Abstract
Background:
The WNT-pathway is involved in several cancers, including colorectal cancer (CRC). Many cell signaling components and pathways are controlled by microRNAs. The main purpose of the present study was to investigate the expression of hsa-miR-374, and its two target genes of the Wnt-pathway in CRC clinical samples.
Methods:
In this study, we predicted the miRNAs targeting key genes of WNT-pathway using bioinformatics algorithms. The expression levels of hsa-miR-374, APC and GSK-3β on 48 pairs of Formalin-Fixed Paraffin-Embedded (FFPE) CRC tumors and marginal-tumors were evaluated using real time-PCR. Additionally, the hsa-miR-374a-5p precursor sequence was amplified by whole-blood DNA as a template. This amplicon was cloned into pEGFP-c1 expression vector and transfected into SW742 cells. Aside from this, MTT assay was performed to evaluate the effect of miR-374 on cell viability.
Results:
The bioinformatics analysis indicated that hsa-miR-374 binds to the regulatory region the key components of WNT-pathway, including APC and GSK-3β considering the recognition elements and mirSVR scores. Our results revealed significant down-regulation of GSK-3β (0.94 times, p= 0.0098) and APC (0.96 times, p= 0.03) and up-regulation of miR-374 (1.22 times, p= 0.0071) on tumor samples compared with their normal pairs. Meanwhile, the results of the over-expression of miR-374 showed down-regulation of APC and GSK-3β. MTT-assay also indicated that the miR-374 increased cell survival.
Conclusion:
The results of our study indicated a concomitant change in the expression of miR-374 and its two related target genes, in clinical samples of CRC. Hsa-miR-374 might be as a helpful biomarker or therapeutic target in CRC.
Key Words: Colorectal cancer, GSK-3β, miR-374, WNT
Introduction
The genetic causes of colorectal cancer (CRC) are the occurrence of changes in several components in different signal transduction pathways, including P53, TGFB, JAK/STAT, PI3K/Akt, and Wnt pathways. These pathways are linked together in many cases. One of the important pathways associated with CRC cancer is the Wnt/β-catenin (1–6). Wnt ligands can trigger two pathways, cononical Wnt-pathway and non-cononical Wnt-pathway which are also referred to as β-catenin independent pathways (7). In cononical Wnt-pathway, following binding Wnt signal to the receptor, β-catenin (gene ID: 1499) is released, entered the nucleus and activated transcription factors (TFs) such as C-myc (gene ID: 4609) and cyclin D (gene ID: 595) etc. In the absence of the Wnt, β-catenin normally is destroyed by scaffolds of APC (gene ID: 324), GSK-3β (gene ID: 2932) and Axin2 (gene ID: 8313). The collapse of the genetic regulations caused by mutations in the cancer process leads to the survival of β-catenin and the expression of the proliferative genes (8), (9). Previous studies have investigated the deregulations of some components of the Wnt-signaling pathway in colon cancer samples (10–12). Recently, scientists have proposed the usage of molecular methods such as microarrays for analysis and identification of cancer molecular biomarkers. All components of signal transduction pathways are controlled by molecules called microRNAs (miRNAs) (13). The molecular network of carcinogenesis was determined by a systematic analysis between mRNAs and the expression of miRNAs. In some studies, based on their expression changes, classified tumors. miRNAs often interacted with their binding site in the 3'un-translated region (UTR) of target genes and affected their expression (14, 15). The purposeful study on miRNAs in cancer requires a candidate gene. The aim of our study was to determine the expression change in miRNAs that are selected by bioinformatics studies and its association with two components of the Wnt pathway in CRC samples.
Materials and Methods
Bioinformatics analysis
Bioinformatics analysis using different software including microRNA.org, miRwalk, DIANA-microT, Targetscan and NCBI, were employed to predict miRNAs that target 3'-UTR region of 7 key component of WNT-signaling pathway including APC, GSK-3β, β-catenin, Axin1, Hnf4a, TCF, CyclinD and C-myc. We selected miRNAs that simultaneously target several upstream and downstream compounds of APC and GSK-3β in the WNT pathway. Furthermore, the main components of other KEGG signaling pathways including MAPK, PI3K/AKT and ErbB pathways, which are involved in CRC, were determined using miRwalk software.
Ethics statement
The clinical sample collection procedure was approved by the ethics committee of Arak University of medical sciences (Ethics committee ID: IR.ARAKMU.REC.1397.51).
