Skip to main content
. 2021 Apr 17;9(4):865. doi: 10.3390/microorganisms9040865

Figure 3.

Figure 3

Schematic representation of CRISPR-1 locus in S. Typhimurium. The direction of spacers and repeats is shown, 5’ → 3’, with respect to the leader region (orange rectangle). The palindromic repeats (CGGTTTATCCCCGCTGGCGCGGGGAACAC) are shown as black horizontal lines. A distinctly coloured diamond represents each spacer. Spacer sequences and length were commonly shared between the DT104b and DT104 S. Typhimurium genomes, only with spacer variation in the DT104b reference (DT104b ref.) strain that possesses nine unique (in respect to all other strains) spacers represented as numbers 10–18. Additionally, n = 15 spacers in the DT104b reference genome and n = 7 spacers in the genomes of DP_F10, DP_N16, DP_N28, JE_2727, JM_04.26, MC_04-0529, R13, TM75-404, and DT104 ref. are identical to the spacers within the LT2 CRISPR-1 array.