Skip to main content
NCBI home page
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2021 Jan 11;9(2):e1595. doi: 10.1002/mgg3.1595

Isobutyryl‐CoA dehydrogenase deficiency associated with autism in a girl without an alternative genetic diagnosis by trio whole exome sequencing: A case report

Maria Eleftheriadou 1, Evita Medici‐ van den Herik 2, Kyra Stuurman 1, Yolande van Bever 1, Debby M E I Hellebrekers 3, Marjon van Slegtenhorst 1, George Ruijter 1, Tahsin Stefan Barakat 1,✉
PMCID: PMC8077115  PMID: 33432785

Abstract

Background

Isobutyryl‐CoA dehydrogenase (IBD) is a mitochondrial enzyme catalysing the third step in the degradation of the essential branched‐chain amino acid valine and is encoded by ACAD8. ACAD8 mutations lead to isobutyryl‐CoA dehydrogenase deficiency (IBDD), which is identified by increased C4‐acylcarnitine levels. Affected individuals are either asymptomatic or display a variety of symptoms during infancy, including speech delay, cognitive impairment, failure to thrive, hypotonia, and emesis.

Methods

Here, we review all previously published IBDD patients and describe a girl diagnosed with IBDD who was presenting with autism as the main disease feature.

Results

To assess whether a phenotype‐genotype correlation exists that could explain the development or absence of clinical symptoms in IBDD, we compared CADD scores, in silico mutation predictions, LoF tolerance scores and C4‐acylcarnitine levels between symptomatic and asymptomatic individuals. Statistical analysis of these parameters did not establish significant differences amongst both groups.

Conclusion

As in our proband, trio whole exome sequencing did not establish an alternative secondary genetic diagnosis for autism, and reported long‐term follow‐up of IBDD patients is limited, it is possible that autism spectrum disorders could be one of the disease‐associated features. Further long‐term follow‐up is suggested in order to delineate the full clinical spectrum associated with IBDD.

Keywords: autism, genotype‐phenotype correlation, isobutyryl‐CoA dehydrogenase deficiency, whole exome sequencing

Here, we review the clinical and molecular literature of Isobutyryl‐CoA dehydrogenase deficiency (IBDD) and present a novel case that was presenting with severe autism as the main disease feature. As extensive genetic analysis including trio whole exome sequencing did not establish a secondary cause for autism in this individual, and current reported follow‐up of IBDD individuals is limited, this case report might indicate that autism can be one of the IBDD manifestations.

graphic file with name MGG3-9-e1595-g002.jpg

1. INTRODUCTION

Isobutyryl‐CoA dehydrogenase (IBD), encoded by the ACAD8 gene (OMIM #604773) on chromosome 11q25, belongs to the Acyl‐CoA dehydrogenase (ACADs) family which is a group of mitochondrial enzymes involved in the catabolism of fatty acids and branched‐chain amino acids (Ikeda et al., 1983). It is responsible for the conversion of isobutyryl‐CoA to methylacrylyl‐CoA at the third step in the catabolism of the essential branched‐chain amino acid valine (Andresen et al., 2000). Isobutyryl‐CoA dehydrogenase deficiency (OMIM #611283, IBDD) (Roe et al., 1998) is a rare autosomal recessive disorder that is caused by bi‐allelic mutations in ACAD8, which reduce or eliminate the ability of IBD to catabolize valine (Andresen et al., 2000). IBDD causes blockage of valine oxidation resulting in the accumulation of isobutyryryl‐CoA, followed by transesterification with carnitine which leads to the formation of C4‐acylcarnitine and free CoA and excretion of acylcarnitines in urine (Reuter & Evans, 2012). In some cases, carnitine re‐uptake by the carnitine transporter in renal cells is inhibited, resulting in systemic secondary depletion of carnitine (Reuter & Evans, 2012). Therefore, IBDD patients present with accumulation of C4‐acylcarnitine in plasma and urine and in some cases secondary carnitine deficiency.

IBDD, in most cases, is suspected after initial aberrant newborn screening (NBS) performed by tandem mass spectrometry (MS/MS) to determine C4‐acylcarnitine levels which may represent isobutyrylcarnitine or butyrylcarnitine. However, elevated levels of C4‐acylcarnitine are not IBDD specific and are also observed in short‐chain acyl‐CoA dehydrogenase deficiency and ethylmalonic encephalopathy (Zafeiriou et al., 2007). In vitro probe studies of fibroblast fatty acid oxidation and specific detection of isobutyrylglycine in urine can help to distinguish between these disorders. However, final diagnosis of IBDD requires isobutyryl‐CoA dehydrogenase activity determination or genetic testing for mutations in ACAD8 (Koeberl et al., 2003). Affected individuals are reported to be either asymptomatic or develop symptoms during infancy or childhood, such as mild intellectual disability, speech delay, and failure to thrive with emesis (Koeberl et al., 2003; Lin et al., 2018; Oglesbee et al., 2007; Pedersen et al., 2006; Roe et al., 1998; Santra et al., 2017; Sass et al., 2004). Since, most cases of IBDD reported in literature have been identified through expanded NBS and limited data on their clinical follow‐up is available, at present the complete clinical spectrum of this disorder is undefined. Here, we review all previously described IBDD cases and report a girl presenting with autism, diagnosed with IBDD upon metabolic and targeted genetic investigation, in which subsequent trio whole exome sequencing (WES) did not establish an alternative genetic diagnosis that could explain autism.

2. METHODS

2.1. Ethical compliance

Parents gave written informed consent for publication of anonymized medical data and clinical photographs of the proband, collected in a clinical care setting. All metabolic investigations were performed in a clinical diagnostic setting. Use of genome‐wide genetic investigations, including trio WES in a clinical setting, was approved by the Erasmus MC Institutional Review Board (METC‐2012‐387).