Preparation of FFPE tissue samples
In the present research, 48 pairs of formalin-fixed embedded (FFPE) tissue samples with ICD-O code 18 and 19 collected during the last 5 years, used from the archive of pathology departments of Khansarinejad hospital (Arak, Iran). Tumor and non-tumor samples obtained from the same CRC patients were confirmed using hematoxylin and eosin (H-E) staining.
RNA extraction, cDNA synthesis
In our study, 5-10 pieces cut from FFPE samples were trimmed and deparaffinized with xylol (Merck). In the following, digestion with proteinase-K (Cinnagen, Iran), extraction of RNA using a kit (RNX-Plus, Cinnagen, Iran) were performed as explained before (16). In the next step, extracted RNA (50 ng-1 µg) was used as a template for cDNA synthesis. The cDNA synthesis step was performed with 1 µl reverse transcriptase M-MuLV 100 Unit enzyme (Cinnagen, Iran), 3 µl RT Buffer 10 X, 2 µl random hexamer RH 10 µM, 0.75 µl stem loop (ST) primers 10 µM (Copenhagen, Denmark) and 3 µl dNTP 10 mM (Yekta Tajhiz Azma, Iran).
The qPCR reaction
The synthesized cDNAs were used as a template for quantitative-PCR on a light Cycler 96 real-time PCR machine (Roche, Germany) with SYBR green master-mix kit (Yekta Tajhiz Azma, Iran). In this reaction addition to GSK-3β, APC, and miR-374 was evaluated the expressions of GAPDH and SNORD47 (U47) RNAs for normalization. The sequences of primers showed in Table 1.
Table 1.
The primer sequences that used in present study.
| Primer ID | Sequence (5'-3') |
|---|---|
| ST-374 New | GTCGTATCGAGAGCAGGGTCCGAGGTATTCGCACTCGATACGACCACTTA |
| F-374 | TTATAATACAACCTGA |
| ST-U47 | GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCTCA |
| F-U47 | ATCACTGTAAAACCGTTCCA |
| F-GAPDH | GAAGGTGAAGGTCGGAGTC |
| R-GAPDH | GAAGATGGTGATGGGATTTC |
| R-universal | AGAGCAGGGTCCGAGGT |
| New F- APC | TTTGTCTTGGCGAGCAG |
| New R- APC | ATTTGCCTGTGGTCCTCA |
| GSK-3Β -F | GACTAAGGTCTTCCGACCCC |
| GSK-3Β -R | GCTTGAATCCGAGCATGAGG |
Plasmid construction for functional analysis of miR-374
The genomic DNA was extracted from human blood cells using PZP DNA extraction kit (Iran). In order to cloning pri-miR-374 in pEGFP-c1 vector, primers were designed using specific software (Table 2). The amplification reaction was carried out using these primers and PCR master-mix (Amplicon, Denmark) in a thermocycler (Eppendorf, Germany). The fragments were cloned in the vector using XhoI and SacII restriction enzymes (Fermentas, USA) and T4-ligase (Cinagene, Iran). Recombinant vectors were extracted by a plasmid extraction kit (Takara, Japan). In addition, a scramble fragment used as control. Verification of positive construct containing miR-374 precursor was performed by the sequencing method with an ABI Apply Biosystem 3730xl (Macrogen, South Korea).
Table 2.
The primer sequences for cloning pre-miR-374 in pEGFP-c1 vector. Under the restriction sites of the enzymes have been drawn lines.
| Primer ID | Sequence (5'-3') |
|---|---|
| F-CLONING-374 | AGATCTCGAGCCGAAAAGCATTTAACCT |
| R-CLONING-374 | TAACCGCGGGGCCTACTAATGTGCCAG |
Cell culture and Transfection
Human Epithelial-like Colon adenocarcinoma (colorectal), SW742, NCBI code: C146 (Pasteur institute, Iran) cell line was cultured in Dulbecco’s Modified Eagle Media (DMEM, Bioidea, Iran), supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin G sodium, and 100 μg/ml streptomycin sulfate (Bioidea, Iran) under a humidified condition at 37 °C with 5% CO2. The Calcium phosphate method was used for the transfection of constructs into cell lines.
MTT test
In order to the evaluation the cell survival after overexpression of miR-374 was performed the MTT assays, and crystal violate analysis. In 96-well plate containing SW742 cells, MTT test were performed with transfection of several amounts of recombinant plasmid containing miR-374 precursor, 1E+02, 1E+01, 1E+00, 1E-01, 1E-02, 1E-03, 1E-04, 1E-05, 1E-06, 1E-07 and 1E-08 ng. Plates were classified into 3 modes (SW-pre-miR374, Sw742 empty vector and SW742-Scramble fragment,). The wavelength at 630 nm read using a Bio-Tek Instrument ELISA reader (USA) after passing the incubation time.
Statistical analysis
Relative RT-qPCR data were calculated by using excel 2007, Graphpad prism 8.2.0 tools. The difference between groups was compared by unpaired t test and two-way ANOVA GraphPad prism 8.2.0 (435) software. The efficiencies of gene expression were calculated with the LightCycler96 Roche software. P values of less than 0.05 were considered as statistically significant.
Results
The results of bioinformatics analysis with specific software provided a list including 255 miRNAs related to 7 components of the WNT-signaling pathway that were chosen based on some criteria such as the miRNA recognition element (MRE sites) and mirSVR scores (Table 3).
Table 3.
Number of miRNAs that target 3'-UTR of components of the WNT-pathway.
| Row | Component of WNT pathway | Gene ID | Description | Number of miRNAs that target 3'-UTR |
|---|---|---|---|---|
| 1 | APC | 324 | APC regulator of WNT signaling pathway (Homo sapiens (human)) | 74 |
| 2 | CTNNB1 | 1499 | catenin beta 1 (Homo sapiens (human)) | 24 |
| 3 | GSK-3Β | 2932 | glycogen synthase kinase 3 beta (Homo sapiens (human)) | 53 |
| 4 | AXIN1 | 8312 | axin 1 (Homo sapiens (human)) | 11 |
| 5 | HNF4A | 3172 | hepatocyte nuclear factor 4 alpha (Homo sapiens (human)) | 25 |
| 6 | CCND1 | 595 | cyclin D1 (Homo sapiens (human)) | 49 |
| 7 | MYC | 4609 | MYC proto-oncogene, bHLH transcription factor (Homo sapiens (human)) | 19 |
Here, we selected hsa-miR-374, which simultaneously target several key components of WNT-pathway and other components of the main pathways involved in CRC (Table 4). Binding site one of MRE of hsa-miR-374 were in nucleotide 359-366 at 3'-UTR of APC (mirSVR score: -1.1305 and PhastCons score: 0.6718) and nucleotide 4525-4532 at 3'-UTR of GSK-3Β (mirSVR score: -0.8140 and PhastCons score: 0.5930). Table 5 shows the clinic-pathological data of 48 collected samples.
Table 4.
Targeting of main components of CRC pathways by Hsa-miR-374a
| The main components of WNT/βcatenin pathway of CRC | The main components of other KEGG pathways of CRC | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| miRNA | APC | CTNNB1 | GSK-3Β | AXIN1 | HNF4A | CCND1 | MYC | Akt1 | Akt3 | Erbb2 | Erbb3 | Foxo1 | Foxo3 | CDKN1B | TP53 | NFKB | Raf-1 |
| Hsa-miR-374a | * | * | * | * | * | * | * | * | * | * | * | * | * | * | |||
Table 5.
Characteristics of collected clinical samples.
| Characteristic | Detail | No. of patients | (%) of patients |
|---|---|---|---|
| Total number of patients | CRC | 48 | 100 |
| Gender | Male | 24 | 50 |
| Female | 24 | 50 | |
| Median age, range | ≤35 | 4 | 8.33 |
| 36-59 | 13 | 27.08 | |
| >59 | 31 | 64.58 | |
| T stage | 1 | 8 | 16.66 |
| 2 | 5 | 10.41 | |
| 3 | 23 | 47.91 | |
| 4 | 5 | 10.41 | |
| unknown | 7 | 14.58 | |
| N stage | 0 and 1 | 29 | 60.41 |
| 2 | 4 | 8.33 | |
| 3 or undefined | 15 | 31.25 | |
| Metastasis | Yes | 32 | 66.66 |
| No | 16 | 33.33 | |
| Type of cancer | Adenocarcinoma | 48 | 48 100 |
| Differentiation | poor | 1 | 2.08 |
| moderately | 13 | 27.08 | |
| well | 18 | 37.50 | |
| unknown | 16 | 33.33 | |
| Tumor site /configuration | colon | 32 | 66.66 |
| rectum | 7 | 14.58 | |
| sigmoid | 9 | 18.75 | |
| polypoid | 8 | 16.66 | |
| ulcerated | 11 | 22.91 | |
| Microscopic diagnosis | high N/C ratio | 37 | 77.083 |
| hyper chromatics nucleus | |||
| mitotic / malignant neoplasm/ atypical epithelial cells | |||
| other | 11 | 22.91 |
Evaluation of gene expression in CRC samples using RT-qPCR revealed the down-regulation of GSK-3β (0.94 times, p= 0.0098**, t= 2.635, df= 96.00) and APC (0.96 times, p= 0.03*, t= 2.088, df= 95.90) and up-regulation of miR-374 (1.22 times, p= 0.0071**, t= 2.802, df= 53.34) significantly in tumor samples of CRC samples in comparison to the non-tumor or marginal-tumor tissues (Unpaired t test with Welch's correction) (Fig. 1).
