Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Sep 15.
Published in final edited form as: Toxicol Appl Pharmacol. 2020 Jul 24;403:115158. doi: 10.1016/j.taap.2020.115158

Arsenic trioxide disturbs the LIS1/NDEL1/dynein microtubule dynamic complex by disrupting the CLIP170 zinc finger in head and neck cancer

Lu Gao 1,2,3, Bingye Xue 2, Bin Xiang 1,*, Ke Jian Liu 2,*
PMCID: PMC8080511  NIHMSID: NIHMS1690852  PMID: 32717241

Abstract

Cancer mortality is mainly caused by metastasis, which requires dynamic remodeling of cytoskeletal components such as microtubules. Targeting microtubules presents a promising antimetastatic strategy that could prevent cancer spreading and recurrence. It is known that arsenic trioxide (ATO) is able to inhibit the migration and invasion of solid malignant tumors, but its exact molecular mechanism remains unclear. Here, we report a novel molecular target and antimetastatic mechanism of ATO in head and neck squamous cell carcinoma (HNSCC). We found that cytoplasmic linker protein 170 (CLIP170) was overexpressed in HNSCC tissues and cells compared to normal controls. ATO at non-cytotoxic level (1 μM) inhibited the migration and invasion of HNSCC cells by displacing zinc in the zinc finger motif of CLIP170, which is a key protein that controls microtubule dynamics. The antimetastatic effects of ATO were equivalent to those of siRNA-mediated CLIP170 knockdown. Furthermore, ATO dysregulated microtubule polymerization via the CLIP170/LIS1/NDEL1/dynein signaling pathway in Cal27 cells as a functional consequence of CLIP170 zinc finger disruption. The effect was partially reversed by zinc supplementation. Taken together, these findings reveal that CLIP170 is a novel molecular target of ATO and demonstrate the capability and underlying mechanisms of ATO as a potential antimetastatic agent for HNSCC treatment.

Keywords: Arsenic trioxide, CLIP170, LIS1/NDEL1/dynein microtubule dynamic complex, Metastasis, Head and neck squamous cell carcinoma

Introduction

Head and neck squamous cell carcinoma (HNSCC) is a common cancer worldwide and is associated with poor prognosis and high potential for recurrence, primarily due to a high rate of metastasis (Bhave et al., 2011; Duprez et al., 2017). Tumor metastasis accounts for 90% of cancer-related deaths (Seyfried and Huysentruyt, 2013). Antimetastatic treatments are important for the prevention of tumor metastasis and can also be used to shrink established lesions and prevent potential recurrence, thereby improving overall therapeutic outcomes (Steeg, 2016; Wan et al., 2013). Currently, there is a lack of safe and effective antimetastatic drugs (Weber, 2013).

Cytoplasmic linker protein 170 (CLIP170) is a founding member of the microtubule plus end-tracking protein (+TIP) family and participates in cell migration by mediating the cortical capture of microtubules, which has been implicated in the progression of cancer (Nakano et al., 2010; Suzuki and Takahashi, 2008; Tanenbaum et al., 2006). CLIP170 recruits Lissencephaly-1 (LIS1) to the tips of growing microtubules through its C-terminus zinc finger motifs (Coquelle et al., 2002). LIS1 is a microtubule organizing center-associated protein that regulates nucleokinesis along microtubules by regulating the motor function of dynein (DeSantis et al., 2017). Another component of the LIS1 complex is nuclear distribution element-like 1 (NDEL1), which directly binds to LIS1 and dynein (Yamada et al., 2008; Zylkiewicz et al., 2011). NDEL1 is required for neuronal migration (Hippenmeyer et al., 2010) and targets dynein to the plus end of microtubules through interaction with the LIS1/dynein complex (Yamada et al., 2008). LIS1 and NDEL1 are responsible for dynein transportation to the cell cortex and essential to neuronal positioning and nuclear migration (Shu et al., 2004; Yamada et al., 2008). Therefore, CLIP170 is critical to cell migration and invasion by mediating key protein-protein interactions of LIS1/NDEL1/dynein for microtubule dynamics through its C-terminus zinc finger motifs. To date, there is no treatment strategy related to targeting CLIP170 and the LIS1/NDEL1/dynein complex to induce antimetastatic effects in HNSCC.

Arsenic trioxide (ATO) has been used successfully in the treatment of acute promyelocytic leukemia (APL) (Soignet et al., 1998; Zhu et al., 2002). Potential benefits of ATO treatment have also been observed in a variety of solid malignant tumors (Dilda and Hogg, 2007; Emadi and Gore, 2010). A few experimental studies have demonstrated the potential for ATO to inhibit the invasion and migration of breast and gastric cancer cells (Kim et al., 2018; Zhang et al., 2016), but the specific targets and relevant mechanisms are still unclear. At the currently approved therapeutic dose (0.15 mg/kg), ATO can cause toxic side-effects to patients (Soignet et al., 2001). Moreover, it has been demonstrated that ATO induces a dose-dependent induction of DNA damages and G2/M arrest in cell cycle in human laryngeal carcinoma SQ20B cell line (Trabelsi et al., 2017), suggesting that ATO, at relatively high concentrations, may exert its anti-cancer effects through cell killing or inducing apoptosis. However, it is unclear whether low-dose, non-cytotoxic ATO (1 μM or lower) is able to suppress HNSCC metastasis.

We and other researchers previously reported that trivalent arsenic selectively interacts with zinc fingers containing at least 3 cysteine residues (Zhang et al., 2010; Zhou et al., 2011), causing zinc loss and functional disruption (Ding et al., 2009). For example, DNA repair protein poly (ADP-ribose) polymerase 1 (PARP-1), which contains C3H1 (3 Cys, 1 His) zinc fingers, is a sensitive target of trivalent arsenic at low and noncytotoxic concentrations (Ding et al., 2009, 2017). Arsenic was able to replace zinc and directly bind to cysteine residues in zinc fingers of promyelocytic leukemia protein (PML), resulting in enhanced PML SUMOylation and degradation in APL (Zhang et al., 2010). Interestingly, CLIP170 C-terminus zinc fingers also have a C3H1 configuration (Mishima et al., 2007), suggesting that CLIP170 might be a direct molecular target of arsenic.

Therefore, in the present study, we investigated the expression of CLIP170 in HNSCC tissues and cell lines. Moreover, we examined whether low-dose ATO suppresses microtubule dynamics through disrupting CLIP170 zinc fingers, thereby inhibiting the zinc finger-dependent CLIP170/LIS1 interaction and disrupting the LIS1/NDEL1/dynein complex signaling pathway, suggesting that CLIP170 might be a novel direct target for ATO anticancer therapy and that ATO could be an antimetastatic agent for HNSCC.

Materials and methods

Patient samples

Twenty paraffin-embedded HNSCC tissues and adjacent normal mucosal specimens were obtained from the Second Hospital of Dalian Medical University (Dalian, China) and collected from Jan 2010 to Dec 2014 for histopathological diagnosis. No patients received radiotherapy or chemotherapy. The related clinical information is listed in Table 1. The human study procedure was approved by the Medical Ethics Committee of Dalian Medical University, and written informed consent was provided by each patient.

Table 1.

General Information for HNSCC patient samples

Clinical Characteristic Total cases CLIP170 expression
Low High
HNSCC 20 7 13
Age
≤ 45 7 2 5
>45 13 5 8
Gender
Male 12 5 7
Female 8 2 6
Location
Tongue 8 3 5
Gingiva 6 2 4
Palate 5 1 4
Buccal 1 1 0
Open in a new tab

Immunohistochemistry

The paraffin-embedded (4 μm thickness) tissue sections were dewaxed by xylene and rehydrated in a graded series of alcohol. After antigen retrieval using boiling citrate buffer (Abcam, Cambridge, MA) for 10 min and blocked using 10% nonimmune goat serum (Gibco, Waltham, MA) at room temperature for 30 min, the sections were incubated with monoclonal mouse anti-CLIP170 antibody (1:50 dilution, Abcam) at 4 °C overnight. The sections were then incubated with a streptavidin-horseradish peroxidase-conjugated secondary antibody (1:500 dilution, Abcam) at room temperature for 1 h and were counterstained with hematoxylin. Negative controls were incubated with rabbit IgG in place of the primary antibodies. The area of the brown staining and the integral optical density (IOD) value were measured using the ImageJ 1.42 software. The IOD/area was calculated to obtain the semi-quantitative value of CLIP170 expression in each image.

Cell culture

Cal27 cells (tongue squamous carcinoma) were purchased from American Type Culture Collection (ATCC, Manassas, VA) and maintained in Dulbecco’s modified Eagle’s medium (DMEM, ATCC). Fadu cells (hypopharyngeal squamous carcinoma) were also purchased from ATCC and cultured in Eagle’s Minimum Essential Medium (EMEM, ATCC). SCC25 and SCC15 cells (tongue squamous carcinoma, ATCC) were cultured in a 1:1 mixture of DMEM and Ham’s F12 medium (Thermo Fisher Scientific, Waltham, MA). HaCaT cells (human keratinocytes, ATCC) were cultured in DMEM (ATCC). All cells were maintained in medium containing 10% fetal bovine serum (FBS, Thermo Fisher Scientific) with 100 IU/mL penicillin and 100 μg/mL streptomycin.

PrestoBlue cell viability assay

Cal27 and Fadu cells were incubated with 0 to 4 μM ATO (Sigma-Aldrich, St. Louis., MO) for 6, 12, and 24 h. Cell viability was measured by PrestoBlue reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. The absorption at 570 nm was recorded using a SpectraMAX 190 microplate reader (Molecular Devices, Sunnyvale, CA).

Wound healing assay

Cal27 or Fadu cells (1×106) were seeded into 6-well plates and treated with 0 to 2 μM ATO. When cells grew to 70–80% confluence, a 200 μL pipette tip was used to make a straight scratch as an artificial wound. After incubating for 12 or 24 h, the migrated cancer cells across this straight scratch were observed using a phase microscope and quantitated by ImageJ 1.42 software.

Transwell migration and invasion assays

The migration of cancer cells was detected using a 24-well Transwell chamber (8 μm pore size, Sigma-Aldrich), and the invasion assay was performed in the same chambers-coated with Matrigel (BD Biosciences, Franklin Lakes, NJ) without growth factors or matrix metalloproteinases (MMPs). A total of 1×105 cancer cells incubated with 0.5–2 μM ATO were seeded into the upper chamber. FBS conditioned medium (10%) was placed in the lower chamber. When the cells were incubated for 12 or 24 h, the penetrated cells were stained using crystal violet solution (Sigma-Aldrich) for 10 min at room temperature and observed under a light microscope. Five random visual fields were selected and analyzed by ImageJ 1.42 software.

Cell cycle analysis

1×105 Cal27 cells were exposed to 0.5 – 2 μM ATO for 12 and 24 h. Then cells were fixed in cold 70% ethanol for 60 min at 4 °C, and washed with PBS for three times. After centrifugation at 450 g for 5 min, the cells were resuspended and incubated with 100 μg/ml RNase A and 50 ug/ml propidium iodide (Guava Technologies Inc, San Francisco, CA, USA) for 30 min. The cell cycle was determined by the Flow cytometer (Guava Technologies Inc). The data were analyzed using the FlowJo software (Tree Star, Ashland, Oregon, USA).

Immunoprecipitation and inductively coupled plasma mass spectrometry analyses

Cal27 or Fadu cells (1×107) were treated with 1 μM ATO for 0 to 24 h. Total protein was collected in IP lysis buffer (Thermo Fisher Scientific). Protein concentrations were measured by bicinchoninic acid (BCA) assay (Thermo Fisher Scientific). CLIP170 was immunoprecipitated using a Pierce Classic Magnetic IP/Co-IP Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. After elution, the pH value in the samples was adjusted to 7 using a neutralizing buffer supplied in the kit. Then, arsenic and zinc concentrations in the CLIP170 protein were detected by inductively coupled plasma mass spectrometry (ICP-MS) as previously described (Zhou et al., 2015).

Zinc release assay

Cal27 or Fadu cells (1×107) were treated with 1 μM ATO for 0 to 24 h and harvested in IP lysis buffer (Thermo Fisher Scientific). Zinc finger protein CLIP170 was isolated by immunoprecipitation as described above. The zinc content was determined as previously described (Zhou et al., 2011). Briefly, the pH value in the samples was adjusted to 7 using sodium hydroxide, and the samples were incubated with 10 mM hydrogen peroxide at 4 °C for 1 h to release zinc from the CLIP170 protein. Zinc content was measured by adding 10 μL of 1 mM 4-(2-pyridylazo) resorcinol (Sigma-Aldrich) to 100 μL of protein sample and scanning the spectra at 350 to 520 nm on the SpectraMAX 190 microplate reader. Zinc content was represented and calculated from the absorbance at 493 nm using a standard curve.

Transfection of siRNA

HiPerFect transfection reagent (Qiagen, Hilden, Germany) was used to transfect Cal27 or Fadu cells with siRNA-CLIP170 according to the manufacturer’s protocol. siRNA-CLIP170 sequences are shown in Table 2. Briefly, 12 μL transfection reagent and 60 ng siRNA-CLIP170 were mixed with 100 μL cell culture medium and incubated at room temperature for 10 min. The mixture was added to 2×105 cells per well in a 6-well plate. After incubation for 48 h, the knockdown efficiency of CLIP170 in Cal27 and Fadu cells was tested by Western blot using an anti-CLIP170 antibody (1:1000 dilution, Abcam).

Table 2.

Target sequences of siRNA-CLIP170

Product name Catalog no. Primers sequence 5’-3’
Hs-CLIP170-1 SI04141760 TTACCCGACCTTCAAAGTTAA
Hs-CLIP170-2 SI04175626 ACCAACTGCAATGACGACGAA
Hs-CLIP170-3 SI04221427 AGCGAGTTTGGGTGAATGGAA
Hs-CLIP170-4 SI04345474 AAGCTAATGGCCTGCAGACAA
Open in a new tab

Western blot

Cal27, Fadu, SCC25, SCC15 and HaCaT cells (2×106) were lysed with RIPA cell lysis buffer (Thermo Fisher Scientific) in the presence of Halt Protease and Phosphatase Inhibitor (Thermo Fisher Scientific) on ice, respectively, and the protein content of each cell lysate was assessed using a BCA assay. Next, each sample containing 20 μg of protein was separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. After blocking with 5% nonfat milk at room temperature for 1 h, the membranes were incubated with primary antibodies, including monoclonal mouse anti-CLIP170 (1:1000 dilution, Abcam), polyclonal rabbit anti-LIS1 (1:1000 dilution, Abcam), monoclonal mouse anti-NDEL1 (1:1000 dilution, Thermo Fisher Scientific), monoclonal mouse anti-dynein (1:1000 dilution, Thermo Fisher Scientific) and mouse monoclonal anti-GAPDH (1:1000 dilution, Abcam) at 4 °C overnight. Then, the membranes were incubated with a secondary HRP-conjugated antibody (goat anti-mouse, 1:5000 dilution, Abcam; or goat anti-rabbit, 1:5000 dilution, Abcam) at room temperature for 2 h. Finally, the protein bands on the membranes were visualized by an enhanced chemiluminescence detection kit (Thermo Fisher Scientific) at room temperature for 3 min and were detected using the ProteinSimple FluorChem M system (ProteinSimple, San Francisco, CA). The results were analyzed using ImageJ 1.42 software.

Tubulin polymerization assay

Cal27 cells (2×106) were treated with 1 μM ATO, 5 μM TPEN, or 1 μM ATO plus 5 μM zinc chloride. After incubation for 12 h, cells were lysed by IP lysis buffer (Thermo Fisher Scientific). CLIP170 protein was pulled down by immunoprecipitation. The protein content of CLIP170 was measured by BCA assay. Tubulin polymerization in vitro was performed using a Tubulin Polymerization Assay Biochem Kit (Cytoskeleton, Denver, CO). Briefly, the 96-well plate was warmed at 37 °C for 30 min prior to starting the assay. Twenty microliters of CLIP170 protein (10 μM) was pipetted into the wells of the prewarmed plate and incubated for 2 min at 37 °C. Then, 100 μL (50 μM) tubulin was added to the wells. The plate was immediately placed in the spectrometer at 37 °C. The absorbance was recorded at 340 nm for 2 min for 30 cycles by a SpectraMAX 190 microplate reader (Molecular Devices, Sunnyvale, CA).

Immunofluorescence

Cal27 cells (1×105) were fixed with paraformaldehyde at room temperature for 20 min and triple-washed with PBS for 3 min each time. Cal27 cells were then incubated with 10% nonimmune goat serum at room temperature for 1 h, followed by incubation with primary antibodies: monoclonal mouse anti-CLIP170 (1:100 dilution, Abcam), polyclonal rabbit anti-LIS1 (1:100 dilution, Abcam) and monoclonal rabbit anti-α-tubulin (1:150 dilution, Abcam) at 4 °C overnight. Then, the cells were incubated with secondary anti-mouse antibody of Alexa Fluor 488 (1:400 dilution, Thermo Fisher Scientific) and/or anti-rabbit antibody conjugated with Alexa Fluor 568 (1:400 dilution, Thermo Fisher Scientific) at room temperature for 1 h. Finally, the cell nuclei were labeled by mounting medium with DAPI (Vector Laboratories, Burlingame, CA) and imaged using a Leica TCS SP8 confocal microscope (Leica Microsystems, Buffalo Grove, IL). For evaluation, five random high-power fields were selected, and the threshold was set based on the staining of the negative control. The colocalization of CLIP170/LIS1 or LIS1/α-tubulin was analyzed using the “co-localization analyzer tool” in Leica TCS SP8 software. The expression of α-tubulin was quantified using densitometry (the sum integrated optical density (IOD)/the sum area) and calculated using Image-Pro Plus 7.0 (Media Cybernetics Inc., Rockville, MD).

Statistical analysis

At least three independent experiments were performed. All data were analyzed by GraphPad Prism 6. Differences between three or more groups were evaluated using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison post hoc test. Statistical significance was set at P < 0.05.

Results

CLIP170 was overexpressed in HNSCC

To evaluate whether CLIP170 is essential to HNSCC and could be a candidate target to provide a new treatment strategy for HNSCC, we examined the expression of CLIP170 in 20 HNSCC patient tissues and adjacent normal mucosal tissues (ANMTs) using immunohistochemistry (IHC). CLIP170 was markedly overexpressed in cancer tissues compared to ANMTs (Figure 1A). The majority of the CLIP170-positive staining was located in the cytoplasm and on the cell membrane, which is consistent with the known intracellular distribution of CLIP170 (Akhmanova et al., 2005; Ran et al., 2017). Statistical analysis of the positive staining intensity is shown in Figure 1B. Moreover, we detected the expression level of CLIP170 in 3 tongue squamous carcinoma cell lines and 1 hypopharyngeal squamous carcinoma cell line by Western blot. Consistent with the IHC results, CLIP170 was highly expressed in all cancer cells (Cal27, Fadu, SCC25 and SCC15) compared with normal epithelial cells (HaCat) (Figure 1C and D). Taken together, these findings demonstrate that CLIP170 is highly expressed in HNSCC and may play an important role in the progression and prognosis of HNSCC.

Figure 1. CLIP170 was overexpressed in HNSCC.

Figure 1.

Open in a new tab

(A) Images of CLIP170 immunohistochemical staining are shown from three representative HNSCC tissues and adjacent normal mucosa (NM). Shown in the bottom row are the enlarged images of the dashed region above. Brown color indicates positive stain for CLIP170. (B) Relative positive staining intensity of CLIP170 in NM tissues (n=20) and HNSCC tissues (n=20). The details of patient data were described in Table 1. (C) and (D) The expression level of CLIP170 in normal epithelial cells (HaCaT) and HNSCC cells (Cal27, Fadu, SCC25 and SCC15) was measured by Western blot. **, p<0.01, ***, p<0.001.

ATO inhibited the migration and invasion of HNSCC cells

To establish a minimally cytotoxic concentration of ATO on HNSCC cells, a PrestoBlue cell viability assay was performed in Cal27 and Fadu cells. The results showed that low concentrations of ATO (0.5 μM and 1 μM) had no cytotoxic effect on the cellular viability of Cal27 (Figure S1A) or Fadu (Figure S1B) cells at all time points of 6, 12 and 24 h. However, when the concentration of ATO reached 2 to 4 μM, a significant decrease in cell viability was observed in both cell lines at 24 h, and this decrease occurred in an ATO concentration-dependent manner (Figure S1A and B). These results indicate that ATO at a concentration of 1 μM or less is non-cytotoxic or minimally cytotoxic to HNSCC cells within 24 h.

To evaluate the effects of minimally cytotoxic concentrations of ATO on the migration and invasion of HNSCC cells, wound healing assays and Transwell migration assays were carried out. As shown in Figure 2A and 2B, 1 μM ATO significantly reduced the migration of Cal27 cells after 12 h. Additionally, 1 μM ATO markedly reduced the number of Cal27 cells that passed through the semipermeable membrane of the upper chamber at 12 h and 24 h (Figure 2C and 2D). Moreover, 1 μM ATO significantly suppressed the invasion of Cal27 cells (Figure 2E and 2F). Similarly, the inhibitory effects of minimally cytotoxic concentrations of ATO on migration and invasion were also observed in Fadu cells (Figure S2). Moreover, 1 μM ATO did not affect mitosis in Cal27 cells (Figure 2G). We next conducted Western Blot to detect the protein expression of CLIP170 induced by ATO in Cal27 cells. The results showed that 1 μM ATO did not reduce the protein expression of CLIP170 significantly at 12 h time point, but which was decreased significantly by 1 μM ATO at 24 h time point (Figure 2H and I). The decline of CLIP170 protein expression was in a time-dose dependent manner with ATO treatment in Cal27 cells. Collectively, our findings suggest that minimally cytotoxic concentrations of ATO can suppress the migration and invasion of HNSCC cells.

Figure 2. ATO inhibited the migration and invasion of HNSCC cells.

Figure 2.

Open in a new tab

(A) Cell migration was analyzed by wound healing assay. Cal27 cells were treated by ATO (0 to 2 μM) for 12 and 24 h. Representative microscopic images show wound closure. (B) Statistical summaries of wound closure at 12 h (top panel) and 24 h (bottom panel). (C) Cell migration was further evaluated by transwell assay. Cal27 cells treated with ATO (0 to 2 μM) were plated in the upper chambers of 24-well Transwell plate for 12 or 24 h. Lower chambers contained conditional media. Microscopic images of Cal27 cells penetrated into lower chambers show cell migration. (D) Statistical summaries on relative percentage of migrated cells. (E) Cell invasion was measured by transwell assay in Cal27 cells. Matrigel was coated on upper chambers to analyze cell invasion. (F) Statistical summaries on relative percentage of invaded cells. (G) The effect of ATO on the cell cycle of Cal27 cells. After Cal27 cells were treated with 0.5 – 2 μM ATO for 12 and 24 h, the quantitative data of cell cycle were analyzed by Flow cytometry. ATO (0.5 – 2 μM) did not significantly modify cell cycle of Cal27 cells at both time points. (H) Western Blot and (I) Statistical summaries on the protein expression of CLIP170 induced by ATO in Cal 27 cells. *, p<0.05; and **, p<0.01, compared to the blank control. All experiments were performed in triplicate.

ATO caused zinc finger disruption of CLIP170 in HNSCC cells

To elucidate the molecular mechanism of ATO in the inhibition of the migration and invasion of HNSCC cells and specifically to determine whether the zinc finger protein CLIP170 is a direct molecular target of ATO on antimetastasis, we utilized inductively coupled plasma mass spectrometry (ICP-MS) to examine and quantify arsenic binding and zinc loss at the CLIP170 molecule. We previously reported that trivalent arsenic selectively binds to zinc fingers containing three or more cysteine residues, thus causing zinc release and functional loss of zinc finger proteins (Zhou et al., 2011). CLIP170 contains a C-terminal zinc finger motif with three cysteine residues and is a key protein involved in cytoskeletal function and the migration and invasion of human bone osteosarcoma and cervical cancer cells (Tanenbaum et al., 2006). In the present study, CLIP170 was isolated from cell extracts by immunoprecipitation using an anti-CLIP170 antibody after treatment with 1 μM ATO for 0 to 24 h in Cal27 cells. Subsequently, arsenic and zinc contents were analyzed using ICP-MS. Arsenic binding to CLIP170 reached its peak at 4 h following ATO treatment and remained stable until the end of the time course (Figure 3A). In contrast, the zinc content in CLIP170 declined rapidly without recovery (Figure 3A). Similar results were also observed in Fadu cells (Figure S3A). These results demonstrate that ATO directly interacts with CLIP170 and displaces zinc from the CLIP170 zinc finger motif.

Figure 3. CLIP170 zinc finger was disrupted by ATO in HNSCC cells.

Figure 3.

Open in a new tab

(A) Time course of arsenic and zinc content in CLIP170 protein. Cal27 cells were treated with 1 μM ATO for 0 to 24 h. Then CLIP170 was immunoprecipitated from cell extracts. The contents of arsenic and zinc in CLIP170 protein were thus measured by ICP-MS. (B) Zinc content measurements on CLIP170 after treatment with TPEN (zinc chelator, 5μM), 1 μM ATO, or ATO with zinc supplement (5μM). The colorimetric zinc content assay was performed on CLIP170 immunoprecipitated from Cal27 cells with indicated treatments for 12 h. **, p<0.01; ***, p<0.001. “NT” indicates non-treated cells. All experiments were performed in triplicate.

We further investigated zinc loss from CLIP170 with colorimetric zinc content analysis using the zinc probe 4-(2-pyridylazo) resorcinol. After 1 μM ATO exposure for 12 h, zinc content in CLIP170 was significantly decreased in Cal27 cells (Figure 3B). At minimally cytotoxic concentrations and with short-term treatment (within 12 h), ATO was capable of binding to and replacing zinc from the CLIP170 zinc finger motif at a level equivalent to zinc chelation. When 5 μM zinc was supplemented to the cells in the presence of 1 μM ATO, the zinc content in CLIP170 was fully restored (Figure 3B). The zinc chelator TPEN was used as a positive control for loss of zinc. Similar results were also observed in Fadu cells (Figure S3B). Taken together, our findings reveal that CLIP170 is a direct sensitive protein target of ATO in HNSCC cells.

CLIP170 zinc finger disruption was associated with the inhibition of HNSCC cell migration and invasion induced by ATO

To further confirm that the molecular target of ATO in the inhibition of the migration and invasion of HNSCC cells may be related to the zinc finger disruption of CLIP170, we established CLIP170 knockdowns using small interfering RNAs (siRNAs) targeting human CLIP170 sequences. siRNAs efficiently reduced the expression of CLIP170 in Cal27 and Fadu cells (Figure S4). Utilizing the wound healing assay, we found that siRNA CLIP170 markedly decreased the ability of Cal27 cells to migrate into the wound area (Figure 4A and C). Transwell assays showed that siRNA CLIP170 dramatically reduced the migration (Figure 4B and D) and invasion of Cal27 cells (Figure 4B and E) across the porous membrane. These results demonstrate that CLIP170 is a key factor in regulating the migration and invasion of HNSCC cells. Under the condition of siRNA-mediated CLIP170 knockdown, zinc supplementation was unable to restore the migration and invasion of Cal27 cells (Figure 4A–E). In contrast, without siRNA knockdown of CLIP170, zinc supplementation in Cal27 cells treated with 1 μM ATO significantly restored migration and invasion (Figure 4A–E). Similar findings were also observed in Fadu cells (Figure S5). Collectively, these results suggest that CLIP170 zinc finger disruption was closely associated with the inhibition of ATO-induced migration and invasion in HNSCC cells.

Figure 4. Zinc finger disruption of CLIP170 was associated with the migration and invasion of HNSCC cells induced by ATO.

Figure 4.

Open in a new tab

(A) and (C) The effects of ATO, CLIP170 knockdown, and zinc supplementation on the migration of Cal27 cells were detected by wound healing assay. (B), (D) and (E) The effects of ATO, CLIP170 knockdown, and zinc supplementation on the migration and invasion of Cal27 cells were further measured by transwell assay (as described in figure 2C and E). *, p<0.05; **, p<0.01; ***, p <0.001. All experiments were performed in triplicate.

ATO suppressed formation of the LIS1/NDEL1/dynein complex as a functional consequence of CLIP170 disruption in HNSCC cells

LIS1 contains a N-terminal coiled-coil domain for dimerization and seven tryptophan-aspartic acid repeats, which directly interacts with CLIP170 zinc fingers (Coquelle et al., 2002). LIS1 acts as a microtubule regulatory protein to enhance the migration of nerve cells and directly binds to NDEL1 and dynein to regulate the localization of centrosome proteins and the dynamic balance of microtubules (Cooper, 2013; Moon et al., 2014; Torisawa et al., 2011). In the present study, coimmunoprecipitation was performed to investigate whether CLIP170 disruption by ATO could lead to CLIP170/LIS1 dissociation. After treatments with TPEN, ATO and ATO plus zinc in Cal27 cells, CLIP170 protein was pulled down by immunoprecipitation. LIS1 coimmunoprecipitation (Co-IP) was measured by Western blot. As shown in Figure 5A and B, treatment with 1 μM ATO resulted in the dissociation of CLIP170 and LIS1 to a similar extent as treatment with a zinc chelator (5 μM TPEN). Interestingly, supplementation with 5 μM zinc during ATO treatment significantly restored the LIS1 and CLIP170 interaction (Figure 5A and B). Meanwhile, the expression of CLIP170 was not affected by TPEN, ATO, or zinc supplementation (Figure 5A). The results reveal that ATO-mediated CLIP170/LIS1 dysfunction occurs mainly through a zinc-dependent mechanism. Furthermore, to confirm the effect of ATO on the colocalization of CLIP170/LIS1 in HNSCC, we performed immunofluorescence staining followed by confocal imaging in Cal27 cells. As shown in Figure 5C and D, the colocalization of CLIP170/LIS1 was significantly reduced after treatment with 1 μM ATO, which is similar to the decrease induced by TPEN. Moreover, zinc supplementation significantly restored the colocalization of CLIP170/LIS1 in the presence of ATO (Figure 5C and D). These results further suggest that CLIP170/LIS1 dysfunction induced by ATO may occur in a zinc-dependent manner.

Figure 5. ATO interrupted the interaction of CLIP170 and LIS1 in HNSCC cells.

Figure 5.

Open in a new tab

(A) and (B) LIS1 was significantly reduced by 1 μM ATO along with CLIP 170. Cal27 cells were treated with 5 μM TPEN, 0.5 μM or 1 μM ATO, and 2.5 μM or 5 μM zinc supplement, respectively. Co-immunoprecipitation and immunoblotting were performed to examine the interaction between CLIP170 and LIS1. *, p<0.05; **, p<0.01. The experiments were performed in triplicate. (C) and (D) Representative images for the colocalization of CLIP170 and LIS1 in presence of ATO or/and zinc. Cal27 cells were incubated with 5 μM TPEN, 1 μM ATO, or 5 μM zinc supplement for 12 h, respectively, and were immunofluorescent stained with antibodies of CLIP170 and LIS1, then were observed and detected with a confocal microscope. Random fields (n=10) were obtained from each sample. *, p<0.05; **, p<0.01.