2.2. Trio whole exome sequencing

Trio WES was performed and analysed as previously described (Hengel et al., 2020; Perenthaler et al., 2020). In short, genomic DNA was isolated from peripheral blood leukocytes of the proband and both parents and exome‐coding DNA was captured with the Agilent SureSelect Clinical Research Exome (CRE) kit (v2). Sequencing was performed on an Illumina HiSeq 4000 with 150 bp paired end reads. Reads were aligned to hg19 using BWA (BWA‐MEM v0.7.13) and variants were called using the GATK haplotype caller (v3.7 (reference: http://www.broadinstitute.org/gatk/). Detected variants were annotated, filtered and prioritized using the Bench lab NGS v5.0.2 platform (Agilent technologies). Initially, only genes known to be involved in intellectual disability were analyzed, followed by a full exome analysis. The encountered ACAD8 variant (reference transcript NM_014384.2) was verified by Sanger sequencing using the following sequencing primers: ACAD8_03_F (TGTAAAACGACGGCCAGTCCTCACTGTGCCCTCTAAA), ACAD8_03_R (CAGGAAACAGCTATGACCTACGAATCTGAACTCTCACAGTC).

2.3. Biochemical analysis

Acylcarnitine concentrations in plasma and urine were measured by flow‐injection tandem mass spectrometry (Vreken et al., 1999). Routine screening of urine organic acids was performed by gas chromatography‐mass spectrometry of methyl derivatives.

2.4. Literature search

Literature on IBDD was searched in PubMed (last assessed: 13 June 2020), focusing on publications in English. This resulted in 41 publications, of which 17 were dealing with patients affected with IBDD and were, therefore, included in our review.

2.5. In silico analysis and genotype‐phenotype correlation

Combined Annotation Dependent Depletion (CADD) scores (v1.4) (Kircher et al., 2014), representing the deleteriousness of single nucleotide variants and insertion/deletions variants in the human genome, were retrieved for each variant found in IBDD patients from https://cadd.gs.washington.edu/. MutationTaster (Schwarz et al., 2014) was used with default settings (http://www.mutationtaster.org/ ). To determine LoF tolerance and display encountered variants in ACAD8, MetaDome (Wiel et al., 2019) (https://stuart.radboudumc.nl/metadome/), was used, as we described before (Nabais Sá et al., 2020). To determine whether mutation characteristics were different between asymptomatic and symptomatic individuals, the average CADD and LoF score for both groups was calculated (summing up values from both alleles per individual) and the 95% confidence interval was calculated to assess whether differences were significant (p <  .05). To assess a possible correlation between C4‐acylcarnitine levels detected by MS/MS blood spot in NBS and the development of clinical symptoms in IBDD patients, the average C4‐acylcarnitine levels were compared between symptomatic versus asymptomatic group and the differences assessed using the same statistics.

3. RESULTS

3.1. Case report

The proband is a currently 11‐year‐old girl (Figure 1a), born by vacuum extraction at 40 weeks of gestation as the first child to distantly related Turkish, healthy parents. Pregnancy was uneventful, and birth weight was 3585 gram (p50). The start was normal, and no congenital anomalies or major dysmorphic features were noticed. A 4‐year‐old younger brother is healthy and has no medical issues, with no other cases of autism known in the family. The first year of the girl was uneventful. Motor development was normal, with independent ambulation at the age of 12 months. Parents noticed lack of interaction and lack of social eye contact early on. At the age of 2 years and 5 months, she first came to medical attention due a severe lack of speech development, which was assumed to be caused by hearing problems. At that age, she only expressed a few, barely understandable words and made some sounds. However, Extensive ENT investigations were normal, after which, at the age of 2 years and 7 months, a multidisciplinary neuropsychological assessment was performed showing internalizing behavior and a lack of social interactions. Further child psychiatry assessment lead to the diagnosis of autism at the age of 3 years (DSM‐IV classification: axis I:299.00; axis II: 799.90, axis III: no somatic disorder; axis IV: bi‐lingual education; axis V:cGas:35). Pivotal Response Treatment led to some improvements in social communication, allowing her to follow pre‐school medical day care and improving in play interactions with other children. Toilet training was achieved at the age of 5 years. At the age of 5 years and 4 months, she was referred to the neurology department for assessment of a cause of her autism. At that age, she was described as a quiet child, being in her own world, and speaking few words. Motor development was normal, and no focal neurological abnormalities were seen. An EEG was normal. A brain MRI at the age of 5 years and 10 months showed a structurally normal brain (Figure 1b), with no signs of aberrant neuronal migration or metabolic disorders, and no signs of previous asphyxia. Routine blood investigations and FGF‐21 in serum were normal. SNP‐array analysis revealed several runs of homozygosity (ROH, in total 42 Mb) in line with the distant consanguinity between parents, and a not‐previously reported variant of unknown significance (loss of approximately 533 kb in band 7p15.3, arr 7p15.3(22,126,627‐22,659,465) x1 (hg18)), which was inherited from the unaffected father. Metabolic testing showed increased C4‐carnitine in plasma and urine, increased isobutyrylglycine and decreased C4‐carnitine/isobutyryl‐carnitine ratios, all suggestive of IBDD (Figure 1e). Subsequent next generation sequencing based gene panel analysis of genes implicated in metabolic diseases found a homozygous variant in ACAD8 (NM_014384.2 (ACAD8): c.289G> A, p.Gly97Arg) (Figure 1c,d). This variant is found nine times heterozygous but not homozygous in GnomAD (MAF 0.0000358), is predicted to be disease causing by MutationTaster (Schwarz et al., 2010), has a CADD score (v1.4) of 31 (Kircher et al., 2014) and has previously been identified in three affected individuals with IBDD (Oglesbee et al., 2007; Santra et al., 2017; Yun et al., 2015), thereby confirming the diagnosis of IBDD in our proband. Subsequent suppletion with carnitine (2x daily, 500 mg) lead to a subjective increase in appetite but did not improve the autism phenotype. Cardiologic evaluation, including ECG and cardiac ultrasound did not show any abnormalities. Investigation at the Clinical Genetics outpatient clinic at the age of 8 years and 7 months showed stable normal growth (with head circumference, height and weight all between 0 and −1 SD at multiple measurements over the years), and no major dysmorphic features other than a mild 2–3 toe syndactyly. She was following special education, and speech was limited to a few words and noises. Given the severity of autism, a possible second genetic disorder was considered. Therefore, trio WES was performed in a clinical setting, which passed all clinical grade quality controls for sequencing coverage. Analysis first focused on a panel of ~1,200 genes involved in intellectual disability, followed by a complete open exome analysis. A variant of unknown significance in DNA2 (OMIM 601810, NM_001080449.2 (DNA2) c.2036‐2037 ins AA, p. (His679Glnfs*10)) inherited from the unaffected mother was found, but besides the previously identified homozygous ACAD8 variant no other likely disease implicated variant was identified. Both parents were heterozygous carriers of the ACAD8 variant. The unaffected brother was not available for genetic investigations.

FIGURE 1.

FIGURE 1

Open in a new tab

(a) Facial image of IBDD proband. (b) Midsagital T1 and axial T2 weighted brain MRI of the IBDD proband, showing normal structural brain morphology. (c) Family pedigree showing segregation of the ACAD8 variant; N/A, not available for genetic testing. (d) Chromatogram showing the ACAD8 c.289G> A, p.Gly97Arg variant (NM_014384.2) in a homozygous state in the proband and in a heterozygous state in both parents. (e) Overview of metabolic investigations. aButyryl‐carnitine + isobutyryl‐carnitine bEthylmalonic acid is normal in IBDD, but elevated in SCAD or ETHE1 deficiency. (f) Mutational spectrum of ACAD8 from all described IBDD patients. ACAD8 consists of 11 coding exons (blue). Variants identified in symptomatic patients are marked (*), red boxed variants are found in a homozygous state in symptomatic individuals. LoF tolerance landscape from MetaDome analysis is indicated

3.2. Review of the literature

Including our patient, to date, 47 individuals with IBDD, with a broad variety of ethnic backgrounds, have been described (Battaile et al., 2004; Koeberl et al., 2003; Lin et al., 2018; Nguyen et al., 2002; Oglesbee et al., 2007; Pedersen et al., 2006; Pena et al., 2012; Roe et al., 1998; Sadat et al., 2020; Santra et al., 2017; Sass et al., 2004; Scolamiero et al., 2015; T. Wang et al., 2019; W. Wang et al., 2019; Yoo et al., 2007; Yun et al., 2015) of which 22 are female, 17 are male and for eight cases gender was not reported (Table 1). Metabolic data have been described for 45 individuals, of which 38 have genetically confirmed bi‐allelic variants in ACAD8. Of these 38 genetically confirmed individuals, 12 showed clinical symptoms, 24 are reported to be asymptomatic, and for two individual no clinical data have been described.

TABLE 1.

Overview of described IBDD patients

Patient no. Sex Zygosity Genomic variant Protein variant CADD score LoF tolerance score Clinical state at birth Clinical symptoms Metabolic findings Last follow‐up age (years) References
Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2 C4‐acylcarnitine in blood spot MS/MS(NBS) NBS results (μmol/L) Day of NBS Plasma C4 acylcarnitine profile Urine Isobutyryl‐glycine Urine C4‐acylcarnitine Isobutyrylcarnitine (Fibroblasts FAO)
1 F hom c.905G>A c.905G>A Arg302Gln Arg302Gln 32 32 0.96 0.96 Unremarkable Failure to thrive, congenital heart malformation, dilated cardiomyopathy, anemia ND (later identified) ND (later identified) ND ↑ (after l‐ carnitine supplement) ↑ (after l‐ carnitine supplement) ND ↑ 11 Nguyen et al. (2002), Pedersen et al. (2006), Roe et al. (1998)
2 F het c.163_164insCT c.607G>A Phe55fs, Val203Ile ND 23.4 0.5 0.74 Unremarkable Developmental delay/intellectual disability, hypotonia ↑ 0.95/0.58 2/14 ↑ ↑ ↑ ND 0.7 Pedersen et al. (2006), Sass et al. (2004)
3 M hom c.384G>C c.384G>C Met128Ile Met128Ile 29 29 0.36 0.36 Unremarkable Normal ↑ 0.92/1.55 4/12 ↑ ↑ ↑ ND 1.1 Pedersen et al. (2006), Sass et al. (2004)
4 ND ND c.443C>T ND Pro148Leu ND 20.3 ND 0.5 ND ND ND ND ND ND ND ND ND ND ND Battaile et al. (2004), Pedersen et al. (2006)
5 ND ND c.988C>T ND Arg330Trp ND 23.1 ND 0.68 ND ND ND ND ND ND ND ND ND ND ND Battaile et al. (2004), Pedersen et al. (2006)
6 F het c.409G>A c.958G>A Gly137Arg Ala320Thr 32 29.7 0.41 0.58 Unremarkable Normal ↑† 1.1/0.8 8/24 ↓† ↑ ND ND 2.5 Pedersen et al. (2006)
7 F het c.455T>C c.1154A>G Met152Thr Gln385Arg 32 29 0.45 0.75 Unremarkable Hypotonia, congenital heart malformation ↑† 2.9/2.6 1/8 ↑ Normal ND ↑ 3.8 Pedersen et al. (2006)
8 F het c.348C>A c.1000C>T Cys116X Arg334Cys 35 29.8 0.59 0.5 Unremarkable Speech delay ↑† 3.23/2.33 2/8 ↑† ↑ ND ↑ At least 5 Koeberl et al. (2003), Pedersen et al. (2006)
9 M hom c.400G>T c.400G>T Asp134Tyr Asp134Tyr 33 33 0.39 0.39 Unremarkable Speech delay, lethargy, ear infections ↑† 2.41/2.40 5/37 ↑† ↑ ND ND At least 2 Pedersen et al. (2006)
10 M het c.3G>T c.1000C>T Met1Ile Arg334Cys 18.17 29.8 1.41 0.5 Unremarkable Normal ↑ 3.89 18 ↑† ND ↑† ND 2.9 Yoo et al. (2007)
11 F hom c.988C>T c.988C>T Arg330Trp Arg330Trp 23.1 23.1 0.68 0.68 Unremarkable Emesis, gastroenteritis, ear infections ↑ 2.9 ND ↑ Normal ND ↑ 5 Oglesbee et al. (2007)
12 F het c.289G>A c.455T>C Gly97Arg Met152Thr 31 32 0.76 0.45 Unremarkable unremarkable ↑ 2.5 ND ↑ ND ND ↑ 5 Oglesbee et al. (2007)
13 M hom c.867C>A c.867C>A His289Gln His289Gln 11.88 11.88 0.65 0.65 Unremarkable Neonatal hyperbilirubinemia ↑ 2.4 4 ↑ Normal ND ↑ 6.5 Oglesbee et al. (2007), Pena et al. (2012)
14 F hom c.867C>A c.867C>A His289Gln His289Gln 11.88 11.88 0.65 0.65 Unremarkable Normal ↑ 2.1 9 ↑ Normal ↑ ND 4.6 Oglesbee et al. (2007), Pena et al. (2012)
15 F het c.443C>T c.455T>C Pro148Leu Met152Thr 20.3 32 0.5 0.45 Unremarkable Emesis, pyelonephritis, gastroenteritis ↑ 2 17 ↑ ND ND ↑ 6.3 Oglesbee et al. (2007), Pena et al. (2012)
16 F ND ND ND ND ND ND ND ND ND ND ND ↑ 2 ND ↑ Normal ↑ ND 5 Oglesbee et al. (2007)
17 F het c.958G>A c.1129G>A Ala320Thr Gly377Ser 29.7 33 0.58 0.6 ND ND ↑ 2 ND ↑ Normal ↑ ↑ 5 Oglesbee et al. (2007)
18 M het c.687T>G c.1129G>A Phe229Leu Gly377Ser 22.8 33 0.97 0.6 Unremarkable Normal ↑ 2.2 7 ↑ Normal ↑ ↑ 3.3 Oglesbee et al. (2007), Pena et al. (2012)
19 M ND ND ND ND ND ND ND ND ND Unremarkable Asthma ND ND (later identified) ND ↑ ND ND ND 6.8 Oglesbee et al. (2007), Pena et al. (2012)
20 M het c.455T>C c.512C>G Met152Thr Ser171Cys 32 25.3 0.45 1.08 Unremarkable Normal ↑ 1.8 ND ↑ Normal ↑ ↑ 5 Oglesbee et al. (2007)
21 M hom c.233T>C c.233T>C Met78Thr Met78Thr 25.9 25.9 0.61 0.61 Unremarkable Normal ↑ 1.8 ND ↑ Normal ↑ ↑ 5 Oglesbee et al. (2007)
22 F ND ND ND ND ND ND ND ND ND Unremarkable Normal ↑ 2.7 7 ↑ ↑ ↑ ND 0.7 Oglesbee et al. (2007), Pena et al. (2012)
23 M ND ND ND ND ND ND ND ND ND Unremarkable Normal ↑ 1.9 8 ↑ Normal ↑ ND 1.8 Oglesbee et al. (2007), Pena et al. (2012)
24 ND hom c.1129G>A c.1129G>A Gly377Ser Gly377Ser 33 33 0.6 0.6 Unremarkable Normal ↑ 2.26 1–3 ↑ ↑ ND ND ND Scolamiero et al. (2015)
25 ND het c.289G>A c.1156_1158delCAG Gly97Arg Gln386del 32 ND 0.76 0.79 Unremarkable Normal ↑ 1.67 ND ΝD ↑ ND ND ND Yun et al. (2015)
26 ND het c.3G>T c.1156_1158delCAG Met1Ile Gln386del 18.17 ND 1.41 0.79 Unremarkable Normal ↑ 2.57 ND ND ↑ ND ND ND Yun et al. (2015)
27 F hom c.289G>A c.289G>A Gly97Arg Gly97Arg 31 31 0.76 0.76 Unremarkable Emesis, failure to thrive, hypoglycemic encephalopathy, gastroenteritis ↑† ND ND ↑† Normal ND Normal 11 Santra et al. (2017)
28 F het c.235C > G c.1000C > T Arg79Gly Arg334Cys 25.4 29.8 0.5 0.5 Unremarkable Normal ↑ 1.47/1.31 4/13 ↑ ND ND ND 1.6 Lin et al. (2018, 2019)
29 M hom c.286G > A c.286G > A Gly96Ser Gly96Ser 29.7 29.7 0.6 0.6 Unremarkable Normal ↑ 1.94/1.69 4/11 ↑ ND ND ND 1.6 Lin et al. (2018, 2019)
30 F hom c.286G > A c.286G > A Gly96Ser Gly96Ser 29.7 29.7 0.6 0.6 Unremarkable Normal ↑ 1.29/1.96 7/21 ↑ ND ND ND 1.4 Lin et al. (2018, 2019)
31 M het c.286G > A c.444G > T Gly96Ser Pro148Pro 29.7 10.7 0.6 0.5‡ Unremarkable Normal ↑ 0.98/0.77 4/21 ↑ ND ND ND 1.2 Lin et al. (2018, 2019)
32 F het c.286G > A c.1092 + 1G > A Gly96Ser Splice site mutation 29.7 32 0.6 ND Unremarkable Normal ↑ 0.83/1.38 4/20 ↑ Normal ND ND 0.8 Lin et al. (2018, 2019)
33 M het c.286G > A c.1092 + 1G > A Gly96Ser Splice site mutation 29.7 32 0.6 ND Unremarkable Speech delay, learning disability ↑ ND (later identified) ND ↑ ND ND ND 8.9 Lin et al. (2018, 2019)
34 M het c.444G > T c.1176G > T Pro148Pro Arg392Ser 10.7 25.4 0.5‡ 0.53 Unremarkable Hypotonia, emesis, hematemesis, failure to thrive ↑ 1.01/0.98 10/19 ↑ ND ND ND 0.5 Lin et al. (2018, 2019)
35 ND het c.286C > A c.1000C > T Pro344Cys Gly96Ser 29.7 29.8 0.58 0.6 Unremarkable Normal ↑ ND ND ND ND ND ND ND T. Wang et al. (2019)
36 ND het c.286C > A c.1000C > T Pro344Cys Gly96Ser 29.7 29.8 0.58 0.6 Unremarkable Normal ↑ ND ND ND ND ND ND ND T. Wang et al. (2019)
37 ND het c.568‐3C > G c.1000C > T Frameshift Pro344Cys 15.29 29.8 0.58 ND Unremarkable Normal ↑ ND ND ND ND ND ND ND T. Wang et al. (2019)
38 ND het c.705 + 1G > A c.1176G > T Frameshift Arg392Ser ND 25.4 1.91 0,53 Unremarkable ND ↑ ND ND ND ND ND ND ND W. Wang et al. (2019)
39 ND§ hom c.384G > A c.384G > A Met128Ile Met128Ile 28.3 28.3 0.36 0.36 Unremarkable Normal ↑ 1.8 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
40 ND§ hom c.481A > G c.481G > A Thr161Ala Thr161Ala 5.217 5.217 1.22 1.23 Unremarkable Normal ↑ 1.5 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
41 ND§ het c.400G > T c.784G > A Asp134Tyr Glu262Lys 33 22.8 0.36 0.42 Unremarkable Normal ↑ 3.5 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
42 ND§ het c.400G > T c.784G > A Asp134Tyr Glu262Lys 33 22.8 0.36 0.43 Unremarkable Normal ↑ 2.5 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
43 ND§ hom c.905G > A c.905G > A Arg302Gln Arg302Gln 32 32 0.96 0.97 Unremarkable Normal ↑ 1.4 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
44 ND§ ND ND ND ND ND ND ND ND ND Unremarkable Normal ↑ 1.7 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
45 ND§ ND ND ND ND ND ND ND ND ND Unremarkable Normal ↑ 1.7 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
46 ND§ ND ND ND ND ND ND ND ND ND Unremarkable Normal ↑ 1.6 ND ↑ ND ND ND ND¶ Sadat et al. (2020)
47 F hom c.289G>A c.289G>A Gly97Arg Gly97Arg 32 32 0.76 0.76 Unremarkable Developmental delay/intellectual disability, speech delay, learning disability, autism ND (later identified) ND (later identified) ND ↑† ↑ ↑† ND 11 This report
Open in a new tab

IBDD patients described in literature including sex, zygosity, genomic and protein variants, CADD scores and LoF tolerance score for each variant. Clinical state at birth and symptoms reported later in life are displayed. Previously reported metabolic findings for each case are displayed, including blood spot MS/MS analysis, plasma acylcarnitine profile, metabolic findings in urine and Fibroblasts fatty acid oxidation (FAO) probe studies. The reported age at last follow‐up age of each individual is also presented. ND, no data; hom, homozygous; het, compound heterozygous; later identified, patients not identified by NBS; FAO, fatty acid oxidation; ↑, increased; † C4‐carnitine. ‡ mutation leading to a synonymous aminoacid change. § The sex of each patient was not described, but out of the eight patients reported in the study of Sadat et al. (2020), four were male and foue were female. ¶ Only a range of the follow‐up age of the individuals was provided by Sadat et al. (2020) (1–8 years old).

Clinical symptoms reported include neurodevelopmental delay/intellectual disability (2/36), hypotonia (3/36), speech delay (4/36), learning disability (2/36), emesis (4/36), failure to thrive (3/36), congenital heart malformation (2/36), dilated cardiomyopathy (1/36) and others (8/36) (Table 1). The average age at last follow‐up was 4.2 years (SD = 3.1 years), and for at least 10 patients, no follow‐up after the age of 3 years has been reported.

To assess whether a genotype‐phenotype correlation exists, we first mapped all reported pathogenic variants in ACAD8 (Figure 1f). Variants are widely distributed along the gene, including mutations in the N‐ and C‐terminal alpha‐helical domain and the medial beta‐strand domain, with no clear differences in spatial localisation between symptomatic and asymptomatic individuals. The average CADD score was 27.2, 95%CI [24.2, 30.2], in the symptomatic group compared to 26.7, 95%CI [24.6, 28.7], in the asymptomatic group which was slightly but not significantly lower. Similarly, we did not find a difference in the average LoF tolerance score between the two groups (0.63, 95%Cl [0.56, 0.7] and 0.679, 95%CI [0.59, 0.77] in symptomatic and asymptomatic respectively). We next assessed whether a correlation exists between the levels of C4‐acylcarnitine and clinical symptoms. The average C4‐acylcarnitine levels detected by MS/MS blood spot analysis was 2.124 μmol/L, 95%CI [1.56, 2.59], in the symptomatic group compared to 1.996, 95%CI [1.74, 2.25] in the asymptomatic group. Therefore, no clear genotype‐phenotype or biochemical correlation explains phenotypical differences between IBDD patients.

4. DISCUSSION

Here, we report an individual diagnosed with IBDD and autism, and review all previously described IBDD cases. Whereas the majority of IBDD cases has been reported to be asymptomatic, several individuals have been described manifesting clinical phenotypes, including neurodevelopmental and speech delay. No clear genotype‐phenotype correlation emerged from our analysis, and no association between C4‐acylcarnitine levels in NBS and clinical features was identified. Most IBDD individuals were identified during NBS, and reported clinical information and long‐term follow‐up is limited. Hence, at present, the clinical spectrum of this disorder remains to be elucidated. Although autism has not yet been specifically reported to be associated with IBDD, at least three and one previously reported individuals displayed speech delay or neurodevelopmental delay, respectively (Koeberl et al., 2003; Lin et al., 2018; Pedersen et al., 2006; Sass et al., 2004), and many other individuals were reported at an early age at which a autism diagnosis might not yet have been possible to establish (Johnson et al., 2007). As in the reported symptomatic cases no further genetic analysis has been performed after the IBDD diagnosis, it remains possible that in a number of cases a secondary genetic diagnosis could explain some of the clinical phenotypes. However, in our case, extensive genetic investigations including SNP‐array and trio WES, aiming to identify a confounding secondary genetic cause, did not establish an alternative genetic diagnosis. Although we cannot exclude that with the current clinical technology, an alternative genetic diagnosis was missed, for example due to a genetic variant in non‐coding regions that are not assessed during WES (Perenthaler et al., 2019), it seems as likely that there is no secondary genetic cause explaining the presence of autism in this individual. Hence, it is possible that autism spectrum features might be associated with IBDD, similar to the occurrence of autism in many other inborn errors of metabolism including those in related pathways (Novarino et al., 2012; Simons et al., 2017). Future long‐term follow‐up of IBDD cases will be necessary to further delineate the clinical phenotype of this metabolic disorder.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

AUTHOR CONTRIBUTIONS

TSB conceived the study and supervised the work. EM, KS, YB, and TSB collected clinical data. DH, MS, and GR performed genetic and biochemical investigations. ME and TSB performed the literature review and wrote the paper with input from all authors.

ACKNOWLEDGMENTS

We are indebted to the patient and their parents for their kind cooperation. ME was supported by an Erasmus+ Traineeship Programme and Noréus travel scholarship from V. and G. Noréus Scholarship Foundation. TSB’s lab is supported by the Netherlands Organisation for Scientific Research (ZonMW Veni, grant 91617021), a NARSAD Young Investigator Grant from the Brain & Behavior Research Foundation, an Erasmus MC Fellowship 2017 and Erasmus MC Human Disease Model Award 2018.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request. Primary patient data (including sequencing and biochemical data) cannot be made available due to restrictions by patient consent.

REFERENCES

  1. Andresen, B. S. , Christensen, E. , Corydon, T. J. , Bross, P. , Pilgaard, B. , Wanders, R. J. A. , & Skovby, F. (2000). Isolated 2‐methylbutyrylglycinuria caused by short/branched‐chain Acyl‐CoA dehydrogenase deficiency: Identification of a new enzyme defect, resolution of its molecular basis, and evidence for distinct Acyl‐CoA dehydrogenases in isoleucine and valine metab. The American Journal of Human Genetics, 67(5), 1095–1103. 10.1086/303105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Battaile, K. P. , Nguyen, T. V. , Vockley, J. , & Kim, J. J. P. (2004). Structures of isobutyryl‐CoA dehydrogenase and enzyme‐product complex: Comparison with isovaleryl‐ and short‐chain acyl‐CoA dehydrogenases. Journal of Biological Chemistry, 279(16), 16526–16534. 10.1074/jbc.M400034200 [DOI] [PubMed] [Google Scholar]
  3. Hengel, H. , Bosso‐Lefèvre, C. , Grady, G. , Szenker‐Ravi, E. , Li, H. , Pierce, S. , Lebigot, É. , Tan, T.‐T. , Eio, M. Y. , Narayanan, G. , Utami, K. H. , Yau, M. , Handal, N. , Deigendesch, W. , Keimer, R. , Marzouqa, H. M. , Gunay‐Aygun, M. , Muriello, M. J. , Verhelst, H. , … Reversade, B. (2020). Loss‐of‐function mutations in UDP‐glucose 6‐dehydrogenase cause recessive developmental epileptic encephalopathy. Nature Communications, 11(1), 595. 10.1038/s41467-020-14360-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ikeda, Y. , Dabrowski, C. , & Tanaka, K. (1983). Separation and properties of five distinct acyl‐CoA dehydrogenases from rat liver mitochondria. Identification of a new 2‐methyl branched chain acyl‐CoA dehydrogenase. Journal of Biological Chemistry, 258(2), 1066–1076 [PubMed] [Google Scholar]
  5. Johnson, C. P. , Myers, S. M. , Lipkin, P. H. , Cartwright, J. D. , Desch, L. W. , Duby, J. C. , & Yeargin‐Allsopp, M. (2007). Identification and evaluation of children with autism spectrum disorders. Pediatrics, 120(5), 1183–1215. 10.1542/peds.2007-2361 [DOI] [PubMed] [Google Scholar]
  6. Kircher, M. , Witten, D. M. , Jain, P. , O'Roak, B. J. , Cooper, G. M. , & Shendure, J. (2014). A general framework for estimating the relative pathogenicity of human genetic variants. Nature Genetics, 46(3), 310–315. 10.1038/ng.2892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Koeberl, D. D. , Young, S. P. , Gregersen, N. , Vockley, J. , Smith, W. E. , Benjamin, D. K. , An, Y. , Weavil, S. D. , Chaing, S. H. , Bali, D. , McDonald, M. T. , Kishnani, P. S. , Chen, Y.‐T. , & Millington, D. S. (2003). Rare disorders of metabolism with elevated butyryl‐ and isobutyryl‐carnitine detected by tandem mass spectrometry newborn screening. Pediatric Research, 54(2), 219–223. 10.1203/01.PDR.0000074972.36356.89 [DOI] [PubMed] [Google Scholar]
  8. Lin, Y. , Peng, W. , Jiang, M. , Lin, C. , Lin, W. , Zheng, Z. , Li, M. , & Fu, Q. (2018). Clinical, biochemical and genetic analysis of Chinese patients with isobutyryl‐CoA dehydrogenase deficiency. Clinica Chimica Acta, 487, 133–138. 10.1016/j.cca.2018.09.033 [DOI] [PubMed] [Google Scholar]
  9. Lin, Y. , Zheng, Q. , Zheng, T. , Zheng, Z. , Lin, W. , & Fu, Q. (2019). Expanded newborn screening for inherited metabolic disorders and genetic characteristics in a southern Chinese population. Clinica Chimica Acta, 494, 106–111. 10.1016/j.cca.2019.03.1622 [DOI] [PubMed] [Google Scholar]
  10. Nabais Sá, M. J. , Venselaar, H. , Wiel, L. , Trimouille, A. , Lasseaux, E. , Naudion, S. , Lacombe, D. , Piton, A. , Vincent‐Delorme, C. , Zweier, C. , Reis, A. , Trollmann, R. , Ruiz, A. , Gabau, E. , Vetro, A. , Guerrini, R. , Bakhtiari, S. , Kruer, M. C. , Amor, D. J. , … Koolen, D. A. (2020). De novo CLTC variants are associated with a variable phenotype from mild to severe intellectual disability, microcephaly, hypoplasia of the corpus callosum, and epilepsy. Genetics in Medicine, 22(4), 797–802. 10.1038/s41436-019-0703-y [DOI] [PubMed] [Google Scholar]
  11. Nguyen, T. V. , Andresen, B. S. , Corydon, T. J. , Ghisla, S. , Abd‐El Razik, N. , Mohsen, A.‐W. , Cederbaum, S. D. , Roe, D. S. , Roe, C. R. , Lench, N. J. , & Vockley, J. (2002). Identification of isobutyryl‐CoA dehydrogenase and its deficiency in humans. Molecular Genetics and Metabolism, 77(1–2), 68–79. 10.1016/S1096-7192(02)00152-X [DOI] [PubMed] [Google Scholar]
  12. Novarino, G. , El‐Fishawy, P. , Kayserili, H. , Meguid, N. A. , Scott, E. M. , Schroth, J. , Silhavy, J. L. , Kara, M. , Khalil, R. O. , Ben‐Omran, T. , Ercan‐Sencicek, A. G. , Hashish, A. F. , Sanders, S. J. , Gupta, A. R. , Hashem, H. S. , Matern, D. , Gabriel, S. , Sweetman, L. , Rahimi, Y. , … Gleeson, J. G. (2012). Mutations in BCKD‐kinase lead to a potentially treatable form of autism with epilepsy. Science, 338(6105), 394–397. 10.1126/science.1224631 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Oglesbee, D. , He, M. , Majumder, N. , Vockley, J. , Ahmad, A. , Angle, B. , Burton, B. , Charrow, J. , Ensenauer, R. , Ficicioglu, C. H. , Keppen, L. D. , Marsden, D. , Tortorelli, S. , Hahn, S. H. , & Matern, D. (2007). Development of a newborn screening follow‐up algorithm for the diagnosis of isobutyryl‐CoA dehydrogenase deficiency. Genetics in Medicine, 9(2), 108–116. 10.1097/GIM.0b013e31802f78d6 [DOI] [PubMed] [Google Scholar]
  14. Pedersen, C. B. , Bischoff, C. , Christensen, E. , Simonsen, H. , Lund, A. M. , Young, S. P. , Koeberl, D. D. , Millington, D. S. , Roe, C. R. , Roe, D. S. , Wanders, R. J. A. , Ruiter, J. P. N. , Keppen, L. D. , Stein, Q. , Knudsen, I. , Gregersen, N. , & Andresen, B. S. (2006). Variations in IBD (ACAD8) in children with elevated C4‐carnitine detected by tandem mass spectrometry newborn screening. Pediatric Research, 60(3), 315–320. 10.1203/01.pdr.0000233085.72522.04 [DOI] [PubMed] [Google Scholar]
  15. Pena, L. , Angle, B. , Burton, B. , & Charrow, J. (2012). Follow‐up of patients with short‐chain acyl‐CoA dehydrogenase and isobutyryl‐CoA dehydrogenase deficiencies identified through newborn screening: One centers experience. Genetics in Medicine, 14(3), 342–347. 10.1038/gim.2011.9 [DOI] [PubMed] [Google Scholar]
  16. Perenthaler, E. , Nikoncuk, A. , Yousefi, S. , Berdowski, W. M. , Alsagob, M. , Capo, I. , van der Linde, H. C. , van den Berg, P. , Jacobs, E. H. , Putar, D. , Ghazvini, M. , Aronica, E. , van IJcken, W. F. J. , de Valk, W. G. , Medici‐van den Herik, E. , van Slegtenhorst, M. , Brick, L. , Kozenko, M. , Kohler, J. N. , … Barakat, T. S. (2020). Loss of UGP2 in brain leads to a severe epileptic encephalopathy, emphasizing that bi‐allelic isoform‐specific start‐loss mutations of essential genes can cause genetic diseases. Acta Neuropathologica, 139(3), 415–442. 10.1007/s00401-019-02109-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Perenthaler, E. , Yousefi, S. , Niggl, E. , & Barakat, T. S. (2019). Beyond the exome: The non‐coding genome and enhancers in neurodevelopmental disorders and malformations of cortical development. Frontiers in Cellular Neuroscience, 13, 352. 10.3389/fncel.2019.00352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Reuter, S. E. , & Evans, A. M. (2012). Carnitine and acylcarnitines: Pharmacokinetic, pharmacological and clinical aspects. Clinical Pharmacokinetics, 51(9), 553–572. 10.2165/11633940-000000000-00000 [DOI] [PubMed] [Google Scholar]
  19. Roe, C. R. , Cederbaum, S. D. , Roe, D. S. , Mardach, R. , Galindo, A. , & Sweetman, L. (1998). Isolated isobutyryl‐CoA dehydrogenase deficiency: An unrecognized defect in human valine metabolism. Molecular Genetics and Metabolism, 65(4), 264–271. 10.1006/mgme.1998.2758 [DOI] [PubMed] [Google Scholar]
  20. Sadat, R. , Hall, P. L. , Wittenauer, A. L. , Vengoechea, E. D. , Park, K. , Hagar, A. F. , Singh, R. , Moore, R. H. , & Gambello, M. J. (2020). Increased parental anxiety and a benign clinical course: Infants identified with short‐chain acyl‐CoA dehydrogenase deficiency and isobutyryl‐CoA dehydrogenase deficiency through newborn screening in Georgia. Molecular Genetics and Metabolism, 129(1), 20–25. 10.1016/j.ymgme.2019.11.008 [DOI] [PubMed] [Google Scholar]
  21. Santra, S. , Macdonald, A. , Preece, M. A. , Olsen, R. K. , & Andresen, B. S. (2017). Long‐term outcome of isobutyryl‐CoA dehydrogenase deficiency diagnosed following an episode of ketotic hypoglycaemia. Molecular Genetics and Metabolism Reports, 10, 28–30. 10.1016/j.ymgmr.2016.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sass, J. O. , Sander, S. , & Zschocke, J. (2004). Isobutyryl‐CoA dehydrogenase deficiency: Isobutyrylglycinuria and ACAD8 gene mutations in two infants. Journal of Inherited Metabolic Disease, 27(6), 741–745. 10.1023/B:BOLI.0000045798.12425.1b [DOI] [PubMed] [Google Scholar]
  23. Schwarz, J. M. , Cooper, D. N. , Schuelke, M. , & Seelow, D. (2014). Mutationtaster2: Mutation prediction for the deep‐sequencing age. Nature Methods, 11(4), 361–362. 10.1038/nmeth.2890 [DOI] [PubMed] [Google Scholar]
  24. Schwarz, J. M. , Rödelsperger, C. , Schuelke, M. , & Seelow, D. (2010). MutationTaster evaluates disease‐causing potential of sequence alterations. Nature Methods, 7(8), 575–576. 10.1038/nmeth0810-575 [DOI] [PubMed] [Google Scholar]
  25. Scolamiero, E. , Cozzolino, C. , Albano, L. , Ansalone, A. , Caterino, M. , Corbo, G. , di Girolamo, M. G. , Di Stefano, C. , Durante, A. , Franzese, G. , Franzese, I. , Gallo, G. , Giliberti, P. , Ingenito, L. , Ippolito, G. , Malamisura, B. , Mazzeo, P. , Norma, A. , Ombrone, D. , … Ruoppolo, M. (2015). Targeted metabolomics in the expanded newborn screening for inborn errors of metabolism. Molecular BioSystems, 11(6), 1525–1535. 10.1039/c4mb00729h [DOI] [PubMed] [Google Scholar]
  26. Simons, A. , Eyskens, F. , Glazemakers, I. , & van West, D. (2017). Can psychiatric childhood disorders be due to inborn errors of metabolism? European Child and Adolescent Psychiatry, 26, 143–154. 10.1007/s00787-016-0908-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Vreken, P. , Van Lint, A. E. M. , Bootsma, A. H. , Overmars, H. , Wanders, R. J. A. , & Van Gennip, A. H. (1999). Quantitative plasma acylcarnitine analysis using electrospray tandem mass spectrometry for the diagnosis of organic acidaemias and fatty acid oxidation defects. Journal of Inherited Metabolic Disease, 22(3), 302–306. 10.1023/A:1005587617745 [DOI] [PubMed] [Google Scholar]
  28. Wang, T. , Ma, J. , Zhang, Q. , Gao, A. , Wang, Q. I. , Li, H. , Xiang, J. , & Wang, B. (2019). Expanded newborn screening for inborn errors of metabolism by tandem mass spectrometry in suzhou, china: Disease spectrum, prevalence, genetic characteristics in a chinese population. Frontiers in Genetics, 10, 1052. 10.3389/fgene.2019.01052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wang, W. , Yang, J. , Xue, J. , Mu, W. , Zhang, X. , Wu, W. , Xu, M. , Gong, Y. , Liu, Y. , Zhang, Y. U. , Xie, X. , Gu, W. , Bai, J. , & Cram, D. S. (2019). A comprehensive multiplex PCR based exome‐sequencing assay for rapid bloodspot confirmation of inborn errors of metabolism. BMC Medical Genetics, 20(1), 3. 10.1186/s12881-018-0731-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wiel, L. , Baakman, C. , Gilissen, D. , Veltman, J. A. , Vriend, G. , & Gilissen, C. (2019). MetaDome: Pathogenicity analysis of genetic variants through aggregation of homologous human protein domains. Human Mutation, 40(8), 1030–1038. 10.1002/humu.23798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yoo, E. H. , Cho, H. J. , Ki, C. S. , & Lee, S. Y. (2007). Isobutyryl‐CoA dehydrogenase deficiency with a novel ACAD8 gene mutation detected by tandem mass spectrometry newborn screening. Clinical Chemistry and Laboratory Medicine, 45(11), 1495–1497. 10.1515/CCLM.2007.317 [DOI] [PubMed] [Google Scholar]
  32. Yun, J. W. , Jo, K. I. , Woo, H. I. , Lee, S. Y. , Ki, C. S. , Kim, J. W. , & Park, H. D. (2015). A novel ACAD8 mutation in asymptomatic patients with isobutyryl‐CoA dehydrogenase deficiency and a review of the ACAD8 mutation spectrum. Clinical Genetics, 87(2), 196–198. 10.1111/cge.12350 [DOI] [PubMed] [Google Scholar]
  33. Zafeiriou, D. , Augoustides‐Savvopoulou, P. , Haas, D. , Smet, J. , Triantafyllou, P. , Vargiami, E. , Tamiolaki, M. , Gombakis, N. , van Coster, R. , Sewell, A. , Vianey‐Saban, C. , & Gregersen, N. (2007). Ethylmalonic encephalopathy: Clinical and biochemical observations. Neuropediatrics, 38(2), 78–82. 10.1055/s-2007-984447 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. Primary patient data (including sequencing and biochemical data) cannot be made available due to restrictions by patient consent.

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES