: Fast genome and metagenome distance estimation using MinHash. Genome Biol. 2016;17:132. doi: 10.1186/s13059-016-0997-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Richter M., Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc. Natl. Acad. Sci. USA. 2009;106:19126–19131. doi: 10.1073/pnas.0906412106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Jain C., Rodriguez-R L.M., Phillippy A.M., Konstantinidis K.T., Aluru S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat. Commun. 2018;9:1–8. doi: 10.1038/s41467-018-07641-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Klasen J.R., Barbez E., Meier L., Meinshausen N., Bühlmann P., Koornneef M., Busch W., Schneeberger K. A multi-marker association method for genome-wide association studies without the need for population structure correction. Nat. Commun. 2016;7:13299. doi: 10.1038/ncomms13299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hyatt D., Chen G.-L., Locascio P.F., Land M.L., Larimer F.W., Hauser L.J. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinform. 2010;11:119. doi: 10.1186/1471-2105-11-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Seemann T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics. 2014;30:2068–2069. doi: 10.1093/bioinformatics/btu153. [DOI] [PubMed] [Google Scholar]
  • 53.Grant J.R., Stothard P. The CGView Server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008;36:W181–W184. doi: 10.1093/nar/gkn179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Jones P., Binns D., Chang H.-Y., Fraser M., Li W., McAnulla C., McWilliam H., Maslen J., Mitchell A., Nuka G., et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics. 2014;30:1236–1240. doi: 10.1093/bioinformatics/btu031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Huerta-Cepas J., Szklarczyk D., Heller D., Hernández-Plaza A., Forslund S.K., Cook H., Mende D.R., Letunic I., Rattei T., Jensen L.J., et al. eggNOG 5.0: A hierarchical, functionally and phylogenetically annotated orthology resource based on 5090 organisms and 2502 viruses. Nucleic Acids Res. 2019;47:D309–D314. doi: 10.1093/nar/gky1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Jia B., Raphenya A.R., Alcock B., Waglechner N., Guo P., Tsang K.K., Lago B.A., Dave B.M., Pereira S., Sharma A.N., et al. CARD 2017: Expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res. 2017;45:D566–D573. doi: 10.1093/nar/gkw1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Arndt D., Grant J.R., Marcu A., Sajed T., Pon A., Liang Y., Wishart D.S. PHASTER: A better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016;44:W16–W21. doi: 10.1093/nar/gkw387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Bortolaia V., Kaas R.S., Ruppe E., Roberts M.C., Schwarz S., Cattoir V., Philippon A., Allesoe R.L., Rebelo A.R., Florensa A.F., et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020;75:3491–3500. doi: 10.1093/jac/dkaa345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Liu B., Zheng D., Jin Q., Chen L., Yang J. VFDB 2019: A comparative pathogenomic platform with an interactive web interface. Nucleic Acids Res. 2019;47:D687–D692. doi: 10.1093/nar/gky1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Couvin D., Bernheim A., Toffano-Nioche C., Touchon M., Michalik J., Néron B., Rocha E.P.C., Vergnaud G., Gautheret D., Pourcel C. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018;46:W246–W251. doi: 10.1093/nar/gky425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Cosentino S., Voldby Larsen M., Møller Aarestrup F., Lund O. Correction: PathogenFinder—Distinguishing friend from foe using bacterial whole genome sequence data. PLoS ONE. 2013;8:e77302. doi: 10.1371/annotation/b84e1af7-c127-45c3-be22-76abd977600f. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Van Heel A.J., De Jong A., Montalbán-López M., Kok J., Kuipers O.P. BAGEL3: Automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic Acids Res. 2013;41:W448–W453. doi: 10.1093/nar/gkt391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Blin K., Shaw S., Steinke K., Villebro R., Ziemert N., Lee S.Y., Medema M.H., Weber T. antiSMASH 5.0: Updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 2019;47:W81–W87. doi: 10.1093/nar/gkz310. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Genome assembly data were deposited in the NCBI Database: BioProject PRIJNA705232 y BioSample SAMN18053630 on 26 February 2021.


Articles from Antibiotics are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES