Parasites and RNA viruses in wild and laboratory reared bumble bees Bombus pauloensis (Hymenoptera: Apidae) from Uruguay

Sheena Salvarrey; Karina Antúnez; Daniela Arredondo; Santiago Plischuk; Pablo Revainera; Matías Maggi; Ciro Invernizzi

doi:10.1371/journal.pone.0249842

. 2021 Apr 26;16(4):e0249842. doi: 10.1371/journal.pone.0249842

Parasites and RNA viruses in wild and laboratory reared bumble bees Bombus pauloensis (Hymenoptera: Apidae) from Uruguay

Sheena Salvarrey ^1,^*, Karina Antúnez ², Daniela Arredondo ², Santiago Plischuk ³, Pablo Revainera ⁴, Matías Maggi ⁴, Ciro Invernizzi ¹

Editor: Guy Smagghe⁵

PMCID: PMC8075198 PMID: 33901226

Abstract

Bumble bees (Bombus spp.) are important pollinators insects involved in the maintenance of natural ecosystems and food production. Bombus pauloensis is a widely distributed species in South America, that recently began to be managed and commercialized in this region. The movement of colonies within or between countries may favor the dissemination of parasites and pathogens, putting into risk while populations of B. pauloensis and other native species. In this study, wild B. pauloensis queens and workers, and laboratory reared workers were screened for the presence of phoretic mites, internal parasites (microsporidia, protists, nematodes and parasitoids) and RNA viruses (Black queen cell virus (BQCV), Deformed wing virus (DWV), Acute paralysis virus (ABCV) and Sacbrood virus (SBV)). Bumble bee queens showed the highest number of mite species, and it was the only group where Conopidae and S. bombi were detected. In the case of microsporidia, a higher prevalence of N. ceranae was detected in field workers. Finally, the bumble bees presented the four RNA viruses studied for A. mellifera, in proportions similar to those previously reported in this species. Those results highlight the risks of spillover among the different species of pollinators.

Introduction

Wild and managed pollinators are essential for agricultural production, maintenance of biodiversity and the sustainability of natural ecosystems [1–3]. However, they are threatened by different factors including intensification of land use, intoxication with pesticides or infection by multiple pest and pathogens, among others [2]. In particular, wild bumble bees populations of the genus Bombus (Hymenoptera: Apidae), are in global decline [4,5]. Among the main threats for bumble bee health, different parasitic enemies stand out, some of them are specific to the genus Bombus, while others have a broad host spectrum [6,7]. The extended commerce and movement of managed bees, such as honey bees Apis mellifera L. and some bumble bees, has led to the spread of pathogens to new hosts, a phenomenon known as spillover [6,8–11].

The microsporidium Nosema ceranae Fries [recently Tokarev et al. [12] suggest to be reclassified as Vairimorpha ceranae)] is one of the most documented spillover examples. This parasite is found in honey bees [13], bumble bees [14–17], stingless bees [18,19], solitary bees (Euglossini) [20] and social wasps [18]. Another example of pathogen spillover occurs with RNA viruses of A. mellifera. Acute bee paralysis virus (ABPV), Black queen cell virus (BQCV), Deformed wing virus (DWV) and Sacbrood virus (SBV) [21,22] were described in honey bees but have also been found in bumble bees [10,23,24], stingless bees [25,26], carpenter bees [27] and other insects such as syrphids (Diptera) [28] and butterflies (Lepidoptera) [29]. Honey bees colonies acting as reservoirs, facilities the spread of pathogens and viruses to other pollinator species through the flowers they share [9,24,30].

Bombus pauloensis Friese (= Bombus atratus] is widely distributed throughout South America [31,32], and is utilized successfully in production of tomato (Solanum lycopersicum L.) and pepper (Capsicum annum L.) in greenhouses [33–35], as well as that of red clover (Trifolium pratense L.) seeds [36]. The colonies of B. pauloensis have been raised in captivity in small scale both in Colombia and Uruguay [36,37] and at commercial scale in Argentina, following a very extended breeding practice of some European and North American species [38,39].

Bombus pauloensis is distributed throughout the Uruguayan territory, and alongside Bombus bellicosus Smith, whose distribution is more reduced, are the only two Bombus species found in the country [40]. Previous studies reported the presence of internal and external parasites in queens, workers and males of both species, including the microsporidia N. ceranae [16,41] and Tubulinosema pampeana Plischuk et al., the nematode Sphaerularia bombi Dufour, one species of parasitoid diptera [41], and the external mites, Kuzinia spp. Zachvatkin, Pneumolaelaps longanalis Hunter and Husband, Pneumolaelaps longipilus Hunter, Scutacarus acarorum Goeze, and Tyrophagus putrescentiae Schrank [42].

In the southern region of South America (Argentina and Chile) the dispersion of the exotic species Bombus terrestris L. and Bombus ruderatus F., has put under threat native bumble bees species, as Bombus dahlbomii Guérin-Méneville, which is currently endangered [43–46]. These invasive species, introduced in Chile over the last few years, may have been acting as reservoirs of pathogens that jumped to native species causing significant damage [43,46,47]. Uruguay, as a neighbor country of Argentina, is also under risk of invasion by B. terrestris or B. ruderatus, or even by pathogens originally present on these species than now had spread to some South American native species [43–47].

From a sanitary point of view, the artificial breeding conditions (high density of individuals, impossibility of going out to defecate and forage, and limited food availability), can increase the survival and multiplication of different pathogens, facilitating the proliferation and transmission of diseases [8,48]. Thus, the aim of this study was to evaluate the presence of different parasites and pathogens on wild B. pauloensis queens and workers; and to evaluate if artificial breeding condition can increase infection by pathogens.

Materials and methods

Bumble bee collection

During the spring (September 2014), 73 queens of B. pauloensis were collected while foraging in the Faculty of Agronomy, University of the Republic, Montevideo (34° 50’ S, 56° 13’ W) after finishing their hibernation period. Among these, 19 queens were used for parasite analysis, 14 for viral analysis and 40 to start laboratory rearing according to Salvarrey et al. [36]. When the laboratory colonies reached 25 workers, a total of 92 were collected from 10 different colonies. Among these, 46 were used for parasite analysis and 46 for viral analysis.

When wild workers started to emerge in nature, in autumn (March 2015), 54 wild workers were collected in the same area as the queens, from which 37 were used for parasite analysis and 17 for virus analysis. The individuals used for parasite analysis were kept at -20°C, and those assigned to virus analysis were kept at -80°C.

Identification of mites and internal parasites

In order to detect phoretic mites, individual bumble bees were observed with a magnifying glass (40x). The mites were extracted, separated and observed with a light microscope (400X) for identification using taxonomic keys [49–52].

Prevalence (percentage of bumble bees harboring mites), abundance (number of mites per examined bumble bee), and intensity (number of mites per parasitized bumble bee) was determined for each mite species and in the three bumble bee groups (wild queens and workers, and laboratory reared workers).

Besides that, mite diversity per group was calculated using Simpson’s index. Results were expressed as low (0–0.3), moderate (0.3–0.6) and high (0.6–1) diversity, according to Revainera et al. [42].

For internal parasite identification, bumble bees were dissected under a stereoscopic microscope (10x – 40x). Firstly, the metasomal cavity was thoroughly observed looking for nematodes and diptera larvae, and trachea was scrutinized in search of mites [41]. Then, small samples of fat tissue, Malphigian tubules, midgut and posterior intestine were extracted and observed under compound bright field microscope (400x - 1000x) in order to detect microsporidia and protists (e.g. Kinetoplastidea, Neogregarinorida) [53]. Special attention was given to the fat tissue since the abnormal presence of granules in this tissue could be provoked by the presence of T. pampeana [54]. In the cases in which microsporidia was observed, the body of the infected insects was completely homogenized using 2 ml of distilled water and the number of microsporidia spores was quantified using a Neubauer chamber [55].

Detection of RNA viruses

Workers and queens samples were individually placed in 1.5 ml tubes and 500 μl or 1200 μl of PBS, respectively, were added. Individuals were disrupted and homogenized using a sterile glass rod. Total RNA was isolated from each individual bee using the PureLink® Viral RNA/DNA Mini Kit (Invitrogen™). Co-purified DNA was degraded usingDNase I, Amplification Grade (Invitrogen™), according to the manufacturer´s recommendations. Then the reverse transcription to cDNA was performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems^TM, EEUU), according to the manufacturer´s instructions. Viral detection was carried out by real time PCR using Power SYBR^R Green PCR Master Mix (Applied Biosystems, EEUU) and specific primers for reference and viral genes (Table 1). Reaction mixture consisted of 1X Master Mix, 0.5 μM of each primer, RNAse free water and 5 μl of 1:10 diluted cDNA in a final volume of 25 μl. Negative controls were included on each run. Serial dilutions of a mix of all the samples were used as a standard curve.

Table 1. Primers utilized for the quantification of viruses in the samples through qPCR.

Primer	Sequence 5’– 3’	Virus/Gen	Reference
ABPV1	`ACCGACAAAGGGTATGATGC`	ABPV	Johnson et al., 2009
ABPV2	`CTTGAGTTTGCGGTGTTCCT`	ABPV	Johnson et al., 2009
DWV_F	`CTGTATGTGGTGTGCCTGGT`	DWV	Kukielka et al., 2008
DWV_R	`TTCAAACAATCCGTGAATATAGTGT`	DWV	Kukielka et al., 2008
BQCV_F	`AAGGGTGTGGATTTCGTCAG`	BQCV	Kukielka et al., 2008
BQCV_R	`GGCGTACCGATAAAGATGGA`	BQCV	Kukielka et al., 2008
SBV_F	`GGGTCGAGTGGTACTGGAAA`	SBV	Johnson et al., 2009
SBV_R	`ACACAACACTCGTGGGTGAC`	SBV	Johnson et al., 2009
BACTIN1	`ATGCCAACACTGTCCTTTCTGG`	β-actina	Yang & Cox-Foster, 2005
BACTIN2	`GACCCACCAATCCATACGGA`	β-actina	Yang & Cox-Foster, 2005

Open in a new tab

Real time PCR reactions were carried out in a thermal Bio-Rad CFX96 Touch ^TM Real-Time System (Bio-Rad, USA). The cycling program consisted of an initial activation at 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds, 50°C for 30 seconds and 60°C for 30 seconds.

The specificity of the reaction was verified through the inclusion of a melting curve of the amplified products (from 65 to 95°C). The β-actin mRNA was amplified in each sample as a control of correct RNA manipulation and extraction.

Statistical analyses

The prevalence of the different pathogens and mites in the wild queens and workers and laboratory reared workers was compared using the Chi-square test. The intensity of the infection by microsporidia as well as the number of mites in the three groups of bumble bees were compared using the Kruskal Wallis and Mann-Whitney tests. P values under 0.05 were considered significant. Statistical analyses were performed using INFOSTAT (available at http://www. infostat. com. ar).

Results

Multiple parasites and pathogens were identified on bumble bees, including the mites T. putrescentiae, P. longanalis, P. longipilus, Kuzinia sp. and Parasitellus fucorum, the microsporidia N. ceranae and T. pampeana, a diptera of Conopidae family, the nematode S. bombi, and the RNA viruses BQCV, ABPV, SBV and DWV. Other common bumble bee parasites such as Apicytis sp. and Chritidia bombi were not found.

Phoretic mites

Fifty eight percent of the screened bumble bees were infected by at least one species of mite. The prevalence was higher in the queens (73.6%), followed by the laboratory workers (65.2%) and the wild workers (40.5%) (χ² = 7.52; p = 0.02; df = 2). The most frequently found mites were T. putrescentiae, which was detected mainly in queens and laboratory workers (H = 21.56; P< 0.0001) and Kuzinia sp. in the wild workers (H = 15.36; P< 0.0001) (Table 2).

Table 2. Prevalence (P), abundance (A) and intensity (I) of the observed mites on laboratory workers, wild workers and queens of B. pauloensis.

Bumble bee group		T. putrescentiae	P. longanalis	P. longipilus	Kuzinia spp.	P. fucorum
Laboratory workers (N = 46)	P	58.7	-	8.7	13.0	-
	A	4.0	-	0.0	0.2	-
	I	6.7	-	1.0	1.3	-
Wild workers (N = 37)	P	10.8	2.7	2.7	29.7	2.7
	A	0.2	0.1	0.0	3.6	0.0
	I	1.8	4.0	1.0	1.3	1.0
Queens (N = 19)	P	63.2	31.6	26.3	21.1	-
	A	26.5	2.7	0.3	0.3	-
	I	42.0	8.7	1.2	1.3	-
Total (N = 102)	P	42.2	6.9	9.8	20.6	1.0
	A	6.8	0.5	0.1	1.4	0.0
	I	16.1	8.0	1.1	7.0	1.0

Open in a new tab

The highest prevalence values are shown in black.

Queens were infested by the highest number of mite species (χ² = 12.89; p = 0.0016; df = 2) and 64.3% of them showed between two and four species of mites per individual. Co-infestation was less observed in wild workers or in laboratory workers (13.3% and 16.6%, respectively).

According to Simpsons’ diversity index over 90% of bumble bees of all groups had low diversity of mites (Fig 1). On the other hand, mean values of the index were 0.18 for the queens, 0.12 for the wild workers and 0.08 for the lab worker bees.

Internal pathogens

The microsporidia N. ceranae and T. pampeana were found in the three analyzed groups of bumble bees. Twenty six percent of the screened bumble bees were infected by N. ceranae. Its prevalence was higher in wild workers (45.9%) than in laboratory workers (13%) (χ² = 12.6; p = 0.0004; df = 1) and in queens (16.6%) (χ² = 5.78; p = 0.01; df = 1). The prevalence values of the last two groups were similar (χ² = 0.08; p = 0.77; df = 1). Regarding the intensity of the infections, similar values were found in the three groups (U = 1.58; p = 0.45). Queens showed 2.1 ± 2.9 x 10⁶ spores/bee, wild workers 2.4 ± 0.96 x 10⁵ spores/bee and the laboratory workers 3.4 ± 4.8 x 10⁵ spores/bee.

Almost fourteen percent of the bumble bees were infected with T. pampeana (21% of the queens, 8.1% of the wild workers, 15.2% of the laboratory workers). No significant differences were found in the prevalence per groups (χ² = 1.93; p = 0.38; df = 2). Regarding the intensity of the infections with this microsporidium, queens showed 6.4 ± 2.5 x 10⁵ spores/bee, wild workers 5.2 ± 8.0 x 10⁵ spores/bee and laboratory workers 2.4 ± 3.5 x 10⁵ spores/bee, with no differences between groups (U = 2.86; p = 0.23).

Three cases of coinfection (2.9%) with both types of microsporidia were found, two in wild workers and one in a queen.

Parasites

The nematode S. bombi was found in two of the 19 analyzed queens (10.5%), counting a total of seven gravid females (hypertrophied uteri) in one of them, and two in the other.

Parasitoids

Diptera larvae belonging to Conopidae family were found in six wild workers (16.2%, n = 37) and in two queens (10.5%, n = 19) (χ² = 7.69; p = 0.02; df = 2). No parasitoids were found in laboratory workers.

RNA viruses

In 83.8% of the analyzed bumble bees at least one RNA virus was detected. BQCV was the most prevalent virus (80.9% of the samples), while SBV, DWV and ABPV showed lower values (Fig 2). Regarding the detection of virus among the analyzed groups, differences were found for the DWV (χ² = 7.59; p = 0.02, df = 2) and for the SBV (χ² = 4.65; p = 0.09; df = 2), since those were more prevalent in wild workers and queens, respectively (Fig 2).

Fig 2 — The asterisk* indicates significate differences (P < 0.05) between the bumble bee groups for the Chi-square test.

Of the analyzed bumble bees 55.8% were only infected by one virus, mainly BQCV; while 27.9% showed co-infection with different viruses, including BQCV-ABPV (n = 9), BQCV-DWV (n = 4), BQCV-SBV (n = 3) and ABPV-SBV (n = 1). Triple infection was found in two samples, with only one case found in laboratory workers and in queens.

Discussion

Bumble bee colonies have an annual life cycle and only the queens survive the winter. This factor has shaped the behavior of parasites and pathogens to reproduce and spread beyond the period in which colonies disappear [56–58].

The effect of phoretic mites in bumble bee populations is unclear. Many groups feed on wax and pollen, while others consume small nematodes and fungi, which might be beneficial for bumble bees [59–61]. However, mites can act as vectors facilitating the introduction of fungi and pathogens. In this sense, Revainera et al. [62] found in individuals of both P. longanalis and P. fucorum obtained from bumble bees collected since 1940’s, the presence of Ascosphaera spp., N. ceranae, Nosema apis, and Nosema bombi, Crithidia bombi, Lotmaria passim (Euglonozoa; Trypanosomatidae), Apicystis bombi (Apicomplexa: Neogregarinorida), and A. mellifera filamentous virus (AmFV), highlighting the importance that these mites have in the transmission of diseases and raising doubts about the propagation routes of some parasites. Furthermore, in their phoretic stage mites can also affect the flight ability and therefore affect the foraging behavior of the individuals [63].

Out of the five mite species found in this study, four (T. putrescentiae, P. longanalis, P. longipilus, Kuzinia sp.) had already been reported to be associated to B. pauloensis in Uruguay [42]. In this case, besides the species mentioned, the presence of P. fucorum was noted in one wild bumble bee worker. On the other hand, S. acarorum was not found, maybe due to the reduced values of prevalence and intensity previously in the country [42].

The queens showed the highest number of mite species, which is reasonable since they are the only individuals in the colony that survive and make it through the winter with mites attached to their bodies [57,64,65]. Even so, Simpson’s Diversity Index showed low diversity values for the mites on the three bumble bees groups. In the case of queens, the low diversity values would respond to the high intensity of the infestation (dominance) of T. putrescentiae.

The laboratory workers and queens showed a high number of T. putrescentiae individuals, which is known for its cosmopolitan distribution and its preference for high fat and/or protein contain food [66]. The nest boxes used bumble bees breeding in captivity offer an unbeatable place for this mite proliferation since nests provide an abundant amount of pollen and wax, rich in protein and fat [67]. Additionally, the confinement increases the lack of hygiene, which makes it difficult to control the presence of this mite, situation that has been reported in the laboratory breeding of other insects [51].

The mites of the genus Kuzinia were associated to wild workers and queens. Those mites feed exclusively on pollen, so they can find their food both in and out of the bumble bee nest, which would explain their abundance in the individuals that were foraging in the fields and their scarcity in those bumble bees that were confined to a nest [68,69]. Their presence in queens is expected since these were collected after their hibernation, when the bumble bee cycle begins promoting dispersal of the mites. Kuzinia mites can also be found on other bee species, wasps, beetles and other groups of insects [70].

Three different species of Kuzinia sp. have been described in bumble bees based on morphology (body size, shape, and number of setae in the tarsiI-IV): K. affinis, K. laevis and K. Americana [52,70]. Despite this, it is difficult to identify these mites at the species level and their taxonomy is in revision.

The two species of Pneumolaelaps feed directly on pollen and wax from the nests, gathering near the larvae to receive the food. Even when feeding this way, mites are heavily associated to queens [67], which matches with the results showed in this study.

Meanwhile, P. fucorum, is a mite of great size that feeds on pollen and small arthropods present on the bumble bee nest [68]. In this study a single specimen was found, in accordance with recent studies in where a low prevalence or even absence of this mite was noted [42,59,61].

The microsporidia N. ceranae and T. pampeana were found in the three groups of bumble bees. In Uruguay both species had already been associated to B. pauloensis [16,41]. The natural host of N. ceranae is the Asian bee Apis cerana Fabricius [71]. However, it was found infecting many species of bumble bees around the world, which could impact negatively on their populations [14,30].

Nosema ceranae showed higher prevalence in wild workers (45.9%) than in lab workers or queens. This prevalence was different than previous studies in which a prevalence of 72% was reported in workers collected in 2010 [16] and 28.6% in 2012 [41].

No significant differences were observed in the spore counts between groups. These results do not match with those found by Plischuk et al. [41] in B. pauloensis from Uruguay, where workers were more infected than queens.

The differences in the prevalence and infection level found between different studies could be due regional differences and time of the year in which bumble bees were collected, as well as in the sampling effort. In honey bees, the prevalence of N. ceranae varies within the region and time of the year [72,73]. Even more, the pollen diversity available for honey bees also influence the infection level [74,75]. This issue has been barely studied in bumble bees. Rotheray et al. [76] found a negative relationship between N. ceranae infection level and the amount of food (pollen and sugar syrup) that was given to colonies of B. terrestris.

Tubulinosema pampeana was described associated to B. pauloensis in Argentina [54]. The prevalence of this parasite in queens, wild workers and laboratory workers was low, coinciding with previous results obtained in Argentina [54]. However, in previous study in Uruguay, Plischuk et al. [41] found T. pampeana in 36.2% of the sampled B. pauloensis queens and only in 1.8% of the workers, suggesting that time of the year may also influence the prevalence. Strikingly, both in Argentina and in Uruguay T. pampeana was only spotted in a few zones [41,54]. The impact that this new microsporidium can have at an individual or colony level is unknown. Plischuk et al. [54] found it infecting fat, neural and connective tissues, Malpighian tubules, muscle cells and digestive tract, so relevant effects are expected at individual level.

The nematode S. bombi is a parasite widely distributed throughout the world, that has been found in approximately 30 species of bumble bees [77]. In this study it was found at lower prevalence than in a previous study in the same Country [41]. This nematode has also been reported in the neighbouring Argentina [78]. Just like with microsporidia, the variations in the proportion of affected queens could be due to the site and time of the collection, and especially due to the conditions of hibernation. It can cause queen infertility and make them fly over the ground and for less time [58,77,79]. This nematode has a great incidence in the success of the laboratory breeding, since when present in a queen, it will not allow her to start a colony [78].

Diptera from Conopidae family are parasitoid with a wide distribution, which have been heavily associated to bumble bees. Its presence can trigger abnormal responses in bumble bees: they change their eating pattern, spend more time outside of the nest and exhibit a burial behavior during the last stages of parasitoidism [80,81]. In this study, larvae were found in wild workers (16.2%) and queens (10.5%). These prevalence values are superior to those found by Plischuk et al. (28%) [41], even though it has to be considered that in this study a lower sample size was used.

Different RNA viruses (BQCV, SBV, DWV y ABPV) were detected in Uruguayan bumble bees; over 80% of the specimens exhibited at least one of them. Those viruses are frequently found in honey bees around the world [82], including Uruguay [72,74,83]. Since they have been reported to be associated to other insects, they should be considered as multi-hosts pathogens [17,23,29].

Confinement conditions of the bumble bees during the artificial breeding did not influence the increase of the virosis, since wild workers showed higher prevalence of BQCV compared to laboratory reared workers. Wild workers may be more exposed to viral infections than laboratory workers, since in the field, bumble bees could exchange viruses with honey bees, for instance, through the flowers that both species visit. In this sense, recently Alger et al. [24] found a higher prevalence of DWV and BQCV in bumble bees compared to neighbour honey bees. Even more they detected a bee virus in 19% of the flowers. These result shows how virus spillover can occur between two species that share food sources. DWV is well known in honey bees, and its association with the ectoparasitic mite Varroa destructor Anderson and Trueman could cause important colony losses [84,85]. Different DWV variants have been reported in honey bees, but their presence in bumble bee species and their role in the populations needs to be addressed [85–87].

Final considerations

A priori it could be considered that the conditions of confinement of the bumble bees in artificial breeding colonies, together with the abundant food and the impossibility to fly would favor the proliferation of parasites and viruses. In this study this was observed in particular for mite species associated to stored foods (T. putrescentiae). However, wild workers showed a higher prevalence of N. ceranae, mites of the genus Kuzinia, BQCV and SBV, and higher diversity of mites, than laboratory workers. An explanation to this difference is that in the field bumble bees are in contact with parasites and viruses from honey bees or other pollinators, with the flowers acting as viral and pathogens hot spots [24]. Another factor that could explain the higher presence of parasites and viruses in the wild workers is that we collected forager bees, which can be of an older age than those bumble bees extracted from laboratory colonies. The bumble bee’s age was not contemplated in this study and could be relevant. For instance, in the case of honey bees the N. ceranae spore count is higher in foragers than in nurses [88].

Parasites and viruses found in laboratory workers can come from two sources: the queen or the pollen the larvae were fed with (corbicular pollen from honey bees). Bumble bee queens exhibited every parasite and virus searched in this study, with a high level of infection by N. ceranae (although of low prevalence) and a high diversity of mites. This is expected if we consider that queens are the only individuals that survive the decay of the colony and the parasites depend in good measure of them to last until the start of a new colony [57].

