Skip to main content
NCBI home page
Chinese Medical Journal logoLink to Chinese Medical Journal
. 2021 Apr 8;134(8):963–970. doi: 10.1097/CM9.0000000000001470

Effects of HDAC4 on IL-1β-induced matrix metalloproteinase expression regulated partially through the WNT3A/β-catenin pathway

Qi Ning 1, Ye-Hua Gan 2, Rui-Rui Shi 2, Juan-Hong Meng 1
Editors: Yan-Jie Yin, Xiu-Yuan Hao
PMCID: PMC8078302  PMID: 33840739

Abstract

Background:

Histone deacetylase 4 (HDAC4) regulates chondrocyte hypertrophy and bone formation. The aim of the present study was to explore the effects of HDAC4 on Interleukin 1 beta (IL-1β)-induced chondrocyte extracellular matrix degradation and whether it is regulated through the WNT family member 3A (WNT3A)/β-catenin signaling pathway.

Methods:

Primary chondrocytes (CC) and human chondrosarcoma cells (SW1353 cells) were treated with IL-1β and the level of HDAC4 was assayed using Western blotting. Then, HDAC4 expression in the SW1353 cells was silenced using small interfering RNA to detect the effect of HDAC4 knockdown on the levels of matrix metalloproteinase 3 (MMP3) and MMP13 induced by IL-1β. After transfection with HDAC4 plasmids, the overexpression efficiency was examined using Real-time quantitative polymerase chain reaction (qRT-PCR) and the levels of MMP3 and MMP13 were assayed using Western blotting. After incubation with IL-1β, the translocation of β-catenin into the nucleus was observed using immunofluorescence staining in SW1353 cells to investigate the activation of the WNT3A/β-catenin signaling pathway. Finally, treatment with WNT3A and transfection with glycogen synthase kinase 3 beta (GSK3β) plasmids were assessed for their effects on HDAC4 levels using Western blotting.

Results:

IL-1β downregulated HDAC4 levels in chondrocytes and SW1353 cells. Furthermore, HDAC4 knockdown increased the levels of MMP3 and MMP13, which contributed to the degradation of the extracellular matrix. Overexpression of HDAC4 inhibited IL-1β-induced increases in MMP3 and MMP13. IL-1β upregulated the levels of WNT3A, and WNT3A reduced HDAC4 levels in SW1353 cells. GSK-3β rescued IL-1β-induced downregulation of HDAC4 in SW1353 cells.

Conclusion:

HDAC4 exerted an inhibitory effect on IL-1β-induced extracellular matrix degradation and was regulated partially by the WNT3A/β-catenin signaling pathway.

Keywords: Histone deacetylase 4, Matrix metalloproteinase 13, Matrix metalloproteinase 3, Osteoarthritis, WNT3A

Introduction

Osteoarthritis (OA) is one of the most common degenerative joint disorders in human,[1,2] which is characterized by hyperplasia of subchondral bone and the degeneration of articular cartilage, resulting in the loss of joint function.[3,4] The temporomandibular joint (TMJ) is a synovial joint that plays an important role in craniofacial growth and function, and can be affected by OA.[5] The maintenance of homeostasis in articular cartilage is crucial for its structural integrity and function. The balance between matrix destruction and repair is regulated by the catabolic and anabolic activities of chondrocytes.[6]

Although the specific mechanisms of OA are unclear, growing evidence suggests that catabolic alterations and inflammation play critical roles in the development of OA.[7] Proinflammatory cytokines such as interleukin (IL)-1β are the critical mediators of the disturbed processes implicated in OA pathophysiology,[8] which lead to the apoptosis of chondrocytes and degradation of the extracellular matrix (ECM), eventually resulting in cartilage degeneration.[8–10,12] Specifically, upregulation of cytokines increases the expression of matrix-degrading proteins such as matrix metalloproteinases (MMPs) significantly, especially matrix metalloproteinase 1 (MMP1), matrix metalloproteinase 3 (MMP3), and matrix metalloproteinase 13 (MMP13).[16,17] These MMPs contribute to the degradation of type II collagen and aggrecan, which are the major components of the cartilage matrix.[18,19] Therefore, inhibition of IL–1β–induced catabolic metabolism and inflammatory responses could delay the progression of OA.