Since the CLIP170-LIS1 complex can regulate microtubule dynamics when bound to NDEL1 and dynein (DeSantis et al., 2017; Torisawa et al., 2011), coimmunoprecipitation was conducted to test the interactions between CLIP170 and NDEL1/dynein induced by ATO. As shown in Figure 6A and B, interactions of both NDEL1 and dynein with CLIP170 were significantly decreased by 1 μM ATO, while zinc supplementation reversed the effect of ATO. The data further suggest that CLIP170 zinc finger disruption by ATO leads to CLIP170 and LIS1/NDEL1/dynein complex dysfunction in HNSCC cells, leading to the inhibition of microtubule dynamics.

Figure 6. ATO disturbed the interaction of CLIP170 and NDEL1/Dynein in HNSCC cells.

Figure 6.

Open in a new tab

(A) Both the expressions of NDEL1 and Dynein were decreased by 1 μM ATO in CLIP170 immunoprecipitation. Co-IP was used to detected the interaction of CLIP170 and NDEL1/Dynein. Cal27 cells were treated with 5 μM TPEN, 0.5 μM or 1 μM ATO and 2.5 μM or 5 μM zinc supplement for 12 h, respectively. Co-immunoprecipitation and immunoblotting were performed to examine the interaction between CLIP170 and NDEL1/Dynein. (B) Densitometry analysis of NDEL1 and Dynein from Co-IP. *, p<0.05; **, p<0.01. The experiments were performed in triplicate.

ATO inhibited microtubule polymerization and dynamics by hindering the interaction of CLIP170/LIS1 in HNSCC cells

To evaluate whether the dissociation of CLIP170/LIS1 induced by ATO could lead to the disorder of microtubule polymerization, we examined the effect of ATO on microtubule assembly. Paclitaxel, as a positive control, was used to promote microtubule assembly. A tubulin polymerization assay was performed in the presence of CLIP170 immunoprecipitated from Cal27 cells after treatment with 1 μM ATO or 1 μM ATO with 5 μM zinc for 12 h. Immunoprecipitated samples (IP-CLIP170) contain CLIP170, LIS1 and other microtubule motor and regulators (NDEL1, dynein) binding to LIS1. Optical absorbance was measured every 2 min at a wavelength of 340 nm. Figure 7A shows representative curves of the in vitro tubulin polymerization assay. IP-CLIP170 indicates the efficiency of microtubule assembly in Figure 7B. ATO (1 μM) significantly reduced the efficiency of IP-CLIP170 in stimulating microtubule assembly, while decreased microtubule polymerization was reversed by zinc supplementation (Figure 7B). The data clearly demonstrate that low concentration of ATO disturbs microtubule polymerization by disrupting the CLIP170 zinc finger.

Figure 7. ATO disordered microtubule polymerization and dynamics via disturbing LIS1/NDEL1/Dynein signal pathway.

Figure 7.

Open in a new tab

(A) The effect of 1 μM ATO on microtubule assembly activity of CLIP170 in Cal27 cells. Purified tubulin was incubated with immunoprecipitated CLIP170 from Cal27 cells treated with 5 μM TPEN, or 1 μM ATO, or 5 μM zinc supplement, respectively. Polymerization of tubulin into microtubules was examined by measuring the absorbance at 340 nm. General tubulin buffer was blank. Paclitaxel was the positive control. “NT” indicates non-treated cells. (B) Statistical summary of maximal OD 340 nm representing tubulin polymerization activity. **, p<0.01; ***, p<0.001. The experiments were performed in triplicate. (C) Representative images of ATO on the colocalization of LIS1 and α-tubulin in Cal27 cells. Cells were grown on the slide glass chamber with or without siRNA-CLIP170. After the cells were treated with 1 μM ATO or 5 μM zinc for 12 h, immunofluorescence was performed with a confocal microscope. Random fields (n=10) were obtained from each sample. (D) Relative density of α-tubulin and (E) Statistical analysis of the colocalization of LIS1 and α-tubulin in Cal27 cells in presence of ATO or zinc for (C). *, p<0.05; **, p<0.01.

Furthermore, the impact of microtubule polymerization by ATO was examined with immunofluorescence analysis. α-Tubulin is a site for posttranslational modification that indicates the luminal surface of microtubules (Eshun-Wilson et al., 2019). In the present study, the localization of α-tubulin was used to evaluate microtubule polymerization. As shown in Figure 7C and D, α-tubulin was significantly reduced by 1 μM ATO in Cal27 cells compared to untreated cells, while the reduction of α-tubulin was partially restored by zinc supplementation. Moreover, the colocalization of LIS1 and α-tubulin was decreased by 1 μM ATO in Cal27 cells but was partially rescued by the addition of zinc (Figure 7C and E). Since the N-terminus of CLIP170 directly links to microtubules and the C-terminus zinc finger of CLIP170 interacts with LIS1, the reduction of α-tubulin and LIS1 colocalization aligned with CLIP170 zinc finger disruption by ATO. To confirm that microtubule dysfunction by ATO was mediated through a zinc-dependent mechanism, we examined the effect of zinc supplementation on the colocalization of α-tubulin and LIS1 in Cal27 cells with siRNA-CLIP170. The localization of α-tubulin was decreased in Cal27 cells transfected with siRNA-CLIP170, an effect that was not restored through zinc supplementation (Figure 7C and D). Furthermore, the colocalization of LIS1 and α-tubulin in Cal27 cells transfected with siRNA-CLIP170 was lower than that in cells transfected with the siRNA-control only (Figure 7C and E). This effect was not reversed by the addition of zinc (Figure 7C and E). Taken together, these results indicate that low concentration of ATO inhibits microtubule polymerization via the CLIP170/LIS1/NDEL1/dynein signaling pathway in Cal27 cells as a functional consequence of CLIP170 zinc finger disruption. These findings reveal a novel molecular mechanism of ATO in the inhibition of HNSCC migration and invasion, which is presented as a schematic diagram in Figure 8.

Figure 8. Schematic illustration on the molecular mechanism of ATO in inhibiting the migration and invasion of HNSCC cell via CLIP170 disruption.

Figure 8.

Open in a new tab

In HNSCC cells, ATO exposure displaces zinc from CLIP170 zinc finger, thus disrupts the interaction of CLIP170 and LIS1, and further inhibits microtubule polymerization and dynamics, ultimately suppresses the migration and invasion of HNSCC.

Discussion

It has been reported that ATO inhibits cell proliferation and migration in the micromolar range (2–5 μM) in HNSCC, and the inhibitory effects of ATO are mainly associated with DNA damage and cell cycle arrest at G2/M (Boyko-Fabian et al., 2014; Trabelsi et al., 2017), but the exact molecular mechanism by which low-dose ATO regulates antimetastatic effects is unclear. Our results presented here, for the first time, clearly demonstrated that ATO dysregulated the CLIP170 zinc finger and inhibited the motility of HNSCC cells at low concentrations. The effectiveness of 1 μM ATO indicated that CLIP170 is a very sensitive target of ATO. Furthermore, dysregulation of CLIP170 by ATO disrupts the formation of LIS1/NDEL1/dynein complex, resulting in the inhibition of microtubule dynamics. Importantly, our findings suggest that CLIP170 is a novel direct target for ATO anticancer therapy.

CLIP170 is a classic microtubule-binding protein that interacts with microtubules through its N-terminal CAP-Gly domains (Mishima et al., 2007). CLIP170 colocalizes with microtubule distal ends, regulates microtubule dynamics and participates in diverse microtubule-associated cellular activities, such as the formation of kinetochore-microtubule attachment during mitosis and directional cell migration (Nakano et al., 2010; Tanenbaum et al., 2006). In addition, it has been reported that CLIP170 regulates lamellipodia formation and cell invasion in invasive human breast cancer cells by modulating the Rac1-CLIP170 complex (Suzuki and Takahashi, 2008); there are few studies on the role of CLIP170 in cancer cells, especially in HNSCC. In the present study, we found that CLIP170 was abundantly expressed in HNSCC, indicating that CLIP170 may play an important role in the progression and prognosis of HNSCC. Furthermore, knockdown of CLIP170 suppressed the migration and invasion of HNSCC cells. These findings demonstrate, for the first time, that CLIP170 is essential to the migration/invasion properties of HNSCC cells, indicating that CLIP170 might be a potential therapeutic target for HNSCC.

Notably, CLIP170 is a zinc finger protein with C3H1 (3 Cys, 1 His) zinc finger motifs (Mishima et al., 2007). Our previous study reported that arsenite can interact selectively with zinc finger motifs containing three or more cysteine residues (Zhou et al., 2011). PARP1 and PML have been established as direct molecular targets of arsenite (Zhang et al., 2010; Zhou et al., 2011), both of which act on DNA damage. Based on the critical role of CLIP170 in microtubule dynamics, we hypothesized that targeting CLIP170 could be an effective antimetastatic strategy in cancer treatment. In the present study, we found that 1 μM ATO displaced zinc from the CLIP170 zinc finger motif without affecting cell viability or even the expression of CLIP170 in HNSCC cells. In contrast, this effect was reversed by zinc supplementation, indicating the zinc-dependent mechanism of ATO inhibition of CLIP170. Furthermore, our results showed that 1 μM ATO significantly inhibited the migration and invasion abilities of HNSCC cells to an extent equivalent to CLIP170 knockdown, and supplementation with zinc rescued the effect of ATO but did not reverse that in CLIP170 knockdown cells. Therefore, these findings reveal that CLIP170 is a direct sensitive protein target of ATO in HNSCC cells and that low concentration of ATO suppresses the migration and invasion of HNSCC cells by interacting with the CLIP170 zinc finger. Rather than genetically, transcriptionally or translationally inhibiting CLIP170, we demonstrate a novel strategy to pharmacologically inhibit CLIP170 by disrupting the CLIP170 zinc finger using ATO. In a clinical setting, pharmacological inhibition of CLIP170 is more feasible than transcriptional or genetic inhibition.

CLIP170 can only play a major role in mediating microtubule dynamics by interacting with LIS1, NDEL1 and dynein (Akhmanova and Steinmetz, 2015; Coquelle et al., 2002; Moon et al., 2014). LIS1 regulates microtubule dynamics by controlling microtubule-associated proteins (NDEL1 and dynein) and promoting polymerization of fibronectin (DeSantis et al., 2017; Huang et al., 2012; Torisawa et al., 2011). LIS1 is involved in metastasis and poor prognosis in lung cancer (Lo et al., 2012). Targeting microtubule dynamics represents a potential therapeutic avenue for cancers. It is known that paclitaxel (an effective anticancer drug commonly used in the clinic) can increase microtubule polymerization and instability to induce mitotic arrest and promote cancer cell death (Schiff et al., 1979; Zheng et al., 2018). However, whether CLIP170 can modulate microtubule bundling and stability through interacting with LIS1, NDEL1 and dynein in the presence of ATO has not been previously established. In the present study, the data showed that 1 μM ATO significantly resulted in the dissociation of CLIP170 and LIS1, disturbed the interaction of CLIP170 and the LIS1/NDEL1/dynein complex, and subsequently disrupted microtubule polymerization and dynamics in HNSCC cells. Moreover, we found that ATO reduced the expression of α-tubulin and the colocalization of α-tubulin and LIS1 to an extent comparable to knockdown of CLIP170. In contrast, zinc supplementation reversed ATO-inhibited microtubule polymerization but not the effect of CLIP170 knockdown. Therefore, our findings strongly suggest that ATO can disturb microtubule dynamics by disrupting CLIP170 and the LIS1/NDEL1/dynein complex in a zinc-dependent mechanism in HNSCC.

Additionally, it has been reported that ATO can induce cell cycle arrest in G2/M phase in some types of cancers, such as lung cancer and renal cancer, at the concentration range of 4–10 μM (Han et al., 2008; Hyun Park et al., 2003; Qu et al., 2009). Inconsistent with these findings, our results showed that there was no significant influence on the cell cycle with 1 μM ATO treatment in Cal27 cells. The 1 μM ATO dose might be too low to induce significant cell cycle arrest in Cal27 cells. The different doses of ATO in different cancer cells may account for the different results. On the other hand, LIS1-NDEL1-dynein complex has been shown to control mitotic spindle organization and organelle positioning (Akhmanova and Steinmetz, 2015; Coquelle et al., 2002; Moon et al., 2014). Knockdown of CLIP170 or LIS1 induced obvious spindle defects and mitotic arrest in human 293 cells (Green et al., 2005). Further investigation is needed to determine whether spindle defects and mitotic arrest could be affected by relatively high concentrations of ATO through the CLIP170/LIS1 signaling pathway. Several studies have demonstrated that EM011 (an antimicrotubule agent) leads to a G2/M arrest and induces apoptosis in T-lymphoid tumors, prostate and non-small cell lung cancer cells (Aneja et al., 2010; Aneja et al., 2006; Karna et al., 2009). Notably, EM011 treatment eliminated CLIP-170’s plus-end association and damaged normal behavior of microtubule plus-ends in HeLa cells (Karna et al., 2011). Moreover, CLIP170 could increase the ability of paclitaxel to induce apoptosis in breast cancer cells (Sun et al., 2012). Therefore, we speculate that the zinc displacement in CLIP170 might be associated with the apoptosis of cancer cells induced by ATO at high dosage. It is worth noting that the dose of 1 μM ATO is 2 magnitudes lower than the dose of Trisenox (an FDA-approved chemotherapy drug for APL) that is used in the clinic (Das, 2017). Therefore, this does of ATO might be noncytotoxic in patients, making it a safe and effective antimetastatic agent for HNSCC or other solid malignant tumors.

In summary, our findings demonstrate that CLIP170 is overexpressed in HNSCC and is required for the migration and invasion of HNSCC cells. Specifically, the data reveal that low-dose ATO can directly displace zinc in the CLIP170 zinc finger, leading to the disruption of the LIS1/NDEL1/dynein complex in HNSCC cells, subsequently resulting in the interruption of microtubule dynamics, thus inhibiting the migration and invasion of HNSCC cells. For the first time, our findings reveal that CLIP170 is a direct molecular target for ATO anticancer therapy and that ATO might be used as a safe, selective, and effective CLIP170 inhibitor to prevent the metastasis of HNSCC or other types of solid malignant tumors.

Supplementary Material

1

Highlights:

  • CLIP170 is overexpressed in head and neck cancer.

  • Arsenic trioxide (ATO) disturbs CLIP170 by disrupting its zinc finger motif.

  • CLIP170 dysfunction by ATO disturbs LIS1/NDEL1/Dynein complex.

  • Non-cytotoxic level of ATO interrupts microtubule polymerization by inhibiting CLIP170 function.

  • CLIP170 is a novel direct target for ATO anticancer effect.

Acknowledgements:

This work was supported by National Natural Science Foundation of China 81771091 (to B. X.) and 81802706 (to L. G.). It was also supported by the National Institutes of Health Grant R01ES029369 and R01CA182969 (to K. J. L).

Footnotes

Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Akhmanova A, Mausset-Bonnefont AL, van Cappellen W, Keijzer N, Hoogenraad CC, Stepanova T, Drabek K, van der Wees J, Mommaas M, Onderwater J, van der Meulen H, Tanenbaum ME, Medema RH, Hoogerbrugge J, Vreeburg J, Uringa EJ, Grootegoed JA, Grosveld F, Galjart N, 2005. The microtubule plus-end-tracking protein CLIP-170 associates with the spermatid manchette and is essential for spermatogenesis. Genes Dev 19, 2501–2515. 10.1101/gad.344505 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akhmanova A, Steinmetz MO, 2015. Control of microtubule organization and dynamics: two ends in the limelight. Nat Rev Mol Cell Biol 16, 711–726. 10.1038/nrm4084 [DOI] [PubMed] [Google Scholar]
  3. Aneja R, Miyagi T, Karna P, Ezell T, Shukla D, Vij Gupta M, Yates C, Chinni SR, Zhau H, Chung LW, Joshi HC, 2010. A novel microtubule-modulating agent induces mitochondrially driven caspase-dependent apoptosis via mitotic checkpoint activation in human prostate cancer cells. Eur J Cancer 46, 1668–1678. 10.1016/j.ejca.2010.02.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aneja R, Zhou J, Vangapandu SN, Zhou B, Chandra R, Joshi HC, 2006. Drug-resistant T-lymphoid tumors undergo apoptosis selectively in response to an antimicrotubule agent, EM011. Blood 107, 2486–2492. 10.1182/blood-2005-08-3516 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bhave SL, Teknos TN, Pan Q, 2011. Molecular parameters of head and neck cancer metastasis. Crit Rev Eukaryot Gene Expr 21, 143–153. 10.1615/critreveukargeneexpr.v21.i2.40 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boyko-Fabian M, Niehr F, Distel L, Budach V, Tinhofer I, 2014. Increased growth-inhibitory and cytotoxic activity of arsenic trioxide in head and neck carcinoma cells with functional p53 deficiency and resistance to EGFR blockade. PLoS One 9, e98867. 10.1371/journal.pone.0098867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cooper JA, 2013. Cell biology in neuroscience: mechanisms of cell migration in the nervous system. J Cell Biol 202, 725–734. 10.1083/jcb.201305021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coquelle FM, Caspi M, Cordelieres FP, Dompierre JP, Dujardin DL, Koifman C, Martin P, Hoogenraad CC, Akhmanova A, Galjart N, De Mey JR, Reiner O, 2002. LIS1, CLIP-170’s key to the dynein/dynactin pathway. Mol Cell Biol 22, 3089–3102. 10.1128/mcb.22.9.3089-3102.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Das M, 2017. Arsenic trioxide consolidation in APL. Lancet Oncol 18, e517. 10.1016/s1470-2045(17)30595-8 [DOI] [PubMed] [Google Scholar]
  10. DeSantis ME, Cianfrocco MA, Htet ZM, Tran PT, Reck-Peterson SL, Leschziner AE, 2017. Lis1 has two opposing modes of regulating cytoplasmic dynein. Cell 170, 1197–1208.e1112. 10.1016/j.cell.2017.08.037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dilda PJ, Hogg PJ, 2007. Arsenical-based cancer drugs. Cancer Treat Rev 33, 542–564. 10.1016/j.ctrv.2007.05.001 [DOI] [PubMed] [Google Scholar]
  12. Ding W, Liu W, Cooper KL, Qin XJ, de Souza Bergo PL, Hudson LG, Liu KJ, 2009. Inhibition of poly (ADP-ribose) polymerase-1 by arsenite interferes with repair of oxidative DNA damage. J Biol Chem 284, 6809–6817. 10.1074/jbc.M805566200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ding X, Zhou X, Cooper KL, Huestis J, Hudson LG, Liu KJ, 2017. Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue. Toxicol Appl Pharmacol 331, 108–115. 10.1016/j.taap.2017.05.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Duprez F, Berwouts D, De Neve W, Bonte K, Boterberg T, Deron P, Huvenne W, Rottey S, Mareel M, 2017. Distant metastases in head and neck cancer. Head Neck 39, 1733–1743. 10.1002/hed.24687 [DOI] [PubMed] [Google Scholar]
  15. Emadi A, Gore SD, 2010. Arsenic trioxide - an old drug rediscovered. Blood Rev 24, 191–199. 10.1016/j.blre.2010.04.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Eshun-Wilson L, Zhang R, Portran D, Nachury MV, Toso DB, Lohr T, Vendruscolo M, Bonomi M, Fraser JS, Nogales E, 2019. Effects of alpha-tubulin acetylation on microtubule structure and stability. Proc Natl Acad Sci U S A 116, 10366–10371. 10.1073/pnas.1900441116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Green RA, Wollman R, Kaplan KB, 2005. APC and EB1 function together in mitosis to regulate spindle dynamics and chromosome alignment. Mol. Biol. Cell 16, 4609–4622. 10.1091/mbc.e05-03-0259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Han YH, Kim SZ, Kim SH, Park WH, 2008. Arsenic trioxide inhibits the growth of Calu-6 cells via inducing a G2 arrest of the cell cycle and apoptosis accompanied with the depletion of GSH. Cancer Lett 270, 40–55. 10.1016/j.canlet.2008.04.041 [DOI] [PubMed] [Google Scholar]
  19. Hippenmeyer S, Youn YH, Moon HM, Miyamichi K, Zong H, Wynshaw-Boris A, Luo L, 2010. Genetic mosaic dissection of Lis1 and Ndel1 in neuronal migration. Neuron 68, 695–709. 10.1016/j.neuron.2010.09.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang J, Roberts AJ, Leschziner AE, Reck-Peterson SL, 2012. Lis1 acts as a “clutch” between the ATPase and microtubule-binding domains of the dynein motor. Cell 150, 975–986. 10.1016/j.cell.2012.07.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hyun Park W, Hee Cho Y, Won Jung C, Oh Park J, Kim K, Hyuck Im Y, Lee MH, Ki Kang W, Park K, 2003. Arsenic trioxide inhibits the growth of A498 renal cell carcinoma cells via cell cycle arrest or apoptosis. Biochem Biophys Res Commun 300, 230–235. 10.1016/s0006-291x(02)02831-0 [DOI] [PubMed] [Google Scholar]
  22. Karna P, Rida PC, Pannu V, Gupta KK, Dalton WB, Joshi H, Yang VW, Zhou J, Aneja R, 2011. A novel microtubule-modulating noscapinoid triggers apoptosis by inducing spindle multipolarity via centrosome amplification and declustering. Cell Death Differ 18, 632–644. 10.1038/cdd.2010.133 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Karna P, Sharp SM, Yates C, Prakash S, Aneja R, 2009. EM011 activates a surviving-dependent apoptotic program in human non-small cell lung cancer cells. Mol Cancer 8, 93. 10.1186/1476-4598-8-93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kim SH, Yoo HS, Joo MK, Kim T, Park JJ, Lee BJ, Chun HJ, Lee SW, Bak YT, 2018. Arsenic trioxide attenuates STAT-3 activity and epithelial-mesenchymal transition through induction of SHP-1 in gastric cancer cells. BMC Cancer 18, 150. 10.1186/s12885-018-4071-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lo FY, Chen HT, Cheng HC, Hsu HS, Wang YC, 2012. Overexpression of PAFAH1B1 is associated with tumor metastasis and poor survival in non-small cell lung cancer. Lung Cancer 77, 585–592. 10.1016/j.lungcan.2012.05.105 [DOI] [PubMed] [Google Scholar]
  26. Mishima M, Maesaki R, Kasa M, Watanabe T, Fukata M, Kaibuchi K, Hakoshima T, 2007. Structural basis for tubulin recognition by cytoplasmic linker protein 170 and its autoinhibition. Proc Natl Acad Sci U S A 104, 10346–10351. 10.1073/pnas.0703876104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Moon HM, Youn YH, Pemble H, Yingling J, Wittmann T, Wynshaw-Boris A, 2014. LIS1 controls mitosis and mitotic spindle organization via the LIS1-NDEL1-dynein complex. Hum Mol Genet 23, 449–466. 10.1093/hmg/ddt436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nakano A, Kato H, Watanabe T, Min KD, Yamazaki S, Asano Y, Seguchi O, Higo S, Shintani Y, Asanuma H, Asakura M, Minamino T, Kaibuchi K, Mochizuki N, Kitakaze M, Takashima S, 2010. AMPK controls the speed of microtubule polymerization and directional cell migration through CLIP-170 phosphorylation. Nat Cell Biol 12, 583–590. 10.1038/ncb2060 [DOI] [PubMed] [Google Scholar]
  29. Qu GP, Xiu QY, Li B, Liu YA, Zhang LZ, 2009. Arsenic trioxide inhibits the growth of human lung cancer cell lines via cell cycle arrest and induction of apoptosis at both normoxia and hypoxia. Toxicol Ind Health 25, 505–515. 10.1177/0748233709345936 [DOI] [PubMed] [Google Scholar]
  30. Ran J, Luo Y, Zhang Y, Yang Y, Chen M, Liu M, Li D, Zhou J, 2017. Phosphorylation of EB1 regulates the recruitment of CLIP-170 and p150glued to the plus ends of astral microtubules. Oncotarget 8, 9858–9867. 10.18632/oncotarget.14222 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schiff PB, Fant J, Horwitz SB, 1979. Promotion of microtubule assembly in vitro by taxol. Nature 277, 665–667. 10.1038/277665a0 [DOI] [PubMed] [Google Scholar]
  32. Seyfried TN, Huysentruyt LC, 2013. On the origin of cancer metastasis. Crit Rev Oncog 18, 43–73. 10.1615/critrevoncog.v18.i1-2.40 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shu T, Ayala R, Nguyen MD, Xie Z, Gleeson JG, Tsai LH, 2004. Ndel1 operates in a common pathway with LIS1 and cytoplasmic dynein to regulate cortical neuronal positioning. Neuron 44, 263–277. 10.1016/j.neuron.2004.09.030 [DOI] [PubMed] [Google Scholar]
  34. Soignet SL, Maslak P, Wang ZG, Jhanwar S, Calleja E, Dardashti LJ, Corso D, DeBlasio A, Gabrilove J, Scheinberg DA, Pandolfi PP, Warrell RP Jr., 1998. Complete remission after treatment of acute promyelocytic leukemia with arsenic trioxide. N Engl J Med 339, 1341–1348. 10.1056/nejm199811053391901 [DOI] [PubMed] [Google Scholar]
  35. Soignet SL, Frankel SR, Douer D, Tallman MS, Kantarjian H, Calleja E, Stone RM, Kalaycio M, Scheinberg DA, Steinherz P, Sievers EL, Coutré S, Dahlberg S, Ellison R, Warrell RP Jr., 2001. United States multicenter study of arsenic trioxide in relapsed acute promyelocytic leukemia. J Clin Oncol 19, 3852–3860. 10.1200/jco.2001.19.18.3852 [DOI] [PubMed] [Google Scholar]
  36. Steeg PS, 2016. Targeting metastasis. Nat Rev Cancer 16, 201–218. 10.1038/nrc.2016.25 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sun X, Li D, Yang Y, Ren Y, Li J, Wang Z, Dong B, Liu M, Zhou J, 2012. Microtubule-binding protein CLIP-170 is a mediator of paclitaxel sensitivity. J Pathol 226, 666–673. 10.1002/path.3026 [DOI] [PubMed] [Google Scholar]
  38. Suzuki K, Takahashi K, 2008. Regulation of lamellipodia formation and cell invasion by CLIP-170 in invasive human breast cancer cells. Biochem Biophys Res Commun 368, 199–204. 10.1016/j.bbrc.2008.01.069 [DOI] [PubMed] [Google Scholar]
  39. Tanenbaum ME, Galjart N, van Vugt MA, Medema RH, 2006. CLIP-170 facilitates the formation of kinetochore-microtubule attachments. Embo j 25, 45–57. 10.1038/sj.emboj.7600916 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Torisawa T, Nakayama A, Furuta K, Yamada M, Hirotsune S, Toyoshima YY, 2011. Functional dissection of LIS1 and NDEL1 towards understanding the molecular mechanisms of cytoplasmic dynein regulation. J Biol Chem 286, 1959–1965. 10.1074/jbc.M110.169847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Trabelsi F, Khlifi R, Goux D, Guillamin M, Hamza-Chaffai A, Sichel F, 2017. Cytotoxicity and genotoxicity effects of arsenic trioxide on SQ20B human laryngeal carcinoma cells. Exp Toxicol Pathol 69, 349–358. 10.1016/j.etp.2017.02.003 [DOI] [PubMed] [Google Scholar]
  42. Wan L, Pantel K, Kang Y, 2013. Tumor metastasis: moving new biological insights into the clinic. Nat Med 19, 1450–1464. 10.1038/nm.3391 [DOI] [PubMed] [Google Scholar]
  43. Weber GF, 2013. Why does cancer therapy lack effective anti-metastasis drugs? Cancer Lett 328, 207–211. 10.1016/j.canlet.2012.09.025 [DOI] [PubMed] [Google Scholar]
  44. Yamada M, Toba S, Yoshida Y, Haratani K, Mori D, Yano Y, Mimori-Kiyosue Y, Nakamura T, Itoh K, Fushiki S, Setou M, Wynshaw-Boris A, Torisawa T, Toyoshima YY, Hirotsune S, 2008. LIS1 and NDEL1 coordinate the plus-end-directed transport of cytoplasmic dynein. Embo j 27, 2471–2483. 10.1038/emboj.2008.182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhang S, Ma C, Pang H, Zeng F, Cheng L, Fang B, Ma J, Shi Y, Hong H, Chen J, Wang Z, Xia J, 2016. Arsenic trioxide suppresses cell growth and migration via inhibition of miR-27a in breast cancer cells. Biochem Biophys Res Commun 469, 55–61. 10.1016/j.bbrc.2015.11.071 [DOI] [PubMed] [Google Scholar]
  46. Zhang XW, Yan XJ, Zhou ZR, Yang FF, Wu ZY, Sun HB, Liang WX, Song AX, Lallemand-Breitenbach V, Jeanne M, Zhang QY, Yang HY, Huang QH, Zhou GB, Tong JH, Zhang Y, Wu JH, Hu HY, de The H, Chen SJ, Chen Z, 2010. Arsenic trioxide controls the fate of the PML-RARalpha oncoprotein by directly binding PML. Science 328, 240–243. 10.1126/science.1183424 [DOI] [PubMed] [Google Scholar]
  47. Zheng Y, Sethi R, Mangala LS, Taylor C, Goldsmith J, Wang M, Masuda K, Karaminejadranjbar M, Mannion D, Miranda F, Herrero-Gonzalez S, Hellner K, Chen F, Alsaadi A, Albukhari A, Fotso DC, Yau C, Jiang D, Pradeep S, Rodriguez-Aguayo C, Lopez-Berestein G, Knapp S, Gray NS, Campo L, Myers KA, Dhar S, Ferguson D, Bast RC Jr., Sood AK, von Delft F, Ahmed AA, 2018. Tuning microtubule dynamics to enhance cancer therapy by modulating FER-mediated CRMP2 phosphorylation. Nat Commun 9, 476. 10.1038/s41467-017-02811-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhou X, Cooper KL, Sun X, Liu KJ, Hudson LG, 2015. Selective sensitization of zinc finger protein oxidation by reactive oxygen species through arsenic binding. J Biol Chem 290, 18361–18369. 10.1074/jbc.M115.663906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhou X, Sun X, Cooper KL, Wang F, Liu KJ, Hudson LG, 2011. Arsenite interacts selectively with zinc finger proteins containing C3H1 or C4 motifs. J Biol Chem 286, 22855–22863. 10.1074/jbc.M111.232926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhu J, Chen Z, Lallemand-Breitenbach V, de The H, 2002. How acute promyelocytic leukaemia revived arsenic. Nat Rev Cancer 2, 705–713. 10.1038/nrc887 [DOI] [PubMed] [Google Scholar]
  51. Zylkiewicz E, Kijanska M, Choi WC, Derewenda U, Derewenda ZS, Stukenberg PT, 2011. The N-terminal coiled-coil of Ndel1 is a regulated scaffold that recruits LIS1 to dynein. J Cell Biol 192, 433–445. 10.1083/jcb.201011142 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1690852-supplement-1.docx (6.9MB, docx)

RESOURCES