The results of this study complement those carried out by Arbulo et al. [16], Plischuk et al. [41] and Revainera et al. [42], improving the sanitary map of the native bumble bees of Uruguay. Besides that, this study evidence that native bumble bees share several pathogens and viruses with honey bees highlighting the role of domesticated animals, which may act as reservoirs favoring the spillover to other host [9,24,30].

Supporting information

S1 Table. Data of parasites and virus presence.

(PDF)

Click here for additional data file.^{(294.3KB, pdf)}

S2 Table. Data of mites’ diversity.

(PDF)

Click here for additional data file.^{(247.5KB, pdf)}

Acknowledgments

Authors thank the degree students Adrián Ortíz and Juan Vázquez for their collaboration in the maintenance tasks of the bumble bees in the laboratory and sample preparation stage. Authors also thank Natalia Arbulo and to anonymous reviewers for their constructing comments of the manuscript.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was funded by the Agencia Nacional de Investigación e Innovación (ANII) (register number: POSNAC_2014_1_102699) and Comisión Académica de Posgrado (CAP) of the Universidad de la República (Udelar) through PhD scholarship to S.S. Comisión Sectorial de investigación Científica (CSIC, Udelar) also provided support through a movility program.

References

1.Klein AM, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc B Biol Sci. 2007;274(1608):303–13. 10.1098/rspb.2006.3721 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Potts SG, Biesmeijer JC, Kremen C, Neumann P, Schweiger O, Kunin WE. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evol [Internet]. 2010;25(6):345–53. Available from: 10.1016/j.tree.2010.01.007 [DOI] [PubMed] [Google Scholar]
3.Chaplin-Kramer R, Sharp RP, Weil C, Bennett EM, Pascual U, Arkema KK, et al. Global modeling of nature’s contributions to people. Science (80-). 2019;366(6462):255–8. [DOI] [PubMed] [Google Scholar]
4.Williams PH, Osborne JL. Bumblebee vulnerability and conservation world-wide. Apidologie. 2009;40(3):367–87. [Google Scholar]
5.Cameron SA, Lozier JD, Strange JP, Koch JB, Cordes N, Solter LF. Patterns of widespread decline in North American bumble bees. 2011;108(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Daszak P, Cunningham AA, Hyatt AD, Daszak P, Cunningham AA, Hyatt AD. Emerging Infectious Diseases of Wildlife- Threats to Biodiversity and Human Health. 2000;287(5452):443–9. 10.1126/science.287.5452.443 [DOI] [PubMed] [Google Scholar]
7.Manley R, Boots M, Wilfert L. Emerging viral disease risk to pollinating insects: Ecological, evolutionary and anthropogenic factors. J Appl Ecol. 2015;52(2):331–40. 10.1111/1365-2664.12385 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Graystock P, Blane EJ, McFrederick QS, Goulson D, Hughes WOH. Do managed bees drive parasite spread and emergence in wild bees? Vol. 5, International Journal for Parasitology: Parasites and Wildlife. 2016. 10.1016/j.ijppaw.2015.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Graystock P, Goulson D, Hughes WOH. Parasites in bloom: Flowers aid dispersal and transmission of pollinator parasites within and between bee species. Proc R Soc B Biol Sci. 2015;282(1813). [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Evans E. From Humble Bee to Greenhouse Pollination Workhorse: Can We Mitigate Risks for Bumble Bees? Bee World [Internet]. 2017;94(2):34–41. Available from: https://www.tandfonline.com/doi/full/10.1080/0005772X.2017.1290892. [Google Scholar]
11.Hicks BJ, Pilgrim BL, Perry E, Marshall HD. Observations of native bumble bees inside of commercial colonies of Bombus impatiens (Hymenoptera: Apidae) and the potential for pathogen spillover. Can Entomol. 2018;150(4):520–31. [Google Scholar]
12.Tokarev YS, Huang WF, Solter LF, Malysh JM, Becnel JJ, Vossbrinck CR. A formal redefinition of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) and reassignment of species based on molecular phylogenetics. J Invertebr Pathol [Internet]. 2020;169(August 2019):107279. Available from: 10.1016/j.jip.2019.107279 [DOI] [PubMed] [Google Scholar]
13.Higes M, Martín R, Meana A. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J Invertebr Pathol. 2006;92(2):93–5. 10.1016/j.jip.2006.02.005 [DOI] [PubMed] [Google Scholar]
14.Graystock P, Yates K, Darvill B, Goulson D, Hughes WOH. Emerging dangers: Deadly effects of an emergent parasite in a new pollinator host. J Invertebr Pathol [Internet]. 2013;114(2):114–9. Available from: 10.1016/j.jip.2013.06.005 [DOI] [PubMed] [Google Scholar]
15.Plischuk S, Martín-Hernández R, Prieto L, Lucía M, Botías C, Meana A, et al. South American native bumblebees (Hymenoptera: Apidae) infected by Nosema ceranae (Microsporidia), an emerging pathogen of honeybees (Apis mellifera). Environ Microbiol Rep. 2009;1(2):131–5. 10.1111/j.1758-2229.2009.00018.x [DOI] [PubMed] [Google Scholar]
16.Arbulo N, Antúnez K, Salvarrey S, Santos E, Branchiccela B, Martín-Hernández R, et al. High prevalence and infection levels of Nosema ceranae in bumblebees Bombus atratus and Bombus bellicosus from Uruguay. J Invertebr Pathol [Internet]. 2015;130:165–8. Available from: 10.1016/j.jip.2015.07.018 [DOI] [PubMed] [Google Scholar]
17.Li J, Chen W, Wu J, Peng W, An J, Schmid-hempel P. Diversity of Nosema associated with bumblebees (Bombus spp.) from China q. Int J Parasitol [Internet]. 2012;42(1):49–61. Available from: 10.1016/j.ijpara.2011.10.005 [DOI] [PubMed] [Google Scholar]
18.Porrini MP, Porrini LP, Garrido PM, Melo C De, Porrini DP, Muller F, et al. Nosema ceranae in South American Native Stingless Bees and Social Wasp. 2017;2–5. [DOI] [PubMed] [Google Scholar]
19.Freitas BM, Imperatriz-fonseca VL, Medina LM, De A, Peixoto M, Galetto L, et al. Diversity, threats and conservation of native bees in the Neotropics To cite this version: HAL Id: hal-00892033 Review article Diversity, threats and conservation of native bees in the Neotropics *. 2009. [Google Scholar]
20.Nemésio A. Orchid bees (Hymenoptera, Apidae) of the Brazilian Atlantic Forest. Zootaxa. 2009;2041:1–242. [Google Scholar]
21.Chen YP, Siede R. Honey Bee Viruses. Adv Virus Res. 2007;70(07):33–80. 10.1016/S0065-3527(07)70002-7 [DOI] [PubMed] [Google Scholar]
22.Chen YP, Pettis JS, Corona M, Chen WP, Li CJ, Spivak M, et al. Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis and Implications for Honey Bee Health. PLoS Pathog. 2014;10(7). [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Gamboa V, Ravoet J, Brunain M, Smagghe G, Meeus I, Figueroa J, et al. Bee pathogens found in Bombus atratus from Colombia: A case study. J Invertebr Pathol [Internet]. 2015;129:36–9. Available from: 10.1016/j.jip.2015.05.013 [DOI] [PubMed] [Google Scholar]
24.Alger SA, Burnham PA, Boncristiani HF, Brody AK. RNA virus spillover from managed honeybees (Apis mellifera) to wild bumblebees (Bombus spp.). PLoS One [Internet]. 2019;14(6):e0217822. Available from: 10.1371/journal.pone.0217822 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Ueira-Vieira C, Almeida LO, de Almeida FC, Amaral IMR, Brandeburgo MAM, Bonetti AM. Scientific note on the first molecular detection of the acute bee paralysis virus in Brazilian stingless bees. Apidologie. 2015;46(5):628–30. [Google Scholar]
26.Alvarez LJ, Reynaldi FJ, Ramello PJ, Garcia MLG, Sguazza GH, Abrahamovich AH, et al. Detection of honey bee viruses in Argentinian stingless bees (Hymenoptera: Apidae). Insectes Soc [Internet]. 2018;65(1):191–7. Available from: 10.1007/s00040-017-0587-2. [DOI] [Google Scholar]
27.Lucia M, Reynaldi FJ, Sguazza GH, Abrahamovich AH. First detection of deformed wing virus in Xylocopa augusti larvae (Hymenoptera: Apidae) in Argentina. J Apic Res [Internet]. 2014;53(4):466–8. Available from: https://www.tandfonline.com/doi/full/10.3896/IBRA.1.53.4.11. [Google Scholar]
28.Bailes EJ, Deutsch KR, Bagi J, Rondissone L, Brown MJF, Lewis OT. First detection of bee viruses in hoverfly (syrphid) pollinators. Biol Lett. 2018;14(2):4–7. 10.1098/rsbl.2018.0001 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Levitt AL, Singh R, Cox-foster DL, Rajotte E, Hoover K, Ostiguy N, et al. Cross-species transmission of honey bee viruses in associated arthropods. Virus Res [Internet]. 2013;176(1–2):232–40. Available from: 10.1016/j.virusres.2013.06.013 [DOI] [PubMed] [Google Scholar]
30.Fürst MA, McMahon DP, Osborne JL, Paxton RJ, Brown MJF. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature. 2014;506(7488):364–6. 10.1038/nature12977 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Abrahamovich AH, Tellería MC, Díaz NB. Bombus species and their associated flora in Argentina. Bee World. 2001;82(2):76–87. [Google Scholar]
32.Abrahamovich AH, Diaz NB, Lucia M. Identificación de las “abejas sociales” del género Bombus (Hymenoptera, Apidae) presentes en la Argentina: clave pictórica, diagnosis, distribución geográfica y asociaciones florales. Rev la Fac Agron La Plata. 2007;106(2):165–76. [Google Scholar]
33.Aldana J, Cure JR, Almanza MT, Vecil D, Rodríguez D. Efecto de Bombus atratus (Hymenoptera: Apidae) sobre la productividad de tomate (Lycopersicon esculentum Mill.) bajo invernadero en la Sabana de Bogotá, Colombia. Agron Colomb. 2007;25(1):13–4. [Google Scholar]
34.Salvarrey S. Characteristics of the tomato fruit (Solanum lycopersicum) using native bumblebees (Bombus atratus) as pollinators in greenhouse Características del fruto de tomate (Solanum lycopersicum) utilizando abejorros nativos (Bombus atratus) como poliniza.
35.Riaño J. D, Pacateque E. J, Cure JR, Rodríguez D. Comportamiento y eficiencia de polinización de Bombus atratus Franklin en pimentón (Capsicum annum L.) sembrado bajo invernadero. Rev Colomb Ciencias Hortícolas [Internet]. 2015;9(2):259–67. Available from: http://revistas.uptc.edu.co/revistas/index.php/ciencias_horticolas/article/view/4182. [Google Scholar]
36.Salvarrey S, Arbulo N, Santos E, Invernizzi C. Cría artificial de abejorros nativos Bombus atratus y Bombus bellicosus (Hymenoptera, Apidae). Agrociencia Uruguay. 2013;17(2):75–82. [Google Scholar]
37.Cruz P, Escobar A, Almanza MT, Cure JR. Implementación de mejoras para la cría en cautiverio de colonias del abejorro nativo Bombus pauloensis (= B. atratus) (Hymenoptera: Apoidea). Rev Fac Ciencias Básicas. 2017;4(1):70–83. [Google Scholar]
38.Velthuis HHW. The historical background of the domestication of the bumble-bee, Bombus terrestris, and its introduction in agriculture. Pollinat Bees—Conserv Link Between Agric Nat. 2002;177–84. [Google Scholar]
39.Velthuis HHW, Van Doorn A. A century of advances in bumblebee domestication and the economic and environmental aspects of its commercialization for pollination. Apidologie. 2006;37(4):421–51. [Google Scholar]
40.Santos E, Arbulo N, Salvarrey S, Invernizzi C. Distribución de las especies del género Bombus Latreille (Hymenoptera, Apidae) en Uruguay. Rev la Soc Entomológica Argentina [Internet]. 2017;76(1–2):22–7. Available from: 10.25085/rsea.761203. [DOI] [Google Scholar]
41.Plischuk S, Salvarrey S, Arbulo N, Santos E, Skevington JH, Kelso S, et al. Pathogens, parasites, and parasitoids associated with bumble bees (Bombus spp.) from Uruguay. Apidologie. 2017;48(3):298–310. [Google Scholar]
42.Revainera PD, Salvarrey S, Santos E, Arbulo N, Invernizzi C, Plischuk S, et al. Phoretic mites associated to Bombus pauloensis and Bombus bellicosus (Hymenoptera: Apidae) from Uruguay. J Apic Res [Internet]. 2019;58(3):455–62. Available from: 10.1080/00218839.2018.1521775. [DOI] [Google Scholar]
43.Arbetman MP, Meeus I, Morales CL, Aizen MA. Alien parasite hitchhikes to Patagonia on invasive bumblebee. Biol Invasions. 2013;(March). [Google Scholar]
44.Morales CL, Arbetman MP, Cameron SA, Aizen MA, Morales CL, Arbetman MP, et al. Rapid ecological replacement of a native bumble bee by invasive species. Front Ecol Environ. 2013; 10.1890/120157 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Aizen MA, Smith-Ramírez C, Morales CL, Vieli L, Sáez A, Barahona-Segovia RM, et al. Coordinated species importation policies are needed to reduce serious invasions globally: The case of alien bumblebees in South America. J Appl Ecol [Internet]. 2018;(March). Available from: http://doi.wiley.com/10.1111/1365-2664.13121. [Google Scholar]
46.Schmid-Hempel R, Eckhardt M, Goulson D, Heinzmann D, Lange C, Plischuk S, et al. The invasion of southern South America by imported bumblebees and associated parasites. J Anim Ecol. 2014;83(4):823–37. 10.1111/1365-2656.12185 [DOI] [PubMed] [Google Scholar]
47.Arismendi N, Riveros G, Zapata N, Smagghe G, Gonzalez C, Vargas M. Occurrence of bee viruses and pathogens associated with emerging infectious diseases in native and non-native bumble bees in southern Chile. Biol Invasions [Internet]. 2021;15. Available from: 10.1007/s10530-020-02428-w. [DOI] [Google Scholar]
48.Murray TE, Coffey MF, Kehoe E, Horgan F. Pathogen prevalence in commercially reared bumble bees and evidence of spillover in conspecific populations. Biol Conserv. 2013;159(January):269–76. 10.1016/j.biocon.2012.10.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Hunter PE. The genus Pneumolaelaps with description of three new species (Acarina: Laelaptidae). J Kansas Entomol Soc. 1966;39:357–69. [Google Scholar]
50.Hunter PE, Husband RW. Pneumolaelaps (Acarina: Laelapidae) mites from North America and Greenland. Florida Entomol. 1973;59:77–91. [Google Scholar]
51.Krantz GW, Walter DE. A manual of acarology. 2009. [Google Scholar]
52.Putatunda BN, Aggarwal K, Kapil RP. Two new species of Kuzinia (Acarina: Acaridae) associated with bees (Hymenoptera) from India. Indian J Acarol. 1983;8(2):57–62. [Google Scholar]
53.Solter LF, Becnel JJ, Oi DH. Microsporidian entomopathogens. San Diego. In: F. E. Vega & H. K. Kaya (eds.), editor. In Insect Pathology and Microbial Pest Control. Second Edi. San Diego; 2012.
54.Plischuk S, Sanscrainte ND, Becnel JJ, Estep AS, Lange CE. a pathogen of the South American bumble bee Bombus atratus. J Invertebr Pathol [Internet]. 2015;126:31–42. Available from: 10.1016/j.jip.2015.01.006 [DOI] [PubMed] [Google Scholar]
55.Undeen HH, Vávra J. Research methods for entomopathogenic protozoa. In: Lacey L, editor. Manual of techniques in insect pathology. New York; 1997. p. 117–51.
56.Binns ES. Phoresy as migration-some functional aspects of phoresy in mites. Biol Rev [Internet]. 1982;57(4):571–620. Available from: 10.1111/j.1469-185X.1982.tb00374. [DOI] [Google Scholar]
57.Huck K, Schwarz HH, Schmid-Hempel P. Host choice in the phoretic mite Parasitellus fucorum (Mesostigmata: Parasitidae): Which bumblebee caste is the best? Oecologia. 1998;115(3):385–90. 10.1007/s004420050532 [DOI] [PubMed] [Google Scholar]
58.Goulson D. Bumblebees: behaviour, ecology and conservation. Second Edi. Goulson D, editor. New York; 2010. 317 p.
59.Maggi MD, Lucia M, Abrahamovich AH. Study of the acarofauna of native bumblebee species (Bombus) from Argentina. Apidologie. 2011;42:280–92. [Google Scholar]
60.Rozej E, Witaliński W, Szentgyörgyi H, Wantuch M, Moroń D, Woyciechowski M. Mite species inhabiting commercial bumblebee (Bombus terrestris) nests in Polish greenhouses. Exp Appl Acarol. 2012;56(3):271–82. 10.1007/s10493-012-9510-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Revainera P, Lucia M, Abrahamovich AH, Maggi M. Spatial aggregation of phoretic mites on Bombus atratus and Bombus opifex (Hymenoptera: Apidae) in Argentina. Apidologie. 2014;45(5):579–89. [Google Scholar]
62.Revainera PD, Quintana S, Fernández de Landa G, Meroi Arcerito F, Lucía M, Abrahamovich AH, et al. Phoretic mites on South American bumblebees (Bombus spp.) as parasite carriers: a historical input. Apidologie. 2020. [Google Scholar]
63.Hubert J, Stejskal V, Kubátová A, Munzbergová Z, Váňová M, Žd’árková E. Mites as Selective Fungal Carriers in Stored Grain Habitats. Exp Appl Acarol [Internet]. 2003;29:69–87. Available from: 10.1023/a:1024271107703 [DOI] [PubMed] [Google Scholar]
64.Schmid-Hempel P, Schmid-Hempel R. Endoparasitic flies, pollen-collection by bumblebees and potential host parasite conflict. Oecologia. 1991;87:222–32. 10.1007/BF00325260 [DOI] [PubMed] [Google Scholar]
65.Schwarz HH, Huck K. Phoretic mites use flowers to transfer between foraging bumblebees. Insectes Soc. 1997;44(4):303–10. [Google Scholar]
66.Koulianos S, Schwarz H. Reproduction, development and diet of Parasitellus fucorum (Mesostigmata: Parasitidae), a mite associated with bumblebees (Hymenoptera: Apidae). J Zool. 1999;248(2):267–9. [Google Scholar]
67.Royce L, Krantz GW. Observations on pollen processing by Pneumolaelaps longanalis (Acari: Laelapidae), a mite associate of bumblebees. Exp Appl Acarol. 1989;7(2):161–5. [Google Scholar]
68.Goulson D. Impacts of non-native bumblebees in Western Europe and North America. Appl Entomol Zool. 2010;45(1):7–12. [Google Scholar]
69.Kissinger CN, Cameron SA, Thorp RW, White B, Solter LF. Survey of bumble bee (Bombus) pathogens and parasites in Illinois and selected areas of northern California and southern Oregon. J Invertebr Pathol [Internet]. 2011;107(3):220–4. Available from: 10.1016/j.jip.2011.04.008 [DOI] [PubMed] [Google Scholar]
70.Delfinado M., Baker E. Notes on Hypopi (Acarina) Associated with Bees and Wasps (Hymenoptera). J New York Entomol Soc [Internet]. 1976;84(2):76–90. Available from: https://www.jstor.org/stable/25008994. [Google Scholar]
71.Fries I. Nosema ceranae in European honey bees (Apis mellifera). J Invertebr Pathol [Internet]. 2010;103(SUPPL. 1):S73–9. Available from: 10.1016/j.jip.2009.06.017. [DOI] [PubMed] [Google Scholar]
72.Anido M, Branchiccela B, Castelli L, Harriet J, Campá J, Zunino P, et al. Prevalence and distribution of honeybee pathogens in Uruguay. J Apic Res. 2015;54(5):532–40. [Google Scholar]
73.Antúnez K, Anido M, Branchiccela B, Harriet J, Campa J, Invernizzi C, et al. Seasonal Variation of Honeybee Pathogens and its Association with Pollen Diversity in Uruguay. Microb Ecol. 2015;70(2):522–33. 10.1007/s00248-015-0594-7 [DOI] [PubMed] [Google Scholar]
74.Branchiccela B, Castelli L, Corona M, Díaz-Cetti S, Invernizzi C, Martínez de la Escalera G, et al. Impact of nutritional stress on the honeybee colony health. Sci Rep. 2019;9(1):1–11. 10.1038/s41598-018-37186-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Invernizzi C, Santos E, García E, Daners G, Di Landro R, Saadoun A, et al. Sanitary and nutritional characterization of honeybee colonies in Eucalyptus grandis plantations. Arch Zootec. 2011;60(232):1303–14. [Google Scholar]
76.Rotheray EL, Osborne JL, Goulson D. Quantifying the food requirements and effects of food stress on bumble bee colony development. J Apic Res [Internet]. 2017;56(3):288–99. Available from: 10.1080/00218839.2017.1307712. [DOI] [Google Scholar]
77.Poinar GO, Van der Laan PA. Morphology and life history of Sphaerularia bombi.pdf. Nematologica. 1972;18:239–52. [Google Scholar]
78.Plischuk S, Lange CE. Sphaerularia bombi (Nematoda: Sphaerulariidae) parasitizing Bombus atratus (Hymenoptera: Apidae) in southern South America. Parasitol Res. 2012;111(2):947–50. 10.1007/s00436-012-2853-6 [DOI] [PubMed] [Google Scholar]
79.Jones CM, Brown MJF. Parasites and genetic diversity in an invasive bumblebee. J Anim Ecol. 2014;83(6):1428–40. 10.1111/1365-2656.12235 [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Müller CB, Schmid-Hempel P. Exploitation of cold temperature as defence against parasitoids in bumblebees. Nature [Internet]. 1993;363:65–6. Available from: 10.1038/363065a0. [DOI] [Google Scholar]
81.Müller CB. Parasitoid induced digging behaviour in bumblebee workers. Anim Behav. 1994;48(4):961–6. [Google Scholar]
82.Beaurepaire A, Piot N, Doublet V, Antunez K. Diversity and Global Distribution of Viruses of the Western Honey Bee. 2020;1–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Antúnez K, D’Alessandro B, Corbella E, Ramallo G, Zunino P. Honeybee viruses in Uruguay. J Invertebr Pathol [Internet]. 2006. September;93(1):67–70. Available from: https://linkinghub.elsevier.com/retrieve/pii/S002220110600108X. 10.1016/j.jip.2006.05.009 [DOI] [PubMed] [Google Scholar]
84.de Miranda JR, Genersch E. Deformed wing virus. J Invertebr Pathol [Internet]. 2010;103(SUPPL. 1):S48–61. Available from: 10.1016/j.jip.2009.06.012 [DOI] [PubMed] [Google Scholar]
85.Martin SJ, Highfield AC, Brettell L, Villalobos EM, Budge GE, Powell M, et al. Global Honey Bee Viral Landscape Altered by a Parasitic Mite. Science (80-). 2012;336:1304–6. 10.1126/science.1220941 [DOI] [PubMed] [Google Scholar]
86.Dalmon A, Desbiez C, Coulon M, Thomasson M, Le Conte Y, Alaux C, et al. Evidence for positive selection and recombination hotspots in Deformed wing virus (DWV). Sci Rep [Internet]. 2017;7(January):1–12. Available from: 10.1038/srep41045 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Natsopoulou ME, McMahon DP, Doublet V, Frey E, Rosenkranz P, Paxton RJ. The virulent, emerging genotype B of Deformed wing virus is closely linked to overwinter honeybee worker loss. Sci Rep. 2017;7(1):1–9. 10.1038/s41598-016-0028-x [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Higes M, García-Palencia P, Botías C, Meana A, Martín-Hernández R. The differential development of microsporidia infecting worker honey bee (Apis mellifera) at increasing incubation temperature. Environ Microbiol Rep. 2010;2(6):745–8. 10.1111/j.1758-2229.2010.00170.x [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0249842.r001

Decision Letter 0

Guy Smagghe

15 Jan 2021

PONE-D-20-36603

Parasites and RNA viruses in wild and laboratory reared bumblebees Bombus pauloensis (Hymenoptera: Apidae) from Uruguay

PLOS ONE

Dear Dr. Salvarrey,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Guy Smagghe, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Given the topic and type of this paper, the data and analyses done are sufficient, but overall I miss objectives which make this paper relevant and worthwhile.

I decided to put 'minor revisions' because the objectives, although they are very minimal, are achieved. But i do strongly suggest to read my comments and answer some questions, and I hope that they will be helpful.

The heterogeneity of the types of pathogens screened for is good, but I do miss some additional analysis.

For example, the choice of only microscopic screening of internal pathogens does not make the methods very sensitive. Only two microsporidian species were chosen to screen for. Why the choice of these parasites? Why not other internal parasites like Crithidia sp. or Apicystis sp.? This might give a lot more interpretable data, and might give enough parasite diversity data to actually state some objectives and get some more information regarding parasites in bumblebees, rather than only report the findings. I also wonder how did you distinguish between Nosema species? How did you see a difference between N. ceranae and N. bombi without molecular confirmation?

For me the sampling set up is not very clear: why take queens from wild and rear them, and then compare them with workers from the wild but from another year? What was the original motive to do this,

[199] having a similar prevalence between queens and laboratory workers is not so strange, since they don’t come into contact anymore with the environment, the lab workers can only get parasites from the queens; the queens already infested will transmit their parasites, while the queens not infested cannot transmit parasites, so the prevalence will stay similar.

What would be a relevant analysis, is to compare the parasite diversity between the queens and the lab workers; are there any parasites that are not present (or way less) in the lab workers but were omnipresent in the queens? For example from your data, there doesn’t seem to be a bottle neck for Nosema ceranae, but a small bottleneck for T. pampeana. Even better would be to also analyse the parasites of the queens used for rearing, if they were kept frozen after the experiment.

[255] You mention mites being a possible vector, but you don’t analyse this in your data; for this you don’t necessarily have to screen the mites themselves, but you could model a relation between presence of certain mite species and prevalence/abundance/load of viruses and pathogens.

Some smaller comments:

The general structure is not good yet. Some examples:

55 strange sentence ‘another example of pathogen spillover are RNA viruses’. Then you explain how viruses found in honeybees are also found in other bee species, but you don’t provide any context about why these viruses are considered to be a spillover risk.

45 ‘among others’ fits better than ‘between others’. Also, maybe it is good to mention multiplicative effects, like pesticide intoxication that increases pathogen susceptibility.

85-87 I do not understand this sentence. This sentence seems to state that B. terrestris and .B ruderatus is present in Uruguay, while on line 72 you say there are only B. pauloensis and B. bellicosus. Also the second part of the sentence on 86 does not make sense.

94 you mention 33 queens, and then explain how many are used for different analysis; then you mention 40 (of these 33??) were used to start laboratory rearing. I don’t think that is physically possible… Also were the queens collected from a lab experiment or were they actually caught during foraging from the wild? This is not explained clearly.

There are still a lot of grammar and spelling mistakes in the text. Some examples:

84 ‘significant’ damage

107 grammatical mistake

287-289 strange sentence

327 spotted

392 strange sentence

397 strange sentence and weird conclusion?

Reviewer #2: The authors did not make all data available. There were not Supporting Information or Supplementary Material.

The English language is ok. However, there were shown typographical/grammatical errors (minimum). I am not English language specialist; therefore, I can not question the writing of the manuscript.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Tina Tuerlings

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Comments to editor Plos One 13 ene 2021.docx

Click here for additional data file.^{(12.1KB, docx)}

Attachment

Submitted filename: PONE-D-20-36603_reviewer Parasites and RNA viruses in wild and laboratory reared bumblebees Bombus.pdf

Click here for additional data file.^{(1MB, pdf)}

PLoS One. 2021 Apr 26;16(4):e0249842. doi: 10.1371/journal.pone.0249842.r002

Author response to Decision Letter 0

1 Mar 2021

Response to reviewers

Reviewer #1:

The heterogeneity of the types of pathogens screened for is good, but I do miss some additional analysis. For example, the choice of only microscopic screening of internal pathogens does not make the methods very sensitive. Only two microsporidian species were chosen to screen for. Why the choice of these parasites? Why not other internal parasites like Crithidia sp. or Apicystis sp.? This might give a lot more interpretable data, and might give enough parasite diversity data to actually state some objectives and get some more information regarding parasites in bumblebees, rather than only report the findings.

R: We used the microscopical screening to search for the presence of several parasites that can be identified with this method (e.g. Kinetoplastidea, Neogregarinorida and Microsporidia). The presence of Crithidia sp. and Apycistis sp. was also evaluated but those parasites were not found. This information was included in the new version of the manuscript.

… I also wonder how did you distinguish between Nosema species? How did you see a difference between N. ceranae and N. bombi without molecular confirmation?

R: We are convinced that the spores were N. ceranae since I) previous studies carried out by molecular methods have never found N. bombi in Bombus spp. in Uruguay. Closest reports were 1,400 km far from the country (e.g.: Plischuk, 2013; Schmid-Hempel et al., 2014; Arbulo et al. 2015; Plischuk & Lange, 2016; Plischuk et al., 2017a, b), and II) careful dissections of all bees showed that spores were always infecting the gut (target tissue of N. ceranae) and they never were found into Malpighian tubules (target tissue of N. bombi).

For me the sampling set up is not very clear: why take queens from wild and rear them, and then compare them with workers from the wild but from another year? What was the original motive to do this?

R: We collected queens from the wild in spring 2014 (September in south hemisphere) and some of them were used for the parasites and viral analysis and others for the rearing in laboratory. Wild workers were collected in autumn (March 2015) since it is the only time of the year when they are found in great numbers in the wild, in accordance with their biological cycle. It is not possible to find many wild workers in spring. Spring 2014 and autumn 2015 belong to the same “biological year” for this species. We compared the workers reared in the lab with the workers and queens collected in the wild.

having a similar prevalence between queens and laboratory workers is not so strange, since they don’t come into contact anymore with the environment, the lab workers can only get parasites from the queens; the queens already infested will transmit their parasites, while the queens not infested cannot transmit parasites, so the prevalence will stay similar. What would be a relevant analysis, is to compare the parasite diversity between the queens and the lab workers; are there any parasites that are not present (or way less) in the lab workers but were omnipresent in the queens? For example, from your data, there doesn’t seem to be a bottle neck for Nosema ceranae, but a small bottleneck for T. pampeana. Even better would be to also analyse the parasites of the queens used for rearing, if they were kept frozen after the experiment.

R: We agree with your comments and we considered that some of those ideas are already included in the manuscript. As the example that you mentioned about the two microsporidia in the discussion section we discuss about other examples such as a P. longanalis, and SBV (Sacbrood virus). On the other hand, unfortunately the queens used for rearing were not kept frozen since laboratory colonies were used for pollination experiments; we are aware that including them in the analysis would have enrich this study.

[255] You mention mites being a possible vector, but you don’t analyses this in your data; for this you don’t necessarily have to screen the mites themselves, but you could model a relation between presence of certain mite species and prevalence/abundance/load of viruses and pathogens.

R: Its very interesting what you mention about modeling but unfortunately, we don’t have the necessary data (e.g. load) for all groups of pathogens and viruses to do that.

Some smaller comments: The general structure is not good yet. Some examples:

R: We modified the text and your suggestions were included.

45 ‘among others’ fits better than ‘between others’.

R: The text was modified taking into account this observation.

Also, maybe it is good to mention multiplicative effects, like pesticide intoxication that increases pathogen susceptibility.

R: It was mentioned in the revised version.

R: The text was modified taking into account these observations.

R: We corrected the numbers of the total collected queens and added details to the material and methods section to improve the clarity.

There are still a lot of grammar and spelling mistakes in the text. Some examples:

84 ‘significant’ damage

107 grammatical mistake

287-289 strange sentence

327-spotted

392-strange sentence

397 strange sentence and weird conclusion?

R: The manuscript was revised and improved, taking into account all the suggestions.

Reviewer 2

Line 2- Bumble bees

R: It was corrected.

Line 20- Please change bumblebees by bumble bee. I recommend making this change in the full text. Also in the case of honeybees by honey bees.

R: It was corrected.

Line 35- bumble bees

R: It was corrected.

Line 45- Please, to continue in the Line 45. ...between others (2). In particular, ....

R: It was corrected.

Line 49- Sentence in Lines 49-51, tend to ensure that Apis mellifera is main agent of dispersion of pathogens to other insect species, which is not clear at all. Please reconsider the setence. I recomend to consider the honey bees as one of posible agent of pathogen dispersion. ....while others have a broad host spectrum [6,7]. There is e.g. that the extended commerce and movement of managment bees such as honey bees, has led ....

R: We agree that A. mellifera is not the only agent of pathogens dispersion but that is not the intention of the reference sentence. We just wanted to highlight the role of commercial colonies as pathogens and parasites reservoirs basing this idea on several references (6,8,9,10,11). We made little modification in the text to clarify the idea, including bumble bees among the commercial colonies.

Line 54- Bumble bees

R: It was corrected.

Line 50- Apis mellifera add “L.”

R: It was corrected.

Line 52- Nosema ceranae add “Fries”

R: It was corrected.

Line 62- Friese

R: It was corrected.

Line 67- Move to Line 88.

From a sanitary point of view, the artificial breeding conditions (high density of individuals, impossibility of going out to defecate and forage, and limited food availability), can increase the survival and multiplication of different pathogens, facilitating the proliferation and transmission of diseases [39,40]. Thus, the aim the this study was perform an exhaustive survey...

R: The text was modified as suggested.

Line 72- Smith

R: It was corrected.

Line 75- To include species descriptor

R: It was corrected.

Line 76- Dufour

R: It was corrected.

Line 77- To include Descriptor of these species

R: It was corrected.

Line 81- L. and F.

R: It was corrected.

Line 82- Guérin-Méneville

R: It was corrected.

Line 85- I recommend to read and to include Arismendi et al 2021. Occurrence of bee viruses and pathogens associated with emerging infectious diseases in native and non-native bumble bees in southern Chile. Biological Invasion https://doi.org/10.1007/s10530-020-02428-w

R: The paper was cited and included in the references (47).

Line 96- Why did not you use all the samples for the viral, ectoparasites and other pathogens analysis? That is, the 33 samples. I believe that these pathogens/parasites can be detected in one sample.

How did you maintain the samples? in ethanol? under cold condition (-20°C/-80°C). Please explain/answer in details these questions

R: It was not possible to perform all analysis in the same individuals since every parasite/ pathogen requires different conditions of sample storage (-20 or -80°C) and different methods for sample processing. For example, samples for viral analysis requires storage at -80°C and the complete specimen is homogenized for RNA extraction. On the other hand, samples for internal parasites analysis require storage at -20°C, specimens must be dissected, the midgut extracted and observed. Procedures are not compatible to be performed in the same individual.

Line 97- There is not clear!

How many queens were collected after hibernation period? 33 or 73?.

I feel that, there were collected 73 queens (see Lines 94-97). In which case, 33 were used for pathogen/parasites analisys and 40 queens were used to start rearing under laboratory condiction.

Please clarify!

R: In total 73 queens were collected, 33 for analysis and 40 for rearing. It was clarified in the text.

Line 99- Similar to above comments, why not use the 92 worker bumble bees for internal and external pathogen/parasites?

R: As explained before, it was not possible to perform all analysis in the same individuals since every parasite/ pathogen requires different conditions of sample storage (-20 or -80°C) and different methods for sample processing.

Line 113- to continue in the Line 112.

R: It was corrected.

Line 138- No italic

R: It was corrected.

Line 139- No italic

R: It was corrected.

Line 141-add dut

R: It was corrected.

Line 150- No italic

R: It was corrected.

Line 151- ).

R: It was corrected.

Line 152- In the Table 1, only β-actin was listed. Did you also used RPS5?

R: Only β-actin was used. It was corrected in the text.

Line 160- Please indicate the statistical software.

R: InfoStat software was used. It was included in the text.

Line 172- Please add real p value. In this case must be report as: Chi-square: = 7.52; p =0.006; df = 1).

R: It was corrected

Line 174- Is it the real p-value? I believe that the p-value is p <001. Please clarify!

R: It was corrected

Table 2- Please indicate N° samples

Indicate N° samples

Where is the wild queens values?

You stated in the

Lines 96-97 that 33 queens were collected for pathogens/parasites analysis

R: The text was modified as suggested.

Line 180- p = 0003

R: The real p value was added

Line 182- co-infestation

R: It was corrected.

Line 187- Please to include title in the Y-axis in the Figure 1, anexed in this manuscript.

R: It was corrected.

Line 191- Delete Lines 191-192. To include this information at end of Figure 1.

R: We think it should be explained in the figure legend to understand the figure.

Line 198-real p-value

R: It was included.

Line 199-real p-value

R: It was included.

Line 202, 203, 207, 208- change “individual” for “bee”

R: It was corrected.

Line 220- Real p-value

R: It was included.

Line 223- I recommend to include ct values in supplementary material

R: If the reviewer think it is essential, we can include it. However, we think it does not provide substantial information to the manuscript.

Line 227- Real p-value

R: It was included.

Line 228- Real p-value

R: It was included.

Line 229- Please to include title in Y-axis

R: It was included.

Please clarify the asteristic in the bars. Who or what is it being compared to? You must to be illustrative and clear to the reader.

R: It was corrected

Line 232- Move this setence at end of Figure 2.

R: We think this information should be in the figure legend.

spell asterisk. No symbol.

The asterisk indicates ...

R: It was corrected.

Line 235-238- There were not shown the viral load.

I am confused. If you used Real Time PCR, there exist the posibility to make a viral quantification. Futhermore, you cited Pfaffl 2001.

Pfaffl W. A new mathematical model for relative quantification in real-time 590 RT–PCR. Nucleic Acids Res. 2001;425(3):2002–7.

If you did not quantified the viral load in the infected bumble bees, I recommend to do it. I believe this information could be usefull to related the viral prevalence with viral load. One thing is prevalence (positive cases) and the other, is the infection level (high, medium or low load of viral infection). There exist the posibility that hight prevalence could be related to high viral load. On the hand, low prevalence, could be associated to low viral titer. The viral load could have implicance in viral dispersion between bee species.

Of course that the viral prevalence is importante index, however, without viral load, it is difficult to conceptualize the intensity of infection or exposure of infected bees. This provides important information on if bee viruses are present in bumble bees at levels likely to have consequences for their health.

For more details, please see:

Dolezal AG, Hendrix SD, Scavo NA, Carrillo-Tripp J, Harris MA, Wheelock MJ, et al. (2016) Honey Bee Viruses in Wild Bees: Viral Prevalence, Loads, and Experimental Inoculation. PLoS ONE 11(11): e0166190. doi:10.1371/journal. pone.0166190

Alger SA, Burnham PA, Boncristiani HF, Brody AK (2019) RNA virus spillover from managed honeybees (Apis mellifera) to wild bumblebees (Bombus spp.). PLoS ONE 14(6): e0217822. https://doi.org/10.1371/journal.

pone.0217822

Alger SA, Burnham PA, Brody AK (2019) Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species. PLoS ONE 14(9): e0221800.

https://doi. org/10.1371/journal.pone.0221800

Arismendi et al 2021. Occurrence of bee viruses and pathogens associated with emerging infectious diseases in native and non-native bumble bees in southern Chile. Biological Invasion https://doi.org/10.1007/s10530-020-02428-w

R: β-actin mRNA was amplified in each sample as a control of correct RNA manipulation and extraction. The text was modified accordingly. The reference Pfaffl 2001 was not adequate, since viral quantification was not carried out.

We agree that absolute quantification would provide interesting information and will allow the comparison between viral levels in honey bees and bumble bees. However, at this point it is not possible to perform since we did not include adequate standard curves (dilution series of cloned PCR products or commercial gene fragments, for each virus).

In spite of that, we think that information regarding RNA viruses prevalence, together with the information of other parasites and pathogens provides useful information.

Line 244- This is the objective. It should be in Lines 88-90.

R: It was corrected.

Line 246- Delete. It does not provide relevant information.

R: It was deleted.

Line 249- I recommend to delete the subtitles in Discussion section

R: Subtitles were deleted.

Line 250- ... phoretic mites in bumble bee... There are tracheal mites which to be harmful for bumblebees.

R: It was corrected.

Line 254- and

R: It was added

Line 273- Please to include reference!

R: It was included.

Line 275- To include reference

R: It was included.

66 - Koulianos, S., Schwarz, H.H. (1999) Reproduction, development and diet of Parasitellus fucorum (Mesostigmata: Parasitidae), a mite associated with bumblebees (Hymenoptera: Apidae). J. Zool., 248, 267–269.

67- Royce, L.A., Krantz, G.W. (1989) Observations on pollen processing by Pneumolaelaps longanalis (Acari, Laelapidae), a mite associate of bumblebees. Exp. App. Acarol., 7, 161–165.

Line 287- To include comma (,)

R: It was corrected.

Line 298- Delete

R: It was deleted.

Line 301- ...Apis cerana (70). However,

R: It was corrected

Line 310- may or could?