The initiation and progression of OA is a complex process that involves many cell types, signaling pathways, and molecular changes in the ECM. Epigenetic alterations occur in chondrocytes during the initiation and progression of OA,[20,21] and histone deacetylases (HDACs) play crucial roles in all stages of chondrocyte maturation, likely contributing to disease phenotypes.[22] Class II HDACs initiate transcriptional changes in response to cytokines and growth factors, playing key roles in chondrocyte maintenance and maturation. HDAC4 is the most extensively studied class II HDAC. HDAC4 has a crucial role in the regulation of chondrocyte hypertrophy during skeletogenesis in mice; HDAC4-null mice displayed aberrant chondrocyte hypertrophy and subsequent premature ossification in the chondrocostal cartilage, and HDAC4 could repress chondrocyte hypertrophy in vitro.[23] Hypertrophic chondrocytes express high levels of MMP-3 and MMP-13.[24] We, therefore, hypothesized that HDAC4 would affect IL-1β-induced MMP expression.

Several critical signaling pathways act as key regulators and activators of cellular and molecular processes during OA development. WNT signaling is one such pathway and it was reported to stimulate matrix catabolic genes and the activity of catabolic proteins in articular chondrocytes, suggesting its possible role in OA.[25–27] WNT is a family of extracellularly secreted glycoproteins whose various receptors regulate canonical β-catenin-dependent and non-canonical β-catenin-independent signaling pathways. The protein level of WNT3A, a major activator of canonical WNT/β-catenin signaling, and that of β-catenin were increased in a model of OA.[28,30–31] β-catenin is a central molecule in the canonical WNT signaling pathway, which controls multiple developmental processes in skeletal and joint development.[34] The constitutive activation of the β-catenin pathway leads to cartilage breakdown and promotes a joint OA-like phenotype.[29,35] Furthermore, IL-1β can activate WNT/β-catenin signaling in chondrocytes.[36,37] However, the relationship between the WNT signaling and HDAC4 in the pathogenesis of TMJ osteoarthritis remains unclear. In the present study, we explored the role of HDAC4 in the development of OA and whether it was regulated through the WNT signaling pathway.

Methods

Primary chondrocyte isolation and culture

Chondrocytes were isolated from the TMJ condyles of 4-week-old Wistar rats (Vital River Experimental Animal Technique Company, Beijing, China) as described in previous study.[38] Cartilage was digested with 0.25% trypsin (Sigma, St. Louis, MO, USA) for 15 min, followed by digestion with 0.2% type II collagenase (Invitrogen, San Diego, CA, USA) for 4 to 6 h. Chondrocytes were then suspended in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) (Hyclone, Logan, UT, USA), supplemented with 50 units of penicillin/streptomycin (Gibco) and 2 mmol/L glutamine. Cells were plated in 60-mm plates at a density of 1.5 × 106 cells/plate. After primary culture for 5 days, the chondrocytes were harvested. All animal procedures were approved by the Animal Use and Care Committee of Peking University, China.

SW1353 cell culture

SW1353 human chondrosarcoma cells were purchased from ATCC (Manassas, VA, USA). The cells were cultured in DMEM supplemented with 10% v/v FBS, 2 mmol/L glutamine, and 50 units of penicillin/streptomycin. Cells were grown at 37°C in an atmosphere containing 5% CO2 and 95% humidity.

Cell treatment and transfection

HDAC4 expression in SW1353 cells was silenced using small interfering RNA (siRNA; GenePharma, Shanghai, China) transfection. The sequences of siRNAs are listed in Table 1. Chondrocytes were seeded at a density of 2.0 × 10 5 cells/well in 6-well plates and transfected with siRNAs specific to HDAC4 (si-HDAC4; 50 nmol/L) or with a negative control siRNA (si-NC; 50 nmol/L) as a negative control, using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The sequences of the siRNAs used are listed in Table 1. The cells were then incubated with IL-1β (10 ng/mL) for 24 h. The HDAC4 overexpression vector and empty vector (Genechem, Shanghai, China) were transfected into cells using Lipofectamine 3000 reagent. Cells were plated in a 6-well tissue culture plate 48 to 72 h before transfection. Cells at 80% to 90% confluence were transfected with 2.5 μg of plasmid DNA. Transfected cells were maintained in complete DMEM for 48 h. Cells were then incubated with IL-1β (10 ng/mL) for 24 h and used for further analyses. For cell treatment, cells at 80–90% confluence were washed with phosphate buffered saline (PBS) and were further cultured in serum free media overnight. IL-1β (Sigma, St. Louis, MO, USA) or WNT3A (R&D Systems, Minneapolis, MN) was added into the media.

Table 1.

Sequences of siRNAs of HDAC4.

Gene Sequence number Sense (5’-3’) Anti-sense (5’-3’)
HDAC4 si1 GCAGCAGCAUCAGCAGUUUTT AAACUGCUGAUGCUGCUGCTT
si2 GCGUGAGCAAGAUCCUCAUTT AUGAGGAUCUUGCUCACGCTT
si3 GGAAUCUGAACCACUGCAUTT AUGCAGUGGUUCAGAUUCCTT
Open in a new tab

HDAC: Histone deacetylase; si/siRNA: Small interfering RNA.

Immunofluorescence microscopy

For immunofluorescence microscopy, cells were grown on glass coverslips and fixed with 4% paraformaldehyde at 4°C for 15 min. The cells were permeabilized and blocked with 0.5% Triton X-100 and 5% bovine serum albumin in phosphate-buffered saline (PBS) for 30 min. The coverslips were then exposed to primary antibodies at 4°C overnight, followed by fluorescein isothiocyanate–conjugated secondary antibodies for 1 h. The nuclei were counterstained using 4’,6-diamidino-2-phenylindole (DAPI) for 5 min. The slides were mounted with 90% glycerol in PBS, and fluorescence was examined under a fluorescence microscope.

RNA isolation and qRT-PCR

Total RNA was isolated from cells using TRIzol (Invitrogen, Carlsbad, CA, USA). Total RNA (1 μg) was reverse-transcribed using a PrimeScript-RT reagent kit (Takara Biotechnology, Kusatsu, Japan), and resultant cDNA was analyzed using quantitative real-time polymerase chain reaction (qPCR) using the 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA) and SYBR Premix Ex Taq™ (Takara Biotechnology), according to the manufacturer's guidelines. The primers used are listed in Table 2. All experiments were performed in triplicate and mRNA levels were standardized to that of glyceraldehyde-3 phosphate dehydrogenase (GAPDH). The relative mRNA expression levels were calculated using the 2(−ΔΔCT) method.

Table 2.

Sequences of primers.

Gene Sense (5’-3’) Anti-sense (5’-3’)
HDAC4 ACTTTCCCGTGTCACTCCTG TCTTCCTTCGTGGCTTTCC
GSK3β AAGCCCAGCCTACTAACAACC CAGCCCCACTGTACTGACTG
GAPDH CTCATGACCACAGTCCATGC TTCAGCTCTGGGATGACTT
Open in a new tab

F: Forward; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GSK3β: Glycogen synthase kinase-3β; HDAC: Histone deacetylase; R: Reverse.

Western blotting

Cells were lysed using 2% sodium dodecyl sulfate (SDS) lysis buffer (50 mmol/L Tris-HCl, pH 7.4, 2 mmol/L EDTA, 2% SDS) supplemented with protease inhibitor cocktail (Calbiochem, La Jolla, CA, USA) and phenylmethanesulfonyl fluoride (PMSF, Sigma). The protein concentration was determined by the bicinchoninic acid method by using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). Proteins (50 μg) were fractionated by SDS-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk in TRIS-buffered saline containing 0.1% Tween 20. Rabbit anti-HDAC4 (1:1000 dilution, Cell Signaling Technology, Danvers, MA, USA), mouse anti-MMP3 (1:2000 dilution, ProteinTech), and rabbit anti-MMP13 (1:500 dilution, ProteinTech) antibodies were used to detect the proteins. The blots were developed using a horseradish peroxidase-conjugated secondary antibody and analyzed using enhanced chemiluminescence detection.

Statistical analysis

All data were expressed as mean ± standard deviation. Statistically significant differences were calculated using the Student's t test in GraphPad Prism software (GraphPad Software, Inc., San Diego, CA, USA). P < 0.05 was considered statistically significant.

Results

HDAC4 was downregulated in chondrocytes and SW1353 cells treated with IL-1β

To study the function of HDAC4 during the progression of OA, a cellular OA model was established by treating primary chondrocytes and SW1353 cells with IL-1β. The levels of HDAC4 and MMP isoforms were analyzed using Western blotting in rat primary TMJ condylar chondrocytes and SW1353 cells treated with IL-1β at different concentrations. As shown in Figure 1, treatment of condylar chondrocytes and SW1353 cells with IL-1β caused a time and dose-dependent downregulation of HDAC4 levels, with a corresponding increase in MMP3 and MMP13 levels.

Figure 1.

Figure 1

Open in a new tab

Regulation of HDAC4 expression by IL-1β in a time and dose-dependent manner. (A) Levels of HDAC4 in CC and SW1353 cells treated with IL-1β at different concentrations. (B) Levels of HDAC4 in the CC and SW1353 cells treated with 10 ng/mL of IL-1β for the indicated time periods. HDAC4 levels were determined using Western blotting. (C) Levels of matrix metalloproteinase (MMP) isoforms (MMP3 and MMP13) in untreated CC and SW1353 cells and in cells treated with 10 ng/ml of IL–1β for 24 h, as determined using Western blotting. HDAC4: Histone deacetylase 4; IL-1β: Interleukin 1 beta; CC: Condylar chondrocytes; SW1353: SW1353 human chondrosarcoma cells.

Knockdown of HDAC4 enhanced IL-1β-induced increases in MMP levels in SW1353 cells

The effects of HDAC4 siRNA were detected using qRT-PCR and Western blotting [Figure 2A]. As shown in Figure 2B, MMP-3 and MMP-13 levels were higher in the si-HDAC4 group than those in the control group. The effect of HDAC4 on IL–1β–induced extracellular matrix degradation in SW1353 cells was then detected. As shown in Figure 2F, MMP-3 and MMP-13 levels were higher in the IL-1β treated group than those in the control group. The protein levels of MMP-3 and MMP-13 significantly increased in the si-HDAC4 group after incubation with IL-1β (10 ng/mL) for 24 h.

Figure 2.

Figure 2

Open in a new tab

Effects of HDAC4 in IL-1β stimulated SW1353 cells. (A) qRT-PCR and Western blotting analyses were used to evaluate the efficiency of HDAC4 knockdown. ∗P < 0.01 compared with si-NC group. (B) SW1353 cells were transfected with si-HDAC4 or si-NC, and the protein levels of MMP3 and MMP-13 were assayed using Western blotting. (C) Relative mRNA expression of HDAC4 after overexpression plasmid transfection. ∗P < 0.01 compared with si-NC group. (D) Protein levels of MMP3 and MMP13 after transfection of the HDAC4 overexpression plasmid were assayed using Western blotting. (E) HDAC4 was overexpressed in SW1353 cells and IL-1β was added and incubated for 24 h. Protein levels of MMP3 and MMP-13 were assayed using Western blotting. (F) SW1353 cells transfected with si-HDAC4 or si-NC were treated with IL-1β for 24 h and the cells were collected for Western blotting analysis of MMP3 and MMP-13 levels. qRT-PCR: Real-time quantitative polymerase chain reaction; si/siRNA: Small interfering RNA; NC: Negative control.

Overexpression of HDAC4 inhibited IL-1β-induced increases in MMP levels in SW1353 cells

To further clarify the hypothesis that HDAC4 participates in IL-1β-mediated induction of MMP3 and MMP13, SW1353 cells were transfected with the HDAC4 overexpression plasmid. As shown in Figure 2D, the levels of MMP3 and MMP13 were downregulated after transfection of the HDAC4 overexpression plasmid. Then HDAC4 was overexpressed in SW1353 cells and IL-1β was added to explore the role of this gene in OA progression. IL-1β significantly upregulated the protein levels of MMP3 and MMP13, whereas pretreatment with HDAC4 overexpression resulted in significant decreases in MMP3 and MMP13 levels [Figure 2E]. Therefore, overexpression of HDAC4 inhibited IL-1β-mediated induction of MMP3 and MMP13, at levels corresponding to transfection efficiency [Figure 2C].

IL-1β activated the WNT3A/β-catenin pathway

We investigated the WNT3A/β-catenin signaling pathway to explore the underlying mechanism of HDAC4. As shown in Figure 3A, treatment of SW1353 cells with IL-1β caused time-dependent upregulation of WNT3A. β-catenin protein levels and their distribution in cells were determined using Western blotting and immunofluorescence staining. Western blotting revealed decreased levels of phosphorylated β-catenin in IL-1β treated cells [Figure 3B]. Immunofluorescence staining revealed that the translocation of β-catenin into the nucleus increased, which was induced by IL-1β stimulation [Figure 3C].

Figure 3.

Figure 3

Open in a new tab

The WNT3A/β-catenin pathway was activated by IL-1β. (A) Levels of WNT3A in the SW1353 cells treated with IL-1β (10 ng/mL) at different times. (B) SW1353 cells were treated with IL-1β (10 ng/mL), and protein levels of β-catenin and phosphorylated β-catenin were assayed using Western blotting. (C) SW1353 cells were treated with IL-1β (10 ng/mL), and the localization of β-catenin was observed using immunofluorescence. WNT3A: WNT family member 3A.

WNT3A downregulated HDAC4 expression in SW1353 cells

To determine the expression patterns of HDAC4 induced by WNT3A, SW1353 cells were treated with purified WNT3A protein for different time periods and at different concentrations. As shown in Figure 4A and 4B, HDAC4 levels were downregulated in a time- and dose-dependent manner; however, the induction of MMP-3 and MMP-13 by WNT3A was significantly upregulated, according to the results of the RT-PCR and Western blotting.

Figure 4.

Figure 4

Open in a new tab

The regulatory mechanism of WNT3A/β-catenin on HDAC4. (A) Levels of HDAC4 in SW1353 cells treated with WNT3A at different concentrations. (B) Levels of HDAC4 in SW1353 cells treated with WNT3A (200 ng/mL) for the indicated time periods. HDAC4 levels were determined using Western blotting. (C) qRT-PCR analyses were used to evaluate the efficiency of GSK3β overexpression. ∗P < 0.01 compared with si-NC group. (D) Protein levels of HDAC4 were assayed using Western blotting after transfection of the GSK3β overexpression plasmid. GSK3β: Glycogen synthase kinase 3 beta.

Glycogen synthase kinase 3 beta (GSK3β) rescued IL-1β-induced downregulation of HDAC4 in SW1353 cells

To investigate and validate the role of WNT/β-catenin signaling in the expression of HDAC4, we transfected SW1353 cells with a GSK3β overexpression vector; GSK3β is a major inhibitory factor involved in the WNT/β-catenin signal pathway. The transfection efficiency was confirmed using qRT-PCR [Figure 4C]. The Western blotting results showed that the levels of HDAC4 were markedly reduced after treatment with IL-1β, but were restored after GSK3β overexpression in SW1353 cells [Figure 4D].

Discussion

A clear understanding of the etiology and molecular pathogenesis of OA is necessary to develop optimal treatments for this disease. Epigenetics has attracted significant research attention in the study of OA pathogenesis and treatment.[33,39] Several HDACs were identified as important regulators of cartilage development and degradation. In a previous study, HDAC4 was shown to repress chondrocyte hypertrophy and endochondral bone formation. Decreased HDAC4 contributed to the pathogenesis of cartilage degeneration.[11] However, high expression of HDAC4 has also been reported in OA chondrocytes, which implicated HDAC4 in promoting the catabolic activity of chondrocytes.[13,15] Conflicting expression patterns of HDAC4 observed in OA chondrocytes could be due to changes in HDAC expression at different stages of OA. However, the exact role of HDAC4 in OA was unclear. In the present study, we aimed to determine the role of HDAC4, a histone deacetylase involved in IL-1β-induced MMPs expression, in OA, and its regulatory mechanism.

IL-1β is a critical mediator of OA progression; therefore, an in vitro OA model was constructed by stimulating rat condylar chondrocytes and SW1353 cells with IL-1β, which caused upregulation of MMP3 and MMP-13 levels. The same expression patterns are observed during OA.[11,40] We found that the HDAC4 level was gradually downregulated after IL-1β treatment in a dose and time-dependent manner, indicating that HDAC4 is associated with cartilage degradation during OA.

MMPs, a family of proteolytic enzymes, are prominently involved in the breakdown of the ECM in OA.[14] Increased MMP expression is closely related to OA progression. MMP-3 and MMP-13 play a crucial role in the progression of OA by degrading components of the ECM, such as type II and type IV collagen. Inhibition of IL–1β–mediated inflammation could be an effective therapeutic strategy for symptomatic relief and structural repair in OA.[32,41] Inhibition of MMP-3 and MMP-13 expression might be related with chondro-protective effects. Clinical trials of the use of MMP inhibitors as a disease-modifying treatment have been unsuccessful because of severe side effects and inefficient MMP inhibition.[42] In the present study, we examined the effects of HDAC4 knockdown and overexpression in IL-1β-induced cells. Knockdown of HDAC4 exerted an enhanced catabolic effect by upregulating MMP-3 and MMP-13 levels. Furthermore, HDAC4 overexpression exerted an anti-catabolic effect by downregulating the levels of MMP-3 and MMP-13 in IL-1β-stimulated cells. Thus, silencing of HDAC4 could cause metabolic imbalance in the ECM and overexpression of HDAC4 could have anti-inflammatory effect in IL-1β-induced cells.

The WNT/β-catenin signaling pathway participates in a series of cellular events, including cell differentiation, proliferation, migration, and cartilage homeostasis. Many studies have shown the important role of WNT/β-catenin signaling in the pathogenesis of OA. In the present study, the relationship between HDAC4 and WNT/β-catenin signaling was investigated. The WNT/β-catenin signaling pathway was activated by stimulation WNT3A, a well-known activator of canonical WNT/β-catenin signaling, which significantly decreased the level of HDAC4. At the same time, cells treated with the WNT3A showed significantly higher levels of MMP-3 and MMP-13, indicating that HDAC4 was associated with the WNT/β-catenin pathway. In addition, the WNT/β–catenin signaling was inhibited by overexpression of GSK3β, which rescued IL-1β-induced downregulation of HDAC4 in SW1353 cells. These data suggested that the effects of HDAC4 in IL-1β-induced MMPs expression were associated with the WNT/β-catenin signaling pathway, indicating that inhibiting the WNT/β-catenin pathway might have an anti-inflammatory effect partially by regulating HDAC4.

In the growth plate, HDAC4 is a negative regulator of chondrocyte hypertrophy23. However, the role of HDAC4 during OA cartilage degeneration and its mechanism is unclear. Our results provided an insight into the role of HDAC4 in an in vitro OA model, and revealed an association of HDAC4 with the WNT/β-catenin signaling pathway. Future studies are necessary to investigate the mechanism of action of HDAC4 on OA-related genes. In addition, the relationship between HDAC4 and other signaling pathways also merits further investigation.

In summary, our results suggest that decreased HDAC4 is at least partially responsible for the upregulation of OA-related genes, such as MMP3 and MMP13, in vitro, and HDAC4 upregulation might downregulate MMP3 and MMP13, indicating that HDAC4 exerts a protective effect on IL-1β-induced ECM degradation and is regulated partially by the WNT3A/β-catenin signaling pathway [Figure 5]. The exact role of HDAC4 in the progression of OA will be confirmed in future animal experiments.

Figure 5.

Figure 5

Open in a new tab

A schematic of involved molecular connections in the TMJOA development. TMJOA: Temporomandibular joint osteoarthritis; IL-1β: Interleukin 1 beta; WNT3A: WNT family member 3A; HDAC4: Histone deacetylase 4; GSK3β: Glycogen synthase kinase 3 beta; MMP: Matrix metalloproteinase.

Funding

This research was granted by the National Natural Science Foundation of China (No. 31671506).

Conflicts of interest

None

Footnotes

How to cite this article: Ning Q, Gan YH, Shi RR, Meng JH. Effects of HDAC4 on IL-1β-induced matrix metalloproteinase expression regulated partially through the WNT3A/β-catenin pathway. Chin Med J 2021;134:963–970. doi: 10.1097/CM9.0000000000001470

References

  • 1.Dubin A. Managing osteoarthritis and other chronic musculoskeletal pain disorders. Med Clin North Am 2016; 100:143–150. doi: 10.1016/j.mcna.2015.08.008. [DOI] [PubMed] [Google Scholar]
  • 2.Ashraf S, Cha BH, Kim JS, Ahn J, Lee SH. Regulation of senescence associated signaling mechanisms in chondrocytes for cartilage tissue regeneration. Osteoarthritis Cartilage 2015; 24:196–205. doi: 10.1016/j.joca.2015.07.008. [DOI] [PubMed] [Google Scholar]
  • 3.Dieppe PA, Lohmander LS. Pathogenesis and management of pain in osteoarthritis. Lancet 2005; 365:965–973. [DOI] [PubMed] [Google Scholar]
  • 4.Aigner T, Mckenna L. Molecular pathology and pathobiology of osteoarthritic cartilage. Cell Mol Life 2002; 59:5–18. doi: 10.1007/s00018-002-8400-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kopp S, Alstergren P, Ernestam S, Nordahl S, Bratt J. Interleukin-1β influences the effect of infliximab on temporomandibular joint pain in rheumatoid arthritis. Scand J Rheumatol 2006; 35:182–188. doi: 10.1080/03009740500483272. [DOI] [PubMed] [Google Scholar]
  • 6.Hashimoto M, Nakasa T, Hikata T, Asahara H. Molecular network of cartilage homeostasis and osteoarthritis. Med Res Rev 2010; 28:464–481. doi: 10.1002/med.20113. [DOI] [PubMed] [Google Scholar]
  • 7.Franco-Trepat E, Guillán-Fresco M, Alonso-Pérez A, Jorge-Mora A, Francisco V, Gualillo O, et al. Visfatin connection: present and future in osteoarthritis and osteoporosis. J Clin Med 2019; 8:1178.doi: 10.3390/jcm8081178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kapoor M, Martel-Pelletier J, Lajeunesse D, Fahmi H, et al. Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol 2011; 7:33–42. doi: 10.1038/nrrheum.2010.196. [DOI] [PubMed] [Google Scholar]
  • 9.Pasternak B, Aspenberg P. Metalloproteinases and their inhibitors—diagnostic and therapeutic opportunities in orthopedics. Acta Orthop 2009; 80:693–703. doi: 10.3109/17453670903448257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chen WP, Xiong Y, Shi YX, Hu PF, Bao JP, Wu LD. Astaxanthin reduces matrix metalloproteinase expression in human chondrocytes. Int Immunopharmacol 2014; 19:174–177. doi: 10.1016/j.intimp.2013.12.007. [DOI] [PubMed] [Google Scholar]
  • 11.Cao K, Wei L, Zhang ZQ, Guo L, Zhang CM, Li YP, et al. Decreased histone deacetylase 4 is associated with human osteoarthritis cartilage degeneration by releasing histone deacetylase 4 inhibition of runt-related transcription factor-2 and increasing osteoarthritis-related genes: a novel mechanism of human osteoarthritis cartilage degeneration. Arthritis Res Ther 2014; 16:491.doi: 10.1186/s13075-014-0491-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Li J, Zhou XD, Yang KH, Fan TD, Chen WP, Jiang LF, et al. Hinokitiol reduces matrix metalloproteinase expression by inhibiting Wnt/(-Catenin signaling in vitro and in vivo. Int Immunopharmacol 2014; 23:85–91. doi: 10.1016/j.intimp.2014.08.012. [DOI] [PubMed] [Google Scholar]
  • 13.Lu JW, Sun Y, Ge QT, Teng HJ, Jiang Q. Histone deacetylase 4 alters cartilage homeostasis in human osteoarthritis. Bmc Musculoskelet Disord 2014; 15:438.doi: 10.1186/1471-2474-15-438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu Q, Zhang X, Dai LH, Hu XQ, Zhu JX, Li L, et al. Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis. Arthritis Rheumatol 2014; 66:969–978. doi: 10.1002/art.38309. [DOI] [PubMed] [Google Scholar]
  • 15.Song J, Jin EH, Kim D, Kim KY, Chun CH, Jin EJ. MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthritis pathogenesis. BBA Clin 2015; 3:79–89. doi: 10.1016/j.bbacli.2014.11.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tsuzaki M, Guyton G, Garrett W, Archambault JM, Herzog W, Almekinders L, et al. IL-1 beta induces COX2, MMP-1, -3 and -13, ADAMTS-4, IL-1 beta and IL-6 in human tendon cells. J Orthop Res 2003; 21:256.doi: 10.1016/S0736-0266(02)00141-9. [DOI] [PubMed] [Google Scholar]
  • 17.Smith GN. The role of collagenolytic matrix metalloproteinases in the loss of articular cartilage in osteoarthritis. Front Bio 2006; 11:3081–3095. doi: 10.2741/2034. [DOI] [PubMed] [Google Scholar]
  • 18.Okada Y, Shinmei M, Tanaka O, Naka K, Nagase H. Localization of matrix metalloproteinase 3 (stromelysin) in osteoarthritic cartilage and synovium. Lab Invest 1992; 66:680–690. [PubMed] [Google Scholar]
  • 19.Nam J, Perera P, Liu J, Rath B, Agarwal S. Sequential alterations in catabolic and anabolic gene expression parallel pathological changes during progression of monoiodoacetate-induced arthritis. PLoS One 2011; 6:e24320.doi: 10.1371/journal.pone.0024320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kirsch T, Swoboda B, Nah HD. Activation of annexin II and V expression, terminal differentiation, mineralization and apoptosis in human osteoarthritic cartilage. Osteoarthritis Cartilage 2000; 8:294–302. doi: 10.1053/joca.1999.0304. [DOI] [PubMed] [Google Scholar]
  • 21.Pfander D, Swoboda B, Kirsch T. Expression of early and late differentiation markers (proliferating cell nuclear antigen, Syndecan-3, Annexin VI, and alkaline phosphatase) by human osteoarthritic chondrocytes. Am J Pathol 2001; 159:1777–1783. doi: 10.1016/S0002-9440(10)63024-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bradley EW, Carpio LR, Van Wijnen AJ, Mcgee-Lawrence ME, Westendorf JJ. Histone deacetylases in bone development and skeletal disorders. Physiol Rev 2015; 95:1359–1381. doi: 10.1152/physrev.00004.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Vega RB, Matsuda K, Oh J, Barbosa AC, Yang X, Meadows E, et al. Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell 2004; 119:555–566. doi: 10.1016/j.cell.2004.10.024. [DOI] [PubMed] [Google Scholar]
  • 24.Wei F, Zhou J, Wei X, Zhang J, Fleming BC, Terek R, et al. Activation of Indian hedgehog promotes chondrocyte hypertrophy and upregulation of MMP-13 in human osteoarthritic cartilage. Osteoarthritis Cartilage 2012; 20:755–763. doi: 10.1016/j.joca.2012.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Usami Y, Gunawardena AT, Iwamoto M, Enomoto-Iwamoto M. Wnt signaling in cartilage development and diseases: lessons from animal studies. Lab Invest 2016; 96:186–196. doi: 10.1038/labinvest.2015.142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yuasa T, Otani T, Koike T, Iwamoto M, Enomoto-Iwamoto M. Wnt/β-catenin signaling stimulates matrix catabolic genes and activity in articular chondrocytes: its possible role in joint degeneration. Lab Invest 2008; 88:264–274. doi: 10.1038/labinvest.3700747. [DOI] [PubMed] [Google Scholar]
  • 27.Zhou Y, Wang T, Hamilton JL, Chen D. Wnt/β-catenin signaling in osteoarthritis and in other forms of arthritis. Curr Rhenmatol Rep 2017; 19:53.doi: 10.1007/s11926-017-0679-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang Y, Huang X, Yuan Y. MicroRNA-410 promotes chondrogenic differentiation of human bone marrow mesenchymal stem cells through down-regulating Wnt3a. Am J Transl Res 2017; 9:136–145. doi: NOT.DOI.28123640. [PMC free article] [PubMed] [Google Scholar]
  • 29.Li K, Zhang Y, Zhang Y, Jiang W, Shen J, Xu S, et al. Tyrosine kinase Fyn promotes osteoarthritis by activating the β-catenin pathway. Ann Rheum Dis 2018; 77:935–943. doi: 10.1136/annrheumdis-2017-212658. [DOI] [PubMed] [Google Scholar]
  • 30.Liu SS, Zhou P, Zhang YQ. Abnormal expression of key genes and proteins in the canonical Wnt/β-catenin pathway of articular cartilage in a rat model of exercise-induced osteoarthritis. Mol Med Rep 2016; 13:1999–2006. doi: 10.3892/mmr.2016.4798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kim M, Lee HC, Tsedensodnom O, Hartley R, Lim YS, Yu E, et al. Functional interaction between Wnt3 and Frizzled-7 leads to activation of the Wnt/beta-catenin signaling pathway in hepatocellular carcinoma cells. J Hepatol 2008; 48:780–791. doi: 10.1016/j.jhep.2007.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Naito S, Takahashi T, Onoda J, Yamauchi A, Kawai T, Kishino J, et al. Development of a neutralizing antibody specific for the active form of matrix metalloproteinase-13. Biochemistry 2012; 51:8877–8884. doi: 10.1021/bi301228d. [DOI] [PubMed] [Google Scholar]
  • 33.Barter MJ, Bui C, Yang DA. Epigenetic mechanisms in cartilage and osteoarthritis: DNA methylation, histone modifications and microRNAs. Osteoarthritis Cartilage 2012; 20:339–349. doi: 10.1016/j.joca.2011.12.012. [DOI] [PubMed] [Google Scholar]
  • 34.Li VS, Ng SS, Boersema PJ, Clevers H, et al. Wnt Signaling through Inhibition of β-Catenin Degradation in an Intact Axin1 Complex. Cell 2012; 149:1245–1256. doi: org/10.1016/j.cell.2012.05.002. [DOI] [PubMed] [Google Scholar]
  • 35.Zhu M, Tang D, Wu Q, Hao S, Chen M, Xie C, et al. Activation of β-catenin signaling in articular chondrocytes leads to osteoarthritis-like phenotype in Adult β-catenin conditional activation mice. J Bone Miner Res 2009; 24:12–21. doi: 10.1359/jbmr.080901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wu J, Huang JF, Qin XX, Hu F, Chen ZF, Zheng Y, et al. Platelet-rich plasma inhibits Wnt/β-catenin signaling in rabbit cartilage cells activated by IL-1β. Int Immunopharmacol 2018; 55:282–289. doi: 10.1016/j.intimp.2017.12.031. [DOI] [PubMed] [Google Scholar]
  • 37.Zhong L, Schivo S, Huang X, Leijten J, Karperien M, Post JN. Nitric oxide mediates crosstalk between interleukin 1β and WNT signaling in primary human chondrocytes by reducing DKK1 and FRZB expression. Int J Mol Sci 2017; 18:2491.doi: 10.3390/ijms18112491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ge XP, Ma XC, Meng JH, Zhang CG, Ma KT, Zhou CY. Role of Wnt-5A in interleukin-1β-induced matrix metalloproteinase expression in rabbit temporomandibular joint condylar chondrocytes. Arthritis Rheum 2009; 60:2714–2722. doi: 10.1002/art.24779. [DOI] [PubMed] [Google Scholar]
  • 39.Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet 2003; 33:245–254. doi: 10.1038/ng1089. [DOI] [PubMed] [Google Scholar]
  • 40.Ying XZ, Chen XW, Cheng SW, Shen Y, Peng L, Xu HZ. Piperine inhibits IL-β induced expression of inflammatory mediators in human osteoarthritis chondrocyte. Int Immunopharmacol 2013; 17:293–299. doi: 10.1016/j.intimp.2013.06.025. [DOI] [PubMed] [Google Scholar]
  • 41.Burrage PS. Matrix metalloproteinases: role in arthritis. Front Bio 2006; 11:529–543. doi: 10.2741/1817. [DOI] [PubMed] [Google Scholar]
  • 42.Blom AB, van der Kraan PM, van den Berg WB. Cytokine targeting in osteoarthritis. Curr Drug Targets 2007; 8:283–292. doi: 10.2174/138945007779940179. [DOI] [PubMed] [Google Scholar]

Articles from Chinese Medical Journal are provided here courtesy of Wolters Kluwer Health

RESOURCES