Fig. 1.
Evaluation of GSK-3β (A), APC (B) and hsa-miR-374 (C) expression levels in clinical samples of CRC by column and heat map graphs (t test data, p value< 0.05). The association between GSK-3β (A), APC (B) and hsa-miR-374 (C) expression levels in clinical samples of CRC and clinic-pathological features of three samples (305, 1827 and 819). Microscopic figures of H-E staining in one of tumor and non-tumor sample (100X) have been showed by arrows.
Also, comparison of the expression level of aforementioned genes with clinic-pathological features revealed that down-regulation of GSK-3β and APC is related to high-grade tumors (T3) and age of patients (age< 51). Also, up-regulation of miR-374 is related to poor differentiation and lower age of the patient (age> 35). In H-E staining of tumor tissue were observed high nucleus/ cytoplasm (N/C) ratio and infiltration of mononuclear cells compared with margins of tumor (Fig. 1). The results of the cloning process indicated the proper designing of the primers and the correct implementation of the PCR reaction (Fig. 2).
Fig. 2.
A, Schematics view of pEGFP-C1 plasmid, B, primer sequences for cloning of precursor miR-374 into pEGFP-C1. The restriction sites of XhoI and SacII enzymes have been shown at primer forward and reverse, respectively, C, Electrophoresis results of colony-PCR in positive recombinant colonies including pre miR-374, D, Sequencing results of amplicons.
The cloned fragment with the length of 290bp associated with miR precursor was transfected into colorectal cell line. The results of over-expression (transfection with a recombinant vector) showed changes in the expression of the studied genes (Fig. 3). SW742 transfected cells showed up-regulation of hsa-miR-374 (37.74 folds) and down-regulation of GSK-3β (0.68 folds) and APC (0.82 folds) than control cultures (Fig. 3).
Fig. 3.
The expression levels of two target genes down-regulated following hsa-miR-374 over-expression in SW742 cell lines compared to control groups (p: 0.026**).
The results of the MTT indicated that the cell survival by the transfection of the recombinant vector, containing the miR-374 sequence, was increased. These results indicate a direct relationship between the formation of violet crystals and the decrease of miR-374 levels (Fig. 4).
Fig. 4.
Result of MTT test in SW742 cells indicated miR-374 increased viability of cell. miR: transfected with recombinant pEGFP-C1 vector containing miR-374, Scramble: transfected with Scramble fragment, C1 empty: transfected with empty pEGFP-C1 (Two-way ANOVA).
Discussion
More than 100,000 people annually are estimated to have died from CRC and more than 150,000 were affected by CRC worldwide. According to the Center for Disease Control and Prevention Statistics, CRC is the leading cause of death after lung cancer. The occurrence rate of this disease is increasing so that the incidence has doubled over the past 20 years (17, 18).
The WNT-signaling pathway plays a role in key biological processes and controls the stages of development and tissue homeostasis. Changes in the components of this pathway lead to developmental disorders and various cancers. During metastasis, the expression changes of mesenchymal markers and tumor microenvironment (TME) in epithelial cancer cells, leading to the ability to attack adjacent tissues and create high-grade tumors (19). In general, the Wnt-signaling pathway has two cononical and non- cononical pathways. The cononical process leads to the accumulation of β-catenin. In the absence of Wnt, the cytoplasmic stability of β-catenin is usually disabled with a complex consisting of scaffolds including APC and GSK-3β (20). In the presence of Wnt, components of these scaffolds were dissociated, β-catenin was released, thereinafter entering the nucleus, were expressed the proliferative genes such as c-myc, c-jun and cyclineD1 (7). The defects in this pathway are associated with genetic mutations in cancer cells, including CRC, hepatocellular carcinoma and medulloblastoma. Previous studies revealed that APC containing mutation becomes unable to form a proper collection with GSK-3β and finally degradation of β-catenin (21). Aside from non-canonical Wnt pathways are classified into three other distinct pathways, Wnt/JNK, Wnt/Ca2+ and Wnt/planar cell polarity (PCP). The mechanisms of downstream signal transduction through these three pathways are poorly understood (19). Here, we could detect down-regulation of two components of scaffold surrounding β-catenin, including APC in tumor tissues of CRC in comparison with non-tumor or marginal tumor tissues. The product of APC is a tumor suppressor protein that acts as an antagonist of the Wnt-signal transduction pathway. Also, GSK-3 has two isoforms named GSK-3α and GSK-3β which expressed a serine/threonine kinase. GSK-3 has multifaceted roles in several signal transduction pathways in cancer and autophagy-related diseases. Phosphorylation of GSK-3 by AKT and other kinases leads to its inactivation and consequently increased glycogen and protein synthesis. In addition, GSK-3 interaction with axin and APC regulated canonical WNT-signaling pathway (21). We revealed that GSK-3β was downregulated in CRC tumor tissues and probably after that, β-catenin was released and activated the proliferated genes in the nucleus.
In recent years, researches have uncovered that change in expression of many miRNAs and their target genes in CRC. For example, in CRC, hsa-miR-143 specifically inhibits the phosphorylation of KRAS kinase. Valeri et al. in 2014 reported that the inhibition of miR-135b in mouse models of CRC reduced tumor growth by controlling germ cell proliferation, invasion and apoptosis (5). In their study showed that miR-30b was able to suppress rectal tumors through KRAG, PIK3CD and BCL2 oncogenes. miR-135b affects apoptosis via the APC/ Wnt/ β-catenin signaling pathway. The silencing of miR-135b reduced the colony formation in mutated cells with PI3KCA.
In this study, hsa-miR-374 was selected using target prediction tools according to the scoring system of the software, MRE and conservation (22), which simultaneously targets several key components of the Wnt-pathway. Several studies revealed that miR-374 family members have the regulatory role in various cancers, cell growth, differentiation, reproductive disorders and epilepsy (23). The chromosomal locations of members of MiR-374 family members in humans are at Xq13.2 the X-inactivation center region (Xic). MiR-374b was significantly up-regulated in hepatocellular carcinoma tissue (HCC) tissue and associated with grade and metastasis (24). In agreement with their findings, we revealed that miR-374 was up-regulated in tumor clinical samples compared with non-tumor tissues. There are different conventional methods and new approaches to detect miRNAs (25, 26). We could optimize the cost-effective qRT-PCR as an efficient and precise quantitative method. Liao et al. conducted a study in 2014 to examine the relationship between miRNAs and tumor suppression (9). miR-374a activates Wnt-pathway to promote metastasis of breast cancer (27). it seems there is a logically contradiction between the expression of the miR-374 and two related targets. These two targets, APC and GSK-3β, are two key components of the Wnt pathway.
It is possible that the down-regulation of these two genes may be due to the up-regulation of miR-374 in clinical CRC tumor than non-tumor tissues. In addition, our data showed the up-regulation of miR-374 and down-regulation of two its target genes have a correlation with a higher grade of the tumor. As shown in our data, the highest point (Fig. 1C) and lowest points of the scatter graph (Fig. 1A) are related to T3 grade of tumor blocks compared with marginal blocks of CRC FFPE tissues. Furthermore, down-regulation of APC and GSK-3β following precursor of miR-374 over-expression, indicated proper processing of the precursor molecules to mature miRNA in transfected cell lines and possibly targeting of APC and GSK-3β transcripts (Fig. 3). Although, several studies have been reported the expression alterations of different miRNAs related to CRC, but so far, the relationship between miR-374 and the key elements of the Wnt-pathway in CRC has not been studied. Aside from, with decreasing the recombinant vector containing pre-miR-374, decreases cell viability (Fig. 4). Taken together, possibly miR-374 conducted increasing in cell viability and proliferation. Therefore, the increase of the expression of this miRNA may be a reason to reduce the expression of these two genes in CRC tumor samples, and possibly the expression of this expression may be therapeutic application in CRC.
Bioinformatics analysis showed miR-374 is targeting the key components of the Wnt-pathway. Performing bioinformatics analysis before implementing laboratory processes is a simple and inexpensive method to reduce the number of targets of miRNAs. Given contradictory expression of miR-374 in tumor tissues relative to non-tumor samples, it might be considered as an onco-miR and a diagnostic biomarker in high-grade CRC.
Acknowledgements
We are thankful to the office of research and technology, the office of research of Khansari Hospital and Infectious Diseases Research Center of Arak University of Medical Sciences. Also we are thankful to Mr Mohajerani for assistance in sample collections.
References
- 1.Hurst DR, Edmonds MD, Welch DR. Metastamir: the field of metastasis-regulatory microRNA is spreading. . Cancer Res. . 2009;69(19):7495–8. doi: 10.1158/0008-5472.CAN-09-2111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ishiguro H, Kimura M, Takeyama H. Role of microRNAs in gastric cancer. . World J Gastroenterol. . 2014;20(19):5694–5699. doi: 10.3748/wjg.v20.i19.5694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. . nature. 2005;435(7043):834–8. doi: 10.1038/nature03702. [DOI] [PubMed] [Google Scholar]
- 4.Sung JJ, Chong WS, Jin H, Lam EK, Shin VY, Yu J, et al. 1070 Differential Expression of MicroRNAs in Plasma of Colorectal Cancer Patients: A Potential Marker for Colorectal Cancer Screening. Gastroenterology. 2009 ;136(5):A–165. doi: 10.1136/gut.2008.167817. [DOI] [PubMed] [Google Scholar]
- 5.Valeri N, Braconi C, Gasparini P, Murgia C, Lampis A, Paulus-Hock V, et al. MicroRNA-135b promotes cancer progression by acting as a downstream effector of oncogenic pathways in colon cancer. . Cancer cell. 2014;25(4):469–83. doi: 10.1016/j.ccr.2014.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yang Y, Peng W, Tang T, Xia L, Wang XD, Duan BF, et al. MicroRNAs as promising biomarkers for tumor-staging: evaluation of MiR21 MiR155 MiR29a and MiR92a in predicting tumor stage of rectal cancer. Asian Pac J Cancer Prev. . 2014;15(13):5175–80. doi: 10.7314/apjcp.2014.15.13.5175. [DOI] [PubMed] [Google Scholar]
- 7.Onyido EK, Sweeney E, Nateri AS. Wnt-signalling pathways and microRNAs network in carcinogenesis: experimental and bioinformatics approaches. Mol cancer. . 2016;15(1):56. doi: 10.1186/s12943-016-0541-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cai SD, Chen JS, Xi ZW, Zhang LJ, Niu ML, Gao ZY. MicroRNA 144 inhibits migration and proliferation in rectal cancer by downregulating ROCK 1. Mol med Rep. 2015;12(5):7396–7402. doi: 10.3892/mmr.2015.4391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liao WT, Ye YP, Zhang NJ, Li TT, Wang SY, Cui YM, et al. MicroRNA-30b functions as a tumour suppressor in human colorectal cancer by targeting KRAS, PIK3CD and BCL2. . J Pathol. . 2014;232(4):415–27. doi: 10.1002/path.4309. [DOI] [PubMed] [Google Scholar]
- 10.Wang HL, Hart J, Fan L, Mustafi R, Bissonnette M. Upregulation of glycogen synthase kinase 3β in human colorectal adenocarcinomas correlates with accumulation of CTNNB1. . Clinical colorectal cancer. . 2011;10(1):30–6. doi: 10.3816/CCC.2011.n.004. [DOI] [PubMed] [Google Scholar]
- 11.Olsen AK, Coskun M, Bzorek M, Kristensen MH, Danielsen ET, Jørgensen S, et al. Regulation of APC and AXIN2 expression by intestinal tumor suppressor CDX2 in colon cancer cells. . Carcinogenesis. . 2013;34(6):1361–9. doi: 10.1093/carcin/bgt037. [DOI] [PubMed] [Google Scholar]
- 12.Shakoori A, Ougolkov A, Yu ZW, Zhang B, Modarressi MH, Billadeau DD, et al. Deregulated GSK3β activity in colorectal cancer: its association with tumor cell survival and proliferation. . Biochemical and biophysical research communications. . 2005;334(4):1365–1373. doi: 10.1016/j.bbrc.2005.07.041. [DOI] [PubMed] [Google Scholar]
- 13.Jo P, Azizian A, Salendo J, Kramer F, Bernhardt M, Wolff HA, et al. Changes of microrna levels in plasma of patients with rectal cancer during chemoradiotherapy. . Int J Mol Sci. . 2017;18(6):1140. doi: 10.3390/ijms18061140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Betel D, Koppal A, Agius P, Sander C, Leslie C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome biology. . 2010;11(8):R90. doi: 10.1186/gb-2010-11-8-r90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Cai D, He K, Chang SE, Tong D, Huang C. MicroRNA-302b enhances the sensitivity of hepatocellular carcinoma cell lines to 5-FU via targeting Mcl-1 and DPYD. . Int J Mol Sci. 2015 ;16(10):23668–23682. doi: 10.3390/ijms161023668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nouraee N, Van Roosbroeck K, Vasei M, Semnani S, Samaei NM, Naghshvar F, et al. Expression, tissue distribution and function of miR-21 in esophageal squamous cell carcinoma. . PloS one. . 2013;8(9):e73009. doi: 10.1371/journal.pone.0073009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Rothschild S. microRNA therapies in cancer. Molecular and cellular therapies. . 2014;2:7. doi: 10.1186/2052-8426-2-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kent OA, Mendell JT. A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. . Oncogene. 2006;25(46):6188–96. doi: 10.1038/sj.onc.1209913. [DOI] [PubMed] [Google Scholar]
- 19.Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial–mesenchymal transition. . Nature reviews Molecular cell biology. . 2014;15(3):178–196. doi: 10.1038/nrm3758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kawahara K, Morishita T, Nakamura T, Hamada F, Toyoshima K, Akiyama T. Down-regulation of β-catenin by the colorectal tumor suppressor APC requires association with Axin and β-catenin. . J Biol Chem. 2000;275(12):8369–74. doi: 10.1074/jbc.275.12.8369. [DOI] [PubMed] [Google Scholar]
- 21.Mancinelli R, Carpino G, Petrungaro S, Mammola CL, Tomaipitinca L, Filippini A, et al. Multifaceted roles of GSK-3 in cancer and autophagy-related diseases. . Oxid Med Cell Longev. 2017;2017:4629495. doi: 10.1155/2017/4629495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Dweep H, Gretz N. miRWalk2. 0: a comprehensive atlas of microRNA-target interactions. Nature methods. . 2015;12(8):697. doi: 10.1038/nmeth.3485. [DOI] [PubMed] [Google Scholar]
- 23.Bian H, Zhou Y, Zhou D, Zhang Y, Shang D, Qi J. The latest progress on miR-374 and its functional implications in physiological and pathological processes. J Cell Mol Med. . 2019;23(5):3063–3076. doi: 10.1111/jcmm.14219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhao Q, Li T, Qi J, Liu J, Qin C. The miR-545/374a cluster encoded in the Ftx lncRNA is overexpressed in HBV-related hepatocellular carcinoma and promotes tumorigenesis and tumor progression. PloS one. . 2014;9(10):e109782. doi: 10.1371/journal.pone.0109782. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ye J, Xu M, Tian X, Cai S, Zeng S. Research advances in the detection of miRNA. . Journal of Pharmaceutical Analysis. . 2019;9(4):217–226. doi: 10.1016/j.jpha.2019.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Abutorabi ES, Irani S, Yaghmaie M, Ghaffari SH. Abemaciclib (CDK4/6 Inhibitor) Blockade Induces Cytotoxicity in Human Anaplastic Thyroid Carcinoma Cells. . Reports of Biochemistry & Molecular Biology. . 2020;8(4):438–445. [PMC free article] [PubMed] [Google Scholar]
- 27.Cai J, Guan H, Fang L, Yang Y, Zhu X, Yuan J, et al. MicroRNA-374a activates Wnt/β-catenin signaling to promote breast cancer metastasis. . J Clin Invest. . 2013;123(2):556–79. doi: 10.1172/JCI65871. [DOI] [PMC free article] [PubMed] [Google Scholar]