Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2021 Apr 29;17(4):e1009515. doi: 10.1371/journal.pgen.1009515

CRISPR gRNA phenotypic screening in zebrafish reveals pro-regenerative genes in spinal cord injury

Marcus Keatinge 1,*,#, Themistoklis M Tsarouchas 1,#, Tahimina Munir 1, Nicola J Porter 1, Juan Larraz 1, Davide Gianni 2, Hui-Hsin Tsai 2, Catherina G Becker 1,, David A Lyons 1,, Thomas Becker 1,‡,*
Editor: Cecilia Moens3
PMCID: PMC8084196  PMID: 33914736

Abstract

Zebrafish exhibit robust regeneration following spinal cord injury, promoted by macrophages that control post-injury inflammation. However, the mechanistic basis of how macrophages regulate regeneration is poorly understood. To address this gap in understanding, we conducted a rapid in vivo phenotypic screen for macrophage-related genes that promote regeneration after spinal injury. We used acute injection of synthetic RNA Oligo CRISPR guide RNAs (sCrRNAs) that were pre-screened for high activity in vivo. Pre-screening of over 350 sCrRNAs allowed us to rapidly identify highly active sCrRNAs (up to half, abbreviated as haCRs) and to effectively target 30 potentially macrophage-related genes. Disruption of 10 of these genes impaired axonal regeneration following spinal cord injury. We selected 5 genes for further analysis and generated stable mutants using haCRs. Four of these mutants (tgfb1a, tgfb3, tnfa, sparc) retained the acute haCR phenotype, validating the approach. Mechanistically, tgfb1a haCR-injected and stable mutant zebrafish fail to resolve post-injury inflammation, indicated by prolonged presence of neutrophils and increased levels of il1b expression. Inhibition of Il-1β rescues the impaired axon regeneration in the tgfb1a mutant. Hence, our rapid and scalable screening approach has identified functional regulators of spinal cord regeneration, but can be applied to any biological function of interest.

Author summary

Nerve connections that are severed in spinal cord injury do not heal, which can lead to permanent paralysis. Lack of repair may in part be due to prolonged inflammation of the injury site. In contrast, zebrafish show excellent repair of nerve connections after spinal injury and this is associated with controlling inflammation. Due to recent advances in genetic technology (CRISPR/Cas9) we can now determine the function of genes that influence regeneration in the living zebrafish in a matter of days. Here we devise a very rapid screening method for the function of inflammation-related genes in zebrafish larvae after spinal cord injury. We find a number of genes that are necessary for repair of nerve connections and control of the inflammation after injury. This provides important leads to improve our understanding of the role of inflammation in spinal cord injury. Moreover, our fast and robust screening method can be adopted by other researchers to screen for gene functions in a whole animal, which was previously not easily possible.

Introduction

Zebrafish, in contrast to mammals, functionally regenerate axonal connections across the injury site after spinal cord injury. Prolonged inflammation is detrimental to recovery from a spinal injury in mammals, but in zebrafish, pro-inflammatory cytokines are rapidly down-regulated and the immune response generally promotes regeneration [1,2]. Specifically, previous work has shown that the presence of blood-derived macrophages is crucial for axonal reconnection in the injured larval spinal cord and recovery from paralysis [3]. These macrophages control the injury site environment by reducing the number of anti-regenerative neutrophils and by mitigating the injury-induced expression of pro-inflammatory cytokines, such as il1b by neutrophils and other cell types. However, the mechanisms and signals by which macrophages keep neutrophils and il1b expression in check during regeneration are largely unknown.

To address these mechanisms, we decided to establish a screening pipeline to test how immune system-related genes might affect spinal cord regeneration in vivo using larval zebrafish [47]. CRISPR-based approaches now allow scalable assessment of gene function in zebrafish, because phenotypes of interest can be observed already in acutely injected, mosaically mutated embryos [815]. This has been exploited for phenotypic screening [9,1618] and improvements in CRISPR/Cas9-based technologies. For example, the use of synthetic RNA Oligo CRISPR guide RNAs (sCrRNAs), has led to the availability of highly efficient gene targeting. However, due to the limited number of sCrRNAs characterised to date, it is unknown whether the rate of highly active sCrRNAs is sufficiently high to use these in phenotypic screening [19,20]. Compensating for that by injecting multiple guides targeting the same gene carries the risk of increasing off-target effects (false-positives) [2123]. Therefore, we reasoned that developing a pipeline that includes pre-screening of guide RNAs in vivo for high activity would allow us to identify and prioritise highly active guides for phenotypic screens. For robust and quick pre-screening, we used a restriction fragment length polymorphism (RFLP)—based approach in which the sCrRNA cas9 cut site overlaps with restriction enzyme recognition sites. This ensures that we retain a high degree of freedom in target selection and scalability of the approach.

Here we demonstrate, by testing 350 sCrRNAs for their efficiency that, although variable, almost half can be classified as being highly active sCrRNAs (haCRs). Pre-screening for haCrs enabled us to effectively target 30 genes of interest for their effect on spinal cord regeneration, and we verified 4 genes as positive regulators of successful regeneration in larval zebrafish. Deleting tgfb1a led to prolonged presence of neutrophils and increased il1b expression, similar to effects of genetic removal of macrophages. Hence, we identify tgfb1a as a signalling molecule that controls inflammation after spinal injury in zebrafish, providing mechanistic understanding of the pro-regenerative role of the immune system in zebrafish. Moreover, we present a rapid sCrRNA design and pre-selection process that will generally facilitate rapid and robust phenotypic screening in vivo.

Results

To establish a phenotypic screening platform to assess the function of candidate genes in regulating the response to spinal cord injury, we set out to determine the general efficiency of sCrRNAs and number of haCRs that need to be co-injected to obtain a sizeable loss-of-function.

sCrRNA activity is variable in vivo

We targeted 350 genomic sites (S1 Table) of genes in the general context of nervous tissue injury or disease and determined their activity towards the targeted sites by injecting sCrRNAs into the zebrafish zygote. To do this efficiently, we targeted recognition sites for restriction enzymes, such that we could use resistance to enzyme digestion in restriction fragment length polymorphism analysis (RFLP) of individual embryos as a proxy for mutagenesis activity at the target site (Fig 1A). Activity was determined by measuring band intensities of undigested and digested bands and calculating their ratio. This ratio, from 0 (no activity) to 1 (complete target mutagenisation) was expressed as percentage efficiency. For example, a ratio of 0.9 was thus expressed as 90% efficiency. We defined as a haCR those with an efficiency of > 90%. We favoured recognition sites for bsl1, xcm1 and bstxi restriction enzymes, because these enzymes contain the necessary PAM sites for CrRNAs in their recognition sequences. Moreover, the recognition sites of these enzymes are also relatively large (>10 nucleotides), consisting of mostly redundant sequences. This makes them sensitive to formation of insertion and deletion mutations (indels) but also resistant to potential single nucleotide polymorphisms. Although we favoured these enzyme sites, any can in theory be used as long as their motif crosses the Cas9 cut site. For example, we also commonly used mwoI, bsrI and bstnI. We used unmodified sCrRNA, because reportedly there are no systematic differences for chemically modified versions [19].

Fig 1. In vivo pre-screening identifies highly active sCrRNAs.

Fig 1

A: Example gels to assess sCrRNA in vivo mutation rate by resistance to restriction enzyme digest (RFLP) are shown. These indicate > 90% mutation rate (top), medium mutation rate (middle) and no detectable mutation rate (bottom). Each lane is derived from one animal. The chart shows the distribution of > 350 sCrRNAs by in vivo mutation rate. B-D: Activities of individual sCrRNAs show weak correlation with predicted in silico efficiency using different prediction rules (see results). E: sCrRNA activities are not correlated with their relative position to the start codon in vivo.

To increase the likelihood that sCrRNAs were function-disrupting, we preferentially targeted the 5’ end of the genes’ coding regions, increasing the chance that frameshift-inducing indels would lead to early stop codons likely to severely disrupt protein translation. In cases in which suitable 5’ target sites were not available, we targeted established functional domains. The subsequent RFLP analysis indicated that 44% of all tested sCrRNAs were haCRs (Fig 1A). Nonetheless, the activity of sCrRNAs is variable, with many of them showing low activity (e.g. 106 of 350 sCrRNAs showed < 50% activity).

We next wanted to determine to what extent guide RNA mutation rate could be successfully predicted by application of established in silico-based rules to increase the haCr detection rate, which would ideally avoid the in vivo testing phase. Using CHOP-CHOP [24], we tested prediction guidelines which assume that GC content, single and dinucleotide identity at each position improves efficiency [25], that cytosine at the -3 position, adenines at -5/-12 and guanines at -14/-17 are favourable for high activity [26], and that guanine enrichment and adenine depletion increases targeting efficiency [27]. Correlation between predictions and actual efficiencies observed in our RFLP-based assays were weak for all of these (R2-values between 0.028–0.044; Fig 1B–1D). Our preference for the 5’ end of the gene did also not bias sCrRNAs for high activity (Fig 1E). Hence, we found that conventional design rules do not strongly predict in vivo mutation rates for sCrRNAs. This indicates the importance of pre-screening guide RNAs in vivo to ensure an adequate mutation rate within injected animals, which the RFLP-based approach allows to be executed rapidly and efficiently.

haCRs efficiently ablate gene function

For phenotypic screening it is important that levels of functional protein are strongly reduced. This may best be achieved by frameshift mutations that can statistically be assumed for almost 66% of all alleles (1–1/3) for injection of one haCR [27]. We aimed to use 2 haCRs per gene, where available, because the total proportion of frameshifts can be estimated to be 89% [1- (1/3 * 1/3)] per allele, so 79% for bi-allelic frameshifts in a cell (0.89 * 0.89). In addition, also in-frame indels may not be tolerated, particularly when known functional domains are targeted. Designing and injecting more than two haCRs could in principle increase the bi-allelic frameshift rate further, but with ever diminishing returns (e.g. 92% of cells for three haCRs compared with 79% for two), and comes at the cost of increasing the possibility of off-target actions.

We used direct sequencing to test the prediction of substantial frameshift activity by using two haCRs (S1A–S1C Fig). The two haCRs targeted sites were placed in close proximity to each other (Cas9 cut sites 79 bp apart) to be able to determine frameshifts in the same sequencing analysis. haCR#1 produced frameshifts in 24 of 33 (72%) clones and haCR#2 in 20 of 33 (60%). When both sites were taken into account simultaneously, the frameshift rate was increased to 87% of the alleles (29/33 clones sequenced) (S1A–S1C Fig), which was close to the theoretical value of 89% for a single allele.

To test whether haCR targeting would produce a substantial reduction in protein function, we targeted hexb, which codes for the lysosomal enzyme and microglial marker hexosaminidase, with two haCRs [28], because a quantifiable enzyme assay was available to us. haCR#1 reduced enzyme activity by 63% and haCR#2 by 80%. Combining the haCRs reduced enzyme activity by 80%, not more than haCR#1 alone (S1D Fig). Hence, one haCR can already lead to strongly reduced protein function.

In summary, we have established that pre-screening of sCrRNA activity is important and can be done using a rapid RFLP-based approach. Using one or two identified haCRs can lead to substantial gene disruption. This informs the decision on striking the right balance between effectiveness of gene targeting and summation of potential off-target effects in any phenotypic screen.

Phenotypic screening

For phenotypic analysis, we focussed on 30 potentially macrophage-related genes. Genes and background information are listed in S2 Table. Based on the above considerations, we decided to limit targeting to maximally two haCRs per gene where available and only used one haCR in cases in which we could target functionally important domains. For duplicated genes (slc2a5, timp2 and lpl), both paralogs were targeted simultaneously with two haCRs each to avoid potential compensation by upregulation of the remaining paralog [29].

As a read-out for an impact of haCR injections on spinal cord regeneration we determined whether haCR-injected larvae showed impaired axon growth across a spinal injury site in a simple assay [3,4], presented in Fig 2A. Using animals with transgenically labelled neurons and their axons (Xla.Tubb:DsRed), we can visualise the spinal cord in side-views. Freshly injured animals and those that do not recover from the injury show a gap in fluorescence along the spinal cord (Fig 2B). At 24 hours post-injury (hpl) 40% and at 48 hpl, about 80% of larvae that have been injured at 72 hours post-fertilization (hpf) show transgenically labelled axons that grow across the injury site to re-connect the spinal cord. While we have shown recovery of swimming capacity in this paradigm by 48 hpl [3,4], full regeneration might take longer, as observed in other larval lesion paradigms [5,30].

Fig 2. Phenotypic screening reveals modifiers of spinal cord regeneration.

Fig 2

A: A schematic representation of the spinal cord regeneration assay. Percentages indicate expected proportions of larvae with an injury site bridged by axons in controls. B: Example images of unlesioned, non-bridged (star indicates gap of neuronal labeling) and bridged spinal cord (white arrow) are shown (lateral views). Scale bar = 50 μm. C: Results of spinal cord regeneration screen for all screened genes at 48 hpl are shown. Significant reductions in bridging, normalised to control lesioned animals, are observed for cst7 (p < 0.0001), sparc (p = 0.04), tgfb1a (p = 0.03), tgfb3 (p = 0.005), tnfa (p < 0.0001), ifngr1 (p = 0.0013,) hspd1 (p = 0.011), tbrg1 (p = 0.0494, serpinb1 (p = 0.0279), and mertk (p = 0.0195); * indicates significance at 48 hpl; # indicates significance at 24 hpl (see S2 Fig); number of larvae per experiment are indicated at the bottom of each bar. For dpm3 no viable larvae could be raised. A single sCrRNA targeting a key functional domain was used to target ctsd, abca7, sparc, clip3, abca1b, tnfa, tgfb1a and tgfb3. Two sCrRNAs were used to target all remaining genes. D: Mutant analysis confirms axonal phenotypes for sparc (p = 0.0189), tgfb1a (p = 0.019), tgfb3 (p = 0.043) and tnfa (p = 0.024), but not for cst7 (p = 0.079) at 48 hpl. The table compares the magnitude of effects between acute injection and in mutants. Fischer’s exact test was used for all analyses.

Determining the percentage of larvae with continuity of axonal labelling across the spinal injury site (called “bridging”) at 24 and 48 hpl is very rapid, a necessity in a screening application. At the same time this previously established scoring method is a sensitive measure to detect changes in the efficiency of axonal regeneration [3,4]. For example, we have shown that our scoring method correlates with more complex measurements, such as the thickness of the axon bridge, and with the degree of recovery of swimming function animals show after injury.

Of the 30 targeted genes, we found 10 ‘hits’ that significantly reduced the proportions of larvae with axon bridging at 48 hpl (Fig 2C). The effect of disrupting one of these genes (tnfa) using acute injection of CRISPR gRNAs has previously been described [3], and thus served as a positive control.

Validation of hit genes

To validate hit genes, we raised stable mutants for four genes of particular interest, tgfb1a, tnfa, sparc, and cst7, because we observed reduced rates of larvae with bridged injury sites at both the early (24 hpl; S2 Fig) and the late time point (48 hpl) of analysis after spinal injury for these. This indicates that these genes may be essential for regeneration from an early time point. We added a fifth hit gene (tgfb3) to the list for mutant validation, to better understand the relative functions of tgfb3 and tgfb1a as anti-inflammatory cytokines (see Material and Methods for mutant generation from haCR-injected larvae).

In all of the stable lines, the induced mutations produced premature stop codons, confirmed by direct sequencing, and therefore were likely to abrogate gene function (S3 Fig). For phenotypic analysis, we outcrossed mutants to wildtype animals and analysed incrosses of these heterozygous animals (F3 generation) to mitigate the risk of carrying forward any potential background or off-target mutations. Proportions of larvae with bridged lesion sites were assessed against wildtype siblings.

With the exception of cst7, all stable mutants showed impaired axon bridging of the spinal lesion site at 48 hpl as predicted from acute studies of haCR-injected animals (Fig 2D). tgfb1a mutants (mutant: 79% larvae with bridged injury site compared to wildtype; acute injection: 73%; Fig 2D) and sparc mutants (Mutant: 71% larvae with bridged injury site compared to wildtype; acute injection: 74%; Fig 2D) showed comparable magnitudes of the bridging phenotype to acute haCR injections. tnfa mutants (72% mutant larvae with bridged injury site compared to wildtype; acute injection: 53%) and tgfb3 mutants (86% mutant larvae with bridged injury site compared to wildtype; acute injection: 68%) showed a somewhat milder phenotype than acutely haCR injected larvae (Fig 2D).

To independently test the importance of Tgf-β signalling for spinal cord regeneration, we used the small molecule inhibitor SB431542 of the transforming growth factor beta receptor 1 (Tgfbr1, formerly known as Alk5), which has previously been validated in zebrafish [31]. This led to a reduction in the frequency of larvae with bridged injury sites to 75.4% of control larvae at 2 dpl (S4 Fig), similar to the reduction seen in tgfb1a and to a lesser extent in tgfb3 mutants. Hence, Tgf-β signalling is necessary for unimpeded axonal regeneration.

Glial processes also bridge the spinal injury site and we wanted to know whether their growth would also be impaired by targeted genes that led to pronounced axonal phenotypes. We assessed glial bridging using immunohistochemistry for the glial fibrillary acidic protein (Gfap) and found that only tgfb3 mutants showed impaired bridging of glial processes, whereas tgfb1a, sparc, and tnfa mutants did not show significant effects on glial bridging (S5 Fig). This suggests differential roles of genes for glial and axonal regrowth.

In summary, we confirmed impaired spinal cord regeneration for four of the five hit genes tested in stable mutants and we confirmed the importance of Tgf-β signalling in two stable mutants and by pharmacological inhibition.

tgfb1a controls post-injury inflammation

We decided to analyse the consequences of targeting tgfb1a and tgfb3 on spinal cord regeneration in more detail, because both are expressed in macrophages in the injury site [3] and may be needed for the function of macrophages in mitigating the inflammatory response after injury. In the absence of macrophages, the initial pro-inflammatory reaction to a lesion, consisting of high numbers of neutrophils and high levels of Il-1β, persists at 48 hpl, whereas in controls both measures sharply drop a few hours after injury. Controlling Il-1β levels is crucial to allow regeneration [3].

To determine whether deficiency in tgfb1a or tgfb3 would lead to a similarly prolonged inflammation, we assessed numbers of neutrophils, macrophages and levels of il1b expression after perturbation of tgfb1a and tgfb3 at 48 hpl. To visualise macrophages in the injury site, we used the mpeg1:GFP transgenic line. We did not find any changes in macrophage numbers after injection of haCRs to tgfb1a or tgfb3 in lesioned animals, compared to lesioned controls (Fig 3A and 3B), indicating that these genes are not necessary for macrophages to populate the injury site.

Fig 3. Loss of tgfb1a leads to prolonged inflammation.

Fig 3

A: Lateral views of lesion sites in larval zebrafish are shown with the indicated markers and experimental conditions at 48 hpl. B-C: Quantifications show that numbers of macrophages were not altered by injecting any of the indicated haCRs (B; one-way ANOVA with Bonferroni’s multiple comparison test; Theoretical power = 0.85 to see a similar increase as for neutrophils in C), neutrophils were increased in number in tgf1b haCRs injected animals (one-way ANOVA with Bonferroni’s multiple comparison test, P = 0.0006), but not in tgfb3 haCRs injected animals (p = 0.32). D: Animals injected with tgfb1a haCRs, but not those injected with tgfb3 haCRs (P = 0.36), displayed marked increases in il1b expression levels in the lesion site compared to lesioned controls at 48 hpl (one-way ANOVA with Bonferroni’s multiple comparison test, P = 0.0211). All transcript levels were normalized to uninjected, unlesioned controls. E-F: tgfb1a heterozygous (one-way ANOVA with Tukey’s multiple comparison test, P = 0.0497) and homozygous mutant animals (P = 0.039) show increased numbers of neutrophils, comparable to haCR-injected animals. G: Inhibition of Il-1β with YVAD rescued axonal bridging compared to the DMSO-treated control group in animals injected with tgfb1a haCRs (Fisher’s exact test * p <0.05, ** p<0.01). Numbers in B, C, F indicate numbers of animals; in D numbers of independent experiments. Error bars represent standard error of the mean (SEM). Scale bars = 50 μm.

To visualise neutrophils, we used an antibody to Mpx in the same animals as above. Injection of tgfb1a haCRs led to a 63% higher count of neutrophils after injury compared to lesioned controls (Fig 3A and 3C). Similarly, counting neutrophils in heterozygous incrosses of tgfb1a mutants indicated a 66% higher number in homozygous mutants. In heterozygous larvae, a 54% higher number was observed, indicating a possible dose effect of gene copy number (Fig 3E and 3F). Higher neutrophil counts are likely a consequence of an impaired ability of macrophages to control neutrophil numbers, e.g. by inducing reverse migration of these [32]. Lesioned animals injected with tgfb3 haCRs showed a trend towards an increase in neutrophil counts of 23% compared to lesioned controls, but this did not reach significance (p > 0.05; Fig 3A and 3C). This is consistent with the observed smaller effects of tgfb3 mutation on axonal regrowth than those of tgfb1b mutation.

To measure levels of il1b expression, we used qRT-PCR on the isolated injured trunk region [3]. This showed a 120% higher level in il1b expression at 48 hpl after injection of tgfb1a sCrRNA, but no effect for tgfb3 (Fig 3A and 3D), compared to control lesioned animals. The continued presence of high numbers of neutrophils and high il1b expression at 48 hpl after tgfb1a targeting indicates prolonged inflammation, shown to inhibit regeneration [3].

To directly test whether increased levels in the tgfb1a mutant are contributing to reduced axon bridging, we inhibited Il-1β signalling in tgfb1a sCrRNA-injected animals using the caspase-1 inhibitor YVAD, as described [3]. This treatment significantly improved the axon bridging phenotype (Fig 3G). Together, this indicates a role of tgfb1a in controlling il1b levels, whereas the contribution of tgfb3 is either very low or it acts through other mechanism to support regeneration.

We also analysed touch-evoked swimming distance in tgfb1a mutants. However, no significant impairment was observed (S6 Fig). This may be explained by a non-linear relationship between relatively modest anatomical recovery already leading to substantial functional recovery after spinal cord injury [33].

In summary, our haCR screen has found several potentially macrophage-related genes to be involved in successful spinal cord regeneration in zebrafish and reveals tgfb1a and tgfb3 as promoting spinal cord regeneration, with tgfb1a, at least in part, doing so by controlling neutrophil numbers and il1b expression.

Discussion

We establish an efficient sCrRNA screening paradigm that involves a pre-screening step to compensate for inherent variability in sCrRNA activity and to identify highly active guides (haCRs) for in vivo phenotypic screens. We used haCRs to target 30 potentially macrophage-associated genes in a spinal cord injury assay and validated four hits through generation of stable mutant lines as playing key roles in successful spinal cord regeneration in zebrafish. We further identified tgfb1a as a regulator of post-injury inflammation, providing a mechanistic basis to understand how inflammation is rapidly resolved to promote recovery.

The immune reaction is essential for spinal cord regeneration

The phenotypes of tgfb1a sCrRNA-injected and mutant animals with an increase in neutrophil numbers and il1b expression levels resembled that of a lack of macrophages [3]. In the macrophage-less irf8 mutant, neutrophils show a slower clearance rate from the injury site after the peak at 2 hours post-lesion, such that their number is still higher relative to wildtype animals at 48 hpl. Likewise, levels of il1b, expressed mainly by neutrophils, peak at 4–6 hours after injury and rapidly decline thereafter, but do so more slowly in the irf8 mutant. Crucially, phenotypes in irf8 mutants can be rescued by inhibiting Il-1β function alone, indicating that a critical macrophage function is control of Il-1β. We could similarly rescue axon bridging in the tgfb1a mutant. As tgfb1a and tgfb3 are typical anti-inflammatory cytokines [34] and are expressed by macrophages in zebrafish [3] and mammals [35] after spinal injury, Tgf-β signalling may thus be a part of the mechanism by which macrophages control Il-1β levels and thereby promote spinal cord regeneration. However, tgfb1a and tgfb3 are also expressed by other cell types [3] and may interact with cell types other than neutrophils, such as astrocytes [36] or the neurons directly [34,37]. Since the interactions of a number of different cell types, such as immune, and neural cell types, but non-neural cells, such as fibroblasts and keratinocytes, are highly complex in the spinal injury site [2], future research will have to dissect influences of Tgf-β signalling on spatio-temporal interactions of these cell types.

Our screen found additional regeneration-relevant genes that we have confirmed in mutants. Tnfa is mainly produced by macrophages in the spinal injury site and has been shown to be necessary for larval spinal cord regeneration using pharmacological inhibition of Tnfa release and acute sCrRNA injection in zebrafish [3]. We confirm these findings here in a stable tnfa mutant.

Sparc is produced by macrophages and organises the collagen matrix [38]. Expression of Sparc by transplanted olfactory ensheathing glia in mammalian spinal cord injury has been shown to be beneficial to regeneration [39]. In zebrafish larvae, regenerating axons grow in close contact with fibrils of extracellular matrix containing growth-promoting ColXII [4]. Hence Sparc protein may contribute to this axon growth promoting matrix in zebrafish. However, sparc has multiple functions, for example in synapse formation [40,41], which will be analysed in future detailed phenotypic analyses of the mutant.

The above suggested mechanisms of hit genes imply indirect actions on axon regrowth by modulating the inflammatory or extracellular matrix environment. However, direct actions on expression of pro-regenerative genes in axotomized neurons is also possible. Future studies, for example using single cell RNAseq analysis, could help to distinguish between these possibilities.

Previous work has suggested that bridges of glial processes across the injury site may form a substrate for axons to cross the injury site in adult zebrafish [42,43]. However, time-lapse observation in larvae has shown that axons often grow independently of glial processes and also cross the injury site when glial processes are ablated [4]. Here we observe that most mutants do not show glial phenotypes and find that the tgfb3 mutant exhibits a strong glial phenotype, but a relatively mild axonal phenotype. This suggests differences in glial and axonal crossing mechanisms of the injury site and that our screen is sensitive to genes that are necessary for axonal regrowth.

Our present screen has already identified some promising candidate genes that will help us to understand the pro-regenerative role of macrophages and potentially other immune cells in zebrafish. Further hits will be confirmed in stable mutants and our screening approach can be scaled up to analyse potential pro-regenerative functions in other cell types that crucially support regeneration, such as fibroblasts [4]. The superb optical accessibility of the larval zebrafish injury model will allow us to follow cell type interactions in space and time to understand the mechanistic contribution of essential genes and cell types to successful spinal cord regeneration in zebrafish.

Pre-screening for activity improves phenotypic screening with sCrRNAs

Finding functional immune system-related genes in successful spinal cord regeneration was possible due to our novel screening paradigm, facilitated by in vivo pre-screening of sCrRNAs for activity. Knowing that sCrRNAs used are highly active in the specific context in which they will be used for phenotypic screening allowed us to reduce the number of sCrRNAs to maximally two pre-determined haCRs per gene, which reduces the risk of off-target effects [21] and false negative results. Although we found phenotypes in our pilot screen using only 1 haCR for certain genes, 2 haCRs might be preferable to achieve a consistent strong reduction in gene function. Furthermore, as haCRs are fairly common (44% of CrRNAs tested), identifying a pair, is not very time consuming. We cannot exclude false negative findings resulting from functional protein still being produced despite premature STOP codons being introduced. However, this is the exception rather than the rule, and generally only occurs when splice sites have been mutated [44]. A two-haCR approach will likely limit false negative findings. It is also important to state that a negative result in the highly targeted read-out for our screening assay does not mean that targeted genes are not important for other immune functions.

Pre-screening has become feasible due to the availability of synthetic CrRNAs, which have a higher likelihood of being highly active than in vitro transcribed sgRNAs and are more versatile in target selection [19,27,45]. However, despite the high rate of haCRs detected, activity of individual sCrRNAs is highly variable and unpredictable. It is unlikely that the enzyme recognition sites chosen for our RFLP-based sCrRNA activity are particularly resistant to CRISPR manipulations, because we used varied enzymes with unrelated sequences, yet variability in activity remained. Nevertheless, other highly efficient methods to determine sCrRNA activity, such as deep sequencing are available [46]. Lack of chemical modification of the RNA oligos is also unlikely to be responsible for variable efficacy according to findings by others [19]. Finally, experimental variations, such as injection location and vehicle composition are unlikely to decisively influence effectiveness of sCrRNAs, as described by others [22] and also reflecting our own experience. Hence, while we cannot exclude that optimisation of experimental protocols could increase haCR frequency, the above considerations suggest sCrRNA activity may be intrinsically variable. Without knowing the complex reasons for these differences, pre-screening presents a viable work-around for screening purposes.

We applied current prediction rules for CrRNA activity to our collection of sCrRNAs and found only weak correlations between predicted activity and the observed in vivo activity of 350 separate guides, which is to our knowledge the largest profiling of in vivo synthetic gRNA activity carried out to date. Although very high somatic activity of specific sCrRNAs has been demonstrated [19], only an unbiased testing of large numbers of sCrNRAs could reveal variability. Therefore, determining CrRNA activity in vivo by pre-screening is hugely advantageous compared to a purely in silico approach. We used RFLP analysis to estimate activity of sCrRNAs, because RFLP is a rapid and relatively inexpensive method. Efficiency of sCrRNAs can be exactly determined using deep sequencing, but this method produces a high amount of raw data that is impractical in a screening approach. Other methods such as T7 endonuclease assays and high-resolution melting analysis could be used, however, these may have difficulty identifying high levels of sCrRNA activity, if indel diversity is minimal or if there is a high level of identical biallelic mutations [47,48]. Our direct sequencing and protein activity assays have shown that our RFLP-based assay is capable of finding differences in sCrRNA activity and is unlikely to skew our activity measurements significantly.

Phenotypic screening of regeneration with haCRs is limited to genes with no essential developmental function. Indeed, we observed excessive mortality when targeting dmt3, probably because of essential developmental roles of the gene [49]. It is likely that we did not observe more instances of non-developing embryos, because we targeted mostly macrophage-related genes and macrophages are not essential for early development [50].

Our screen had a relatively high hit rate of 33%. This was expected, as genes were pre-selected for likely functions in macrophages that play a crucial role in controlling the inflammation in successful spinal cord regeneration in zebrafish [3]. We confirmed a role for the genes in spinal cord regeneration in stable mutants for 4 out of 5 genes (80%). This indicates that the screening paradigm has a relatively low rate of false positive findings. However, even with our 2-guide approach, we encountered a false positive in cst7 and two of the other four mutants showed a weaker phenotype than after acute injection of haCRs. Despite CrRNAs having few predicted off-target effects, we cannot exclude that these exaggerated the phenotype. Sensitivity to off-target effects may also vary depending on design and read-out, which will be revealed in future screens. Overall, this highlights that guide number should be kept to a minimum and that validation of novel phenotypes with stable mutants is advised.

In conclusion, through a CRISPR based phenotypic screen in larval zebrafish, we identify genes that are crucial for successful spinal cord regeneration. A similar approach has recently been proposed for adult zebrafish [51]. We are using a specific injury paradigm as a read-out. However, our sCrRNA approach can be used in a variety of developmental or injury contexts where specific cell types may be transgenically labelled and a simple and robust read-out can be devised or be gleaned from small molecule screens in zebrafish [52]. This could be done in an automated fashion to further increase throughput [53]. Hence, the rapid phenotypic screening approach that uses sCrRNAs of pre-defined high activity in vivo is versatile and can be adapted to any biological context of interest.

Material and methods

Ethics statement

All experiments were reviewed by the Animal Welfare and Ethical Review Body at the University of Edinburgh and approved by the British Home Office (project license no.: 70/8805).

Animal husbandry

All zebrafish lines were kept and raised under standard conditions. The following lines were used: WIK wild type zebrafish [54], Tg(Xla.Tubb:DsRed)zf14826, abbreviated as Xla.Tubb:DsRed [55]; Tg(mpeg1:EGFP)gl22, abbreviated as mpeg1:GFP [56].

Crispr/Cas9 design and injection

All sCrRNAs were designed so a restriction enzyme recognition sequence overlapped the Cas9 cut site. sCrRNAs and TracrRNA were purchased from Merck KGaA (Germany, Darmstadt). Cas9 (M0386M, NEB, Ipswich USA) and all restriction enzymes were purchased from NEB (Ipswich USA). Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at -20°C. RNA oligos were re-suspended to 20 μM with nuclease free water, and stored at -20 until use. For in vivo testing of CrRNA activity, 1 nl of an injection mixture composed of 1 μl of each sCrRNA (up to 4), 1 μl TracrRNA, 1 μl Cas9 and 1 μl Fast Green (Alfa Aesar, Heysham, UK), was injected into the yolk of single cell stage embryos.

Generation of stable mutants

CrRNAs targeting exon 1 were injected into the yolk of one-cell stage embryos. The CrRNA target sites for tgfb1a and tgfb3 were 5’ ATGGCTAAAGAGCCTGAATCCGG and 5’GAATCCATCCAGCAGATCCCTGG, respectively. tnfa was targeted with 5’ ACAAAATAAATGCCATCATCGGG, sparc with 5’ CTAAACCATCACTGCAAGAAGGG and cst7 with two sCrRNAs, 5’TTCTGCAGAGCTCCTGGGATCGG and 5’ TAAAAGAGTAAGTTCCAGTCAGG, to generate a larger deletion. Founders were identified and out crossed to WT (F1), then crossed to WT again to generate the F2 generation. F2 heterozygous individuals were crossed to Xla.Tubb:DsRed or wildtype to generate the F3 generation. All spinal cord lesion assays were performed on an F3 heterozygous incross.

The tgfb1a line was genotyped with primers F 5’ GATTTGGAGGTGGTGAGGAA and R 5’ TCGCTCAGTTCAACAGTGCTAT. The tgfb3 line was genotyped with primers F 5’ GGGTCAGATCCTCAGCAAAC and R 5’ GAGATCCCTGGATCATGTTGA, the sparc line with F 5’ TGCCTAAACCATCACTGCAA and R 5’ ATGCTCGAAGTCTCCGATTG, and the cst7 line with F 5’ TTGTGTGCTCTTTGCTGTCTG and R’ CTGCACCTGTCTCTTTGCAC. The tnfa line was genotyped with primers F 5’ACCAGGCCTTTTCTTCAGGT and R 5’ AGCGGATTGCACTGAAAAGT followed by a bstXI digest.

RFLP analysis

At 24 hpf, DNA from single embryos was extracted using 100 μl of 50 mM NaOH and 10 μl of Tris-HCl pH 8.0 as previously described [57] All RFLP analyses were conducted on DNA of separate individuals and not pooled in order to accurately determine mutation rate. For each CrRNA, RFLP was conducted on 4 uninjected controls and 8 injected individuals. Complete digestion in controls served as indicator of appropriate gel detection sensitivity, enzyme activity, and purity of DNA.

PCR products were generated with BIOMIX red (BIOLINE, London, UK) and 1 μl of the respective restriction enzyme was added directly to the final PCR product for RFLP analysis, without the addition of extra buffers and incubated at the optimal temperature for each respective enzyme. 20 μl of digest were run on 2% agarose gel (BIOLINE, London, UK) and imaged on a trans illuminator. Band intensities were calculated using imageJ (http://imagej.nih.gov/ij).

Allele sequencing

PCR products from 8 injected embryos (24 hpf) were pooled and ligated into a StrataClone vector and transformed into competent cells, following the manufacturer’s instructions (Agilent, Santa Clara, USA). Positive colonies were identified and sequenced using M13 primers.

Hexb activity assay

Hexb activity was determined as previously described [58]. Briefly, 3 dpf embryos, 20 per clutch, 3 independent clutches, were homogenised in 100 μl of nuclease free water. Each sample was diluted 1/10 with McIlvaine citrate–phosphate buffer pH 4.5 and activity assayed with 4-methylumbelliferyl-2-acetamido- 2-deoxy-β-D-gluco-pyranoside (Sigma, Dorset, UK) in a plate reader.

Immunohistochemistry on whole-mount larvae

All incubations were performed at room temperature unless stated otherwise. At the time point of interest, larvae were fixed in 4% PFA-PBS containing 1% DMSO at 4°C overnight. After washes in PBS, larvae were washed in PBTx. After permeabilization by incubation in PBS containing 2 mg/ml Collagenase (Sigma) for 25 min larvae were washed in PBTx. They were then incubated in blocking buffer for 2 h and incubated with primary antibody (anti-MPX, GeneTex GTX128379, Irvine, California, USA) diluted in blocking buffer at 4°C overnight. On the following day, larvae were washed 3 x in PBTx, followed by incubation with secondary antibody diluted in blocking buffer at 4°C overnight. The next day, larvae were washed three times in PBTx and once in PBS for 15 min each, before mounting in 70% glycerol.

For whole mount immunostaining of acetylated tubulin (Sigma T6793) and GFAP (Dako Z0334) to visualise the axons and the glial processes, respectively, larvae were fixed in 4% PFA for 1 h and then were dehydrated in 25% 50%, 75% MeOH in 0.1% Tween in PBS, transferred to 100% MeOH and then stored at -20°C overnight. The next day, head and tail were removed, and the samples were incubated in pre-chilled 100% acetone at -20°C for 10 min. Thereafter, larvae were washed and digested with Proteinase K (10 μg/ml) for 15 min at room temperature and re-fixed in 4% PFA. After washes, the larvae were incubated with 4% BSA in PBTx for 1 h. Subsequently, the larvae were incubated over two nights with primary antibodies (anti-acetylated tubulin, anti-GFAP). After washes and incubation with the secondary antibody, the samples were washed in PBS for 15 min each, before mounting in glycerol.

Spinal cord injury

At 3 dpf, zebrafish larvae were anaesthetised in PBS containing 0.02% aminobenzoic-acid-ethyl methyl-ester (MS222, Sigma), as described [3]. Larvae were transferred to an agarose-coated petri dish. Following removal of excess water, the larvae were placed in a lateral position, and the tip of a sharp 30.5 G syringe needle (BD Microlance) was used to inflict a stab injury or a dorsal incision on the dorsal part of the trunk at the level of the 15th myotome, leaving the notochord intact.

Compound incubation

SB431542 (Abcam, ab120163) was dissolved in DMSO to a stock concentration of 100 mM and added to the larvae as indicated at a final concentration of 50 μM. The final concentration of DMSO was 1% and the same concentration of DMSO was added to the controls. Larvae were pre-treated for 2 hours before the injury and were incubated with the drug for 48 hours.

Ac-YVAD-cmk (YVAD) (Sigma, SML0429) was dissolved in DMSO to a stock concentration of 10 mM. The working concentration was 50 μM prepared by dilution from the stock solution in fish water. Larvae were pre-treated for 2 h before the injury and were incubated with the drug for 48 hpl as previously described [3]. Axonal and glial bridging was assessed blinded to the experimental condition on three independent clutches of larvae.

Behavioural analysis

Behavioural analysis was performed as previously described [59]. Lesioned larvae were touched caudal to the lesion site using a glass capillary. The swim distance of their escape response was recorded for 15 s after touch and analyzed using a Noldus behaviour analysis setup (EthoVision version 7). Data given is averaged from triplicate measures per fish. Between repeated measures, the larvae were left to recover for 30 sec. The observer was blinded to the treatment during the behavioural assay.

Assessment of axonal and glial phenotypes

Re-established axonal connections and glial connections (“bridges”) were scored at the time point of interest in fixed immunolabelled samples (for axonal and glial bridges) and live transgenic animals (for axonal bridges). Larvae were directly visually evaluated using a fluorescent stereomicroscope (Leica M165 FC) or confocal imaging (Zeiss LSM 710, 880). Larvae were scored as described [3] with the observer blinded to the experimental condition. Briefly, a larva was scored as having a bridged lesion site when continuity of the axonal labeling between the rostral and caudal part of the spinal cord was observed. The same criterion was used for the assessment of the glial bridges. Continuity of labeling was defined as at least one fascicle being continuous between rostral and caudal spinal cord ends, irrespective of the fascicle thickness. Larvae in which the lesion site was obscured by melanocytes or the notochord was inadvertently injured were excluded from the analysis.

Quantitative RT-PCR

Reverse transcription of 500 ng RNA was performed with the iSCRIPT kit (BIORAD, Hercules, USA). Standard RT-PCR was performed using 10 mM of each dNTP and each primer. qRT-PCR was performed at 58°C using Roche Light Cycler 96 and relative mRNA levels determined using the Roche Light Cycler 96 SW1 software. Samples were run in duplicates and expression levels were normalized to a β-actin control. Primers were designed to span an exon–exon junction using the Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) software.

Assessment of immune cell numbers

A volume of interest was defined centered on the lesion site from confocal images. The dimensions were: width = 200 μm, height = 75 μm (above the notochord), depth = 50 μm. Images were analysed using the Imaris (Bitplane, Belfast, UK) or the ImageJ software. The number of cells was quantified manually in 3D view, on at least three independent clutches of larvae, blinded to the experimental condition.

Experimental design and statistical analysis

No formal randomization method was used. All mutant analyses were performed on incrosses of heterozygous animals without prior knowledge of genotype. For all experiments and analyses the experimenter was blinded to the experimental condition. Image analysis was performed using ImageJ. Power analysis using G*Power (Faul et al. 2009), was used to calculate power (aim > 0.8) for the experiments and determine the group sizes accordingly. Statistical power was > 0.8 for all experiments. All quantitative data were tested for normality and analyzed with parametric and non-parametric tests as appropriate. The statistical analysis was performed using IBM SPSS Statistics 23.0. Shapiro-Wilk’s W-test was used in order to assess the normality of the data. Kruskal-Wallis test followed by Dunn’s multiple comparisons, One-way ANOVA followed by Bonferroni multiple comparisons test, two-way ANOVA, followed by Bonferroni multiple comparisons, t-test, Mann–Whitney U test or Fischer’s exact test were used, as indicated in the figure legends. *P< 0.05, **P< 0.01, ***P< 0.001, n.s. indicates no significance. Error bars indicate the standard error of the mean (SEM). The figures were prepared with Adobe Photoshop CC and Adobe Illustrator CC. Graphs were generated using GraphPad Prism 7.

Supporting information

S1 Fig. Injecting two haCRs simultaneously effectively disrupts gene function.

A-C: Direct sequencing of mutant alleles in embryos injected with two haCRs per gene demonstrates induction of frameshift frequencies of 72% (A; haCr #1) and 60% (B; haCR #2), when either sCrRNA is analysed individually. This rises to 87% when frame-shift frequencies are combined (C). D: At the protein level, dual haCR injection against hexb reduces enzyme activity by 80% in vivo (ANOVA with Tukey post-test; p < 0.0001). Single haCRs also reduce enzyme activity (p < 0.0001 for both). haCR#2 is more efficient than haCR#1 (p = 0.0051). Error bars represent SEM.

(TIF)

S2 Fig. Inhibition of axon bridging is observed for some of the selected genes at 24 hpl.

Significant reductions in bridging were detected after acute injection of haCRs for sparc (p = 0.0424), tnfa (p = 0.0068), tgfb1a (p = 0.0225) and cst7 (p = 0.0418). Fisher’s Exact test, p<0.05.

(TIF)

S3 Fig. Mutations likely lead to non-functional protein.

Deletions are shown in red and insertions are shown in blue. All stable mutations produce frameshifts (cst7, tnfa, tgfb1a and sparc) and premature stop codons, with the exception of the mutation in the tgfb3 gene. The latter contains an in-frame indel in which the large quantity of inserted material contains a nonsense mutation.

(TIF)

S4 Fig. Inhibiting Tgf signalling with SB31442 impairs axonal bridging.

Experimental timeline, lateral views of embryos and quantification are shown. Fisher’s Exact test, p<0.05. The white arrow indicates the axonal bridge. Scale bar 50 μm.

(TIF)

S5 Fig. Glial bridging is impaired in the tgfb3 mutant.

Lateral views of whole-mounted larvae at 5 dpf are shown; rostral is left, dorsal is up. A: Gfap immunohistochemistry shows longitudinal processes over the injury site (centred in right column) for wildtype (WT), sparc, tnfa, and tgfb1a mutants, but not for tgfb3 mutants at 48 hours post-injury (hpf). B: Quantification of the phenotypes shows a significant reduction in the proportion of larvae with glial bridging only for tgfb3 mutants (Fisher’s Exact test).

(TIF)

S6 Fig. Functional recovery is not significantly impaired in the tgfb1a mutant.

No change is observed in the distance that tgfb1a mutants swim after a touch evoked stimulus (Unpaired t test, p = 0.2590).

(TIF)

S1 Table. List of sCRNAs.

This is a list all sCrRNAs used in this study and their efficiencies as determined by RFLP.

(XLSX)

S2 Table. Genes used in spinal cord injury screen.

This is a list of genes that are used in the spinal cord injury in vivo screen, also containing information on expression and regulation after injury.

(XLSX)

Acknowledgments

We thank Viviane Schulz for help with some experiments.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by a Wellcome Trust (https://wellcome.org/) Senior Research Fellowship (102836/Z/13/Z) to DAL and by Biogen (https://www.biogen.com/en_us/home.html) who provided funding via a scientific research agreement with DAL. Work in the Becker group is funded by the Era-Net Neuron Cofund consortium NEURONICHE (https://www.neuron-eranet.eu/) administered by the MRC (https://mrc.ukri.org/) under grant number MR/R001049/1 with contributions from MRC, Spinal Research (https://spinal-research.org/) and Wings for Life (https://www.wingsforlife.com) to CGB, as well as project grants from the BBSRC (https://bbsrc.ukri.org/) to TB (BB/R003742/1) and EPSRC (https://epsrc.ukri.org/) to CGB (EP/S010289/1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Greenhalgh AD, David S, Bennett FC. Immune cell regulation of glia during CNS injury and disease. Nat Rev Neurosci. 2020;21(3):139–52. Epub 2020/02/12. 10.1038/s41583-020-0263-9 . [DOI] [PubMed] [Google Scholar]
  • 2.Becker T, Becker CG. Dynamic cell interactions allow spinal cord regeneration in zebrafish. Curr Opin Physiol. 2020; 10.1016/j.cophys.2020.01.009. [DOI] [Google Scholar]
  • 3.Tsarouchas TM, Wehner D, Cavone L, Munir T, Keatinge M, Lambertus M, et al. Dynamic control of proinflammatory cytokines Il-1beta and Tnf-alpha by macrophages in zebrafish spinal cord regeneration. Nat Commun. 2018;9(1):4670. Epub 2018/11/09. 10.1038/s41467-018-07036-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wehner D, Tsarouchas TM, Michael A, Haase C, Weidinger G, Reimer MM, et al. Wnt signaling controls pro-regenerative Collagen XII in functional spinal cord regeneration in zebrafish. Nat Commun. 2017;8(1):126. Epub 2017/07/27. 10.1038/s41467-017-00143-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chapela D, Sousa S, Martins I, Cristovao AM, Pinto P, Corte-Real S, et al. A zebrafish drug screening platform boosts the discovery of novel therapeutics for spinal cord injury in mammals. Sci Rep. 2019;9(1):10475. Epub 2019/07/22. 10.1038/s41598-019-47006-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Briona LK, Dorsky RI. Radial glial progenitors repair the zebrafish spinal cord following transection. Exp Neurol. 2014;256:81–92. Epub 2014/04/12. 10.1016/j.expneurol.2014.03.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tsata V, Möllmert S, Schweitzer C, Kolb J, Möckel C, Böhm B, et al. A switch in pdgfrb(+) cell-derived ECM composition prevents inhibitory scarring and promotes axon regeneration in the zebrafish spinal cord. Dev Cell. 2021;56(4):509–24.e9. Epub 2021/01/08. 10.1016/j.devcel.2020.12.009 . [DOI] [PubMed] [Google Scholar]
  • 8.Jao LE, Wente SR, Chen W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013;110(34):13904–9. Epub 2013/08/07. 10.1073/pnas.1308335110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kuil LE, Oosterhof N, Geurts SN, van der Linde HC, Meijering E, van Ham TJ. Reverse genetic screen reveals that Il34 facilitates yolk sac macrophage distribution and seeding of the brain. Dis Model Mech. 2019;12(3). Epub 2019/02/16. 10.1242/dmm.037762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Shah AN, Davey CF, Whitebirch AC, Miller AC, Moens CB. Rapid reverse genetic screening using CRISPR in zebrafish. Nat Methods. 2015;12(6):535–40. Epub 2015/04/14. 10.1038/nmeth.3360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hu R, Huang W, Liu J, Jin M, Wu Y, Li J, et al. Mutagenesis of putative ciliary genes with the CRISPR/Cas9 system in zebrafish identifies genes required for retinal development. FASEB J. 2019;33(4):5248–56. Epub 2019/01/10. 10.1096/fj.201802140R . [DOI] [PubMed] [Google Scholar]
  • 12.Pei W, Xu L, Huang SC, Pettie K, Idol J, Rissone A, et al. Guided genetic screen to identify genes essential in the regeneration of hair cells and other tissues. NPJ Regen Med. 2018;3:11. Epub 2018/06/07. 10.1038/s41536-018-0050-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Burger A, Lindsay H, Felker A, Hess C, Anders C, Chiavacci E, et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 2016;143(11):2025–37. Epub 2016/05/01. 10.1242/dev.134809 . [DOI] [PubMed] [Google Scholar]
  • 14.Charlton-Perkins M, Almeida AD, MacDonald RB, Harris WA. Genetic control of cellular morphogenesis in Müller glia. Glia. 2019;67(7):1401–11. Epub 2019/03/30. 10.1002/glia.23615 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kroll F, Powell GT, Ghosh M, Gestri G, Antinucci P, Hearn TJ, et al. A simple and effective F0 knockout method for rapid screening of behaviour and other complex phenotypes. eLife. 2021;10. Epub 2021/01/09. 10.7554/eLife.59683 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shankaran SS, Dahlem TJ, Bisgrove BW, Yost HJ, Tristani-Firouzi M. CRISPR/Cas9-Directed Gene Editing for the Generation of Loss-of-Function Mutants in High-Throughput Zebrafish F(0) Screens. Curr Protoc Mol Biol. 2017;119:31.9.1-.9.22. Epub 2017/07/06. 10.1002/cpmb.42 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Trubiroha A, Gillotay P, Giusti N, Gacquer D, Libert F, Lefort A, et al. A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function. Sci Rep. 2018;8(1):5647. Epub 2018/04/06. 10.1038/s41598-018-24036-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jobst-Schwan T, Schmidt JM, Schneider R, Hoogstraten CA, Ullmann JFP, Schapiro D, et al. Acute multi-sgRNA knockdown of KEOPS complex genes reproduces the microcephaly phenotype of the stable knockout zebrafish model. PLoS One. 2018;13(1):e0191503. Epub 2018/01/19. 10.1371/journal.pone.0191503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hoshijima K, Jurynec MJ, Klatt Shaw D, Jacobi AM, Behlke MA, Grunwald DJ. Highly Efficient CRISPR-Cas9-Based Methods for Generating Deletion Mutations and F0 Embryos that Lack Gene Function in Zebrafish. Dev Cell. 2019;51(5):645–57.e4. Epub 2019/11/12. 10.1016/j.devcel.2019.10.004 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kotani H, Taimatsu K, Ohga R, Ota S, Kawahara A. Efficient Multiple Genome Modifications Induced by the crRNAs, tracrRNA and Cas9 Protein Complex in Zebrafish. PLoS One. 2015;10(5):e0128319. Epub 2015/05/27. 10.1371/journal.pone.0128319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tsai SQ, Zheng Z, Nguyen NT, Liebers M, Topkar VV, Thapar V, et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol. 2015;33(2):187–97. Epub 2014/12/17. 10.1038/nbt.3117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Dev Cell. 2018;46(1):112–25.e4. Epub 2018/07/06. 10.1016/j.devcel.2018.06.003 . [DOI] [PubMed] [Google Scholar]
  • 23.Shah AN, Davey CF, Whitebirch AC, Miller AC, Moens CB. Rapid Reverse Genetic Screening Using CRISPR in Zebrafish. Zebrafish. 2016;13(2):152–3. Epub 2015/07/15. 10.1089/zeb.2015.29000.sha [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Labun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 2019;47(W1):W171–w4. Epub 2019/05/21. 10.1093/nar/gkz365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016;34(2):184–91. Epub 2016/01/19. 10.1038/nbt.3437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Xu H, Xiao T, Chen CH, Li W, Meyer CA, Wu Q, et al. Sequence determinants of improved CRISPR sgRNA design. Genome Res. 2015;25(8):1147–57. Epub 2015/06/13. 10.1101/gr.191452.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Moreno-Mateos MA, Vejnar CE, Beaudoin JD, Fernandez JP, Mis EK, Khokha MK, et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods. 2015;12(10):982–8. Epub 2015/09/01. 10.1038/nmeth.3543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hickman SE, Kingery ND, Ohsumi TK, Borowsky ML, Wang LC, Means TK, et al. The microglial sensome revealed by direct RNA sequencing. Nat Neurosci. 2013;16(12):1896–905. Epub 2013/10/29. 10.1038/nn.3554 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.El-Brolosy MA, Kontarakis Z, Rossi A, Kuenne C, Gunther S, Fukuda N, et al. Genetic compensation triggered by mutant mRNA degradation. Nature. 2019;568(7751):193–7. Epub 2019/04/05. 10.1038/s41586-019-1064-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Vasudevan D, Liu Y-C, Barrios JP, Wheeler MK, Douglass AD, Dorsky RI. Regenerated Interneurons Integrate Into Locomotor Circuitry Following Spinal Cord Injury. BioRxiv. 2020;doi: 10.1101/2020.03.23.003806. [DOI] [PubMed] [Google Scholar]
  • 31.Inman GJ, Nicolas FJ, Callahan JF, Harling JD, Gaster LM, Reith AD, et al. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol. 2002;62(1):65–74. Epub 2002/06/18. 10.1124/mol.62.1.65 . [DOI] [PubMed] [Google Scholar]
  • 32.Tauzin S, Starnes TW, Becker FB, Lam PY, Huttenlocher A. Redox and Src family kinase signaling control leukocyte wound attraction and neutrophil reverse migration. J Cell Biol. 2014;207(5):589–98. Epub 2014/12/10. 10.1083/jcb.201408090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Becker T, Wullimann MF, Becker CG, Bernhardt RR, Schachner M. Axonal regrowth after spinal cord transection in adult zebrafish. J Comp Neurol. 1997;377:577–95. 10.1002/(sici)1096-9861(19970127)377:4&lt;577::aid-cne8&gt;3.0.co;2-# [DOI] [PubMed] [Google Scholar]
  • 34.Li S, Gu X, Yi S. The Regulatory Effects of Transforming Growth Factor-beta on Nerve Regeneration. Cell transplantation. 2017;26(3):381–94. Epub 2016/12/17. 10.3727/096368916X693824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.McTigue DM, Popovich PG, Morgan TE, Stokes BT. Localization of transforming growth factor-beta1 and receptor mRNA after experimental spinal cord injury. Exp Neurol. 2000;163(1):220–30. Epub 2000/04/29. 10.1006/exnr.2000.7372 . [DOI] [PubMed] [Google Scholar]
  • 36.Rathore KI, Redensek A, David S. Iron homeostasis in astrocytes and microglia is differentially regulated by TNF-alpha and TGF-beta1. Glia. 2012;60(5):738–50. Epub 2012/02/03. 10.1002/glia.22303 . [DOI] [PubMed] [Google Scholar]
  • 37.Vidal PM, Lemmens E, Dooley D, Hendrix S. The role of "anti-inflammatory" cytokines in axon regeneration. Cytokine Growth Factor Rev. 2013;24(1):1–12. Epub 2012/09/19. 10.1016/j.cytogfr.2012.08.008 . [DOI] [PubMed] [Google Scholar]
  • 38.Bradshaw AD. The role of secreted protein acidic and rich in cysteine (SPARC) in cardiac repair and fibrosis: Does expression of SPARC by macrophages influence outcomes? J Mol Cell Cardiol. 2016;93:156–61. Epub 2015/11/20. 10.1016/j.yjmcc.2015.11.014 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Au E, Richter MW, Vincent AJ, Tetzlaff W, Aebersold R, Sage EH, et al. SPARC from olfactory ensheathing cells stimulates Schwann cells to promote neurite outgrowth and enhances spinal cord repair. J Neurosci. 2007;27(27):7208–21. Epub 2007/07/06. 10.1523/JNEUROSCI.0509-07.2007 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kucukdereli H, Allen NJ, Lee AT, Feng A, Ozlu MI, Conatser LM, et al. Control of excitatory CNS synaptogenesis by astrocyte-secreted proteins Hevin and SPARC. Proc Natl Acad Sci U S A. 2011;108(32):E440–9. Epub 2011/07/27. 10.1073/pnas.1104977108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Jones EV, Bernardinelli Y, Tse YC, Chierzi S, Wong TP, Murai KK. Astrocytes control glutamate receptor levels at developing synapses through SPARC-beta-integrin interactions. J Neurosci. 2011;31(11):4154–65. Epub 2011/03/18. 10.1523/JNEUROSCI.4757-10.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Goldshmit Y, Matteo R, Sztal T, Ellett F, Frisca F, Moreno K, et al. Blockage of lysophosphatidic acid signaling improves spinal cord injury outcomes. Am J Pathol. 2012;181(3):978–92. Epub 2012/07/24. 10.1016/j.ajpath.2012.06.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mokalled MH, Patra C, Dickson AL, Endo T, Stainier DY, Poss KD. Injury-induced ctgfa directs glial bridging and spinal cord regeneration in zebrafish. Science. 2016;354(6312):630–4. Epub 2016/11/05. 10.1126/science.aaf2679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Anderson JL, Mulligan TS, Shen MC, Wang H, Scahill CM, Tan FJ, et al. mRNA processing in mutant zebrafish lines generated by chemical and CRISPR-mediated mutagenesis produces unexpected transcripts that escape nonsense-mediated decay. PLoS Genet. 2017;13(11):e1007105. Epub 2017/11/22. 10.1371/journal.pgen.1007105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gagnon JA, Valen E, Thyme SB, Huang P, Akhmetova L, Pauli A, et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014;9(5):e98186. Epub 2014/05/31. 10.1371/journal.pone.0098186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019;576(7785):149–57. Epub 2019/10/22. 10.1038/s41586-019-1711-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sentmanat MF, Peters ST, Florian CP, Connelly JP, Pruett-Miller SM. A Survey of Validation Strategies for CRISPR-Cas9 Editing. Sci Rep. 2018;8(1):888. Epub 2018/01/19. 10.1038/s41598-018-19441-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Vouillot L, Thélie A, Pollet N. Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases. G3 (Bethesda). 2015;5(3):407–15. Epub 2015/01/09. 10.1534/g3.114.015834 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Marchese M, Pappalardo A, Baldacci J, Verri T, Doccini S, Cassandrini D, et al. Dolichol-phosphate mannose synthase depletion in zebrafish leads to dystrophic muscle with hypoglycosylated alpha-dystroglycan. Biochem Biophys Res Commun. 2016;477(1):137–43. Epub 2016/06/14. 10.1016/j.bbrc.2016.06.033 . [DOI] [PubMed] [Google Scholar]
  • 50.Shiau CE, Kaufman Z, Meireles AM, Talbot WS. Differential Requirement for irf8 in Formation of Embryonic and Adult Macrophages in Zebrafish. PLoS One. 2015;10(1):e0117513. Epub 2015/01/24. 10.1371/journal.pone.0117513 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Klatt Shaw D, Mokalled MH. Efficient CRISPR/Cas9 mutagenesis for neurobehavioral screening in adult zebrafish. G3 (Bethesda). 2021. Epub 2021/03/21. 10.1093/g3journal/jkab089 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lam PY, Peterson RT. Developing zebrafish disease models for in vivo small molecule screens. Curr Opin Chem Biol. 2019;50:37–44. Epub 2019/04/01. 10.1016/j.cbpa.2019.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Early JJ, Cole KL, Williamson JM, Swire M, Kamadurai H, Muskavitch M, et al. An automated high-resolution in vivo screen in zebrafish to identify chemical regulators of myelination. eLife. 2018;7. Epub 2018/07/07. 10.7554/eLife.35136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Johnson SL, Zon LI. Genetic backgrounds and some standard stocks and strains used in zebrafish developmental biology and genetics. Methods Cell Biol. 1999;60:357–9. Epub 1999/01/19. 10.1016/s0091-679x(08)61910-x . [DOI] [PubMed] [Google Scholar]
  • 55.Peri F, Nusslein-Volhard C. Live imaging of neuronal degradation by microglia reveals a role for v0-ATPase a1 in phagosomal fusion in vivo. Cell. 2008;133(5):916–27. Epub 2008/05/31. 10.1016/j.cell.2008.04.037 . [DOI] [PubMed] [Google Scholar]
  • 56.Ellett F, Pase L, Hayman JW, Andrianopoulos A, Lieschke GJ. mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish. Blood. 2011;117(4):e49–56. 10.1182/blood-2010-10-314120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wilkinson RN, Elworthy S, Ingham PW, van Eeden FJ. A method for high-throughput PCR-based genotyping of larval zebrafish tail biopsies. BioTechniques. 2013;55(6):314–6. Epub 2013/12/19. 10.2144/000114116 . [DOI] [PubMed] [Google Scholar]
  • 58.Keatinge M, Bui H, Menke A, Chen YC, Sokol AM, Bai Q, et al. Glucocerebrosidase 1 deficient Danio rerio mirror key pathological aspects of human Gaucher disease and provide evidence of early microglial activation preceding alpha-synuclein-independent neuronal cell death. Hum Mol Genet. 2015;24(23):6640–52. Epub 2015/09/18. 10.1093/hmg/ddv369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ohnmacht J, Yang Y, Maurer GW, Barreiro-Iglesias A, Tsarouchas TM, Wehner D, et al. Spinal motor neurons are regenerated after mechanical lesion and genetic ablation in larval zebrafish. Development. 2016;143(9):1464–74. Epub 2016/03/12. 10.1242/dev.129155 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Gregory S Barsh, Cecilia Moens

5 Dec 2020

Dear Dr Becker,

Thank you very much for submitting your Research Article entitled 'CRISPR gRNA phenotypic screening in zebrafish reveals pro-regenerative genes in spinal cord injury' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Cecilia Moens

Associate Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: In this manuscript the authors describe a method for more selecting more highly active GRISPR guides and functionally test them in the context of larval zebrafish regeneration. The method for selecting and testing the guides seems robust and applicable to organisms with a sequenced and very well annotated genome. The manuscript is well written but in some cases assumes the reader is very familiar with previous research in the field, the manuscript should be revised to ensure a reader can understand the manuscript without having to go read other papers. Specific points:

1. The authors select a list of genes to test with their new guide design method which they say are “macrophage related genes based on previous research”. Table S1 should be revised to include specific information about these genes, reference papers, have they been previously knocked out, what is the phenotype, what method was used, morpholinos, mutants, talens etc.

2. Information should be given in the text or Table S1 as to where these genes are normally expressed in development and is there an embryonic phenotype from knocking them out in the embryo?

3. Are the genes they selected normally up-regulated after spinal cord injury, is this why they were selected?

4. The authors use an axon regeneration assay using the Tubb:DsREd transgenic line to assay axon regeneration. Previous work from others in the field have shown that the glial cells must first migrate and form a glial bridge and then axon regeneration begins. It would be interesting to know if there are also defects in the formation of the glial bridge in mutants where axon regeneration is impaired.

5. Five genes which gave phenotypes were raised as stable mutants. Again it would be helpful to know where/which cell types these genes are normally expressed in after spinal cord injury. This might shed more light on why KO of tgfb1a and tgfb3 do not result in any change in the number of macrophages at the injury site, when increased number of neutrophils are observed, do they stay at the injury site for longer than in WT animals, the same with animals where an increase in macrophages in seen?

6. Overall the assay of axon regeneration and effect on immune cells are quantified at very early timepoints, even in young larvae axon regeneration takes more than 48hrs, previous work from Briona and Dorsky report axon regeneration to take up to 9 days in 4 day old larvae, while work from the Saude group reports up to 6dpl. These groups and others work on spinal cord regeneration in zebrafish, it would be good to see references to other people work in the field in this manuscript.

Reviewer #2: This study screened for macrophage genes implicated in spinal cord injury in zebrafish larvae. Recently reported high efficiency CRISPR methods were used. 30 macrophage genes were targeted. Phenotypes were scored for the presence or absence of an axon reporter bridge at the lesion site. Phenotypes were observed and confirmed in stable lines for tgfb1a tgfb3 tnfa and sparc. The study proposes that tgfb1a deletion leads to a prolonged immune response that inhibits regeneration after injury.

1- One concern is that the described screening methods report low targeting efficiencies relative to previously published studies in the field. In this study, 44% of all tested RNAs were high efficiency. This is in contrast to findings from Hoshijima et al, which convincingly reported bi-allelic indel mutations in almost all cells of the developing embryos, a result that has been recapitulated by numerous other labs. The authors do not discuss or address the reasons behind limited targeting efficiency, and instead propose pre-screening for high efficiency guide RNA to overcome this limitation.

a. The design strategy was limited to targeting enzyme recognition sites that were later used for restriction fragment length polymorphism (RFLP) genotyping. Is this limitation likely to limit targeting efficiency? Especially considering that enzyme-independent assays are now available to accurately quantify the rate of mutagenesis.

b. Compensatory mechanisms associated with targeting early exons have been described in great detail in the field but are not addressed in this study. Mutations with premature stop codons are not always likely to abrogate gene function as stated in the manuscript. Added to this concern is that all 4 phenotypes reported in this study were attributed to genes in which functional domains rather than 5’ exons were targeting.

c. A number of genes that are essential for macrophage function do not show phenotypes. Is this due to targeting strategies? Do stable p2yr1 mutants shown normal recovery for example?

d. Is it possible that the source of synthetic RNA is a contributing factor. Unclear whether the RNAs used here are chemically modified to enhance their resistance to degradation the way Alt-R-modified RNAs were shown to be.

2- The more exciting and novel aspect of this study is to apply recent CRISPR advances in zebrafish genetics to identify new genes involved in spinal cord injury. Unfortunately, the inflammatory factors tgfb1 and 3 are well characterized in spinal cord injury, and the data presented seems preliminary. For example, this reviewer finds sparc phenotypes intriguing and novel. Including expression and phenotypic data for sparc can add the missing novelty to the study. Keeping in mind that Sparc is also a known regulator of synapse function, it is important to distinguish between possible functions in neurons or macrophages.

3. The rationale behind which macrophage-related genes were included is not described in the text. it will be helpful to describe their expression and previous implication in macrophage activation.

4. Phenotyping was based on scoring an axon reporter line for bridging at the lesion site. This method does not distinguish phenotypes related to degeneration and debris clearing from regeneration phenotypes. The authors have previously reported numerous methods to assess anatomical and behavioral regeneration. We recommend using these assays for in depth characterization of the phenotypes.

As an example, Figure 3 gives a brief overview of the phenotype in tgfb mutants. Quantifications in 3b and 3c suggest that macrophage number were not changed but that tgfb1a mutants have more neutrophils. It is possible this difference is statistical since many more replicates are quantified in 3c.

Reviewer #3: The manuscript by Keatinge et al. describes a very valuable and useful scalable in vivo phenotypic screen based on CRISPR technology using imaging-friendly zebrafish larvae.

The screen was designed for a specific spinal cord injury paradigm, but I would like to emphasize the possibility of using the same screening logic to identify regulators of other biological processes, as long as they are easy to phenotype in medium-large scale.

As an important note for the general scientific community, the authors claim that the 4 different in silico prediction tools they used did not have enough prediction power to selected highly efficient guide RNASs. They propose the use of an easy and efficient RLFP-based tool and further show its efficacy in the prediction of guide RNAs.

I have a few points that I would like the authors to address.

# 1. The screening platform was designed to screen for macrophage-related genes and was successful in identifying potential macrophage players, with potential inflammation modulation effects and with potential positive effects on spinal cord regeneration. I would like to emphasize the word potential because at this stage of the work that's what the identified genes are. I think the authors should lower the tone throughout the manuscript about the involvement of these genes specifically with macrophages (as no co-stainings were done) and with regeneration capacity (as no swimming recovery test of any type was performed, only the presence of tubulin:GFP at the injury site was roughly quantified).

# 2. In Fig 1A, why do the Uninjected Digested lanes of irak3 gene have only one band? If the embryos were not injected, they should have the restriction site intact and when digested should then produce at least 2 bands. Please clarify.

# 3. In Fig 2A, I think the representation of axonal bridge at 24 and 48 hpl is misleading, as it is expected that at 48 hpl the axonal bridge at the injury site would be bigger when compared to the one seen at 24 hpl.

# 4. In Fig 2B, the examples of transgenic larvae shown are at which time point after lesion?

I find bridging a weak and limited item to access in this context. You can find larvae with a lot or very little bridging and these will be included in the same bridged category. In their quantification methodology, a larvae with only on fascicle being continuous between rostral and caudal spinal cord ends will be included in the bridged category. And the question I would like to raise at this point is to what extent can we came assumptions on the regenerative capacity based on only one fascicle crossing the injury site? A swimming test would be essential to produce a stronger conclusion.

# 5. In Fig 2C, the y axis should not be % of larvae with bridged lesion because theses values were normalized to the WT control (in which according to values in Fig 2A a represented approx. 80% and not 100% as seen in the 2C graphic.

# 6. In Fig 2D, why is there a discrepancy between the bridging % tendency between acute injections and stable mutations? The difference expected would be that in stale mutants the effect would be more pronounced than in the acute mosaic injections, why is this? and did they authors also see the defects at 24 hpl that they saw in the acute injected ones?

# 7. In Fig 2D, the legend says that the sparc mutant was analysed at 24 hpl but the text gives the idea that the result is from 48 hpl. Is the result the same for 24 and 48 hpl? Could the stronger phenotype of the sparc mutants be a result of the earlier timepoint analysed?

# 8. The authors when on to characterize in more detail the tgfb1a mutant and propose that Tgfb1a signaling may be part of the mechanism by which macrophages control iL1b levels and thus promote regeneration. To support this hypothesis the authors could simply do a IL1b inhibition rescue experiment similarly to what they already did for the tnfa mutant. And I would argue that it would be fundamental to complement these experiments with swimming recovery tests (tgfb1a mutant and tgfb1a mutant after rescue).

# 9. Regarding the genotyping of the stable mutants used for the phenotypic analysis (Fig 2D), it is not clear in the methods how this was done. Do the authors use individual larvae to extract DNA after doing the injury and then genotype by PCR?

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 1

Gregory S Barsh, Cecilia Moens

28 Mar 2021

Dear Dr Becker,

We are pleased to inform you that your manuscript entitled "CRISPR gRNA phenotypic screening in zebrafish reveals pro-regenerative genes in spinal cord injury" has been editorially accepted for publication in PLOS Genetics. Congratulations! 

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. You may also consider addressing the comment of reviewer 4 about clarifying the mechanism by which macrophages regulate regeneration at that time. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Cecilia Moens

Associate Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors have addressed all of the reviewers comments and in doing so improved the manuscript and made it acceptable for publication.

Reviewer #3: I have no further comments.

Reviewer #4: In this MS, the Becker group develop a novel phenotypic screening paradigm for identifying macrophage-related pro-regenerative genes after spinal cord injury, using an elegant larval zebrafish regeneration model and CRISPR-based technologies. In an innovative approach, they used synthetic RNA Oligo CRISPR guide RNAs (sCrRNAs) and pre-screening for high activity in vivo; testing of 350 sCrRNAs; targeting 30 genes of interest; validating 5 candidates in loss of function studies and identifying 4 genes as positive regulators of successful regeneration in larval zebrafish. This novel screening methodology represents a valuable new tool for the field of regenerative neurobiology. The potential for wider application of this technology in other contexts is also important, such as other injury models and/or other cell types (and cell type interactions) related with injury and repair; and also, neurodevelopmental systems and neurogenesis and pathfinding studies where zebrafish are commonly used.

Having not been one of the original reviewers, I took into consideration the previous review comments and responses and read these carefully alongside the manuscript. I have no technical comments to add on top of the previous reviewers, it seems the authors have done an excellent job in addressing all of the main concerns. This study is elegantly conducted, and the findings are robust. I ask only for clarification (which could be added to the discussion) on one general point relating to their conclusions on understanding the mechanistic basis of how macrophages regulate regeneration:

In relation to the loss of function/mutation studies, can the authors comment on whether they are preventing neuronal regeneration directly (i.e., directly affecting pro-regenerative gene expression in injured neurons) or are they preventing regeneration indirectly (i.e., because there is no resolution of inflammation, the environment remains pro-inflammatory/toxic and inhibitory to growth). This is an important point in terms of mechanistic understanding. Future studies (e.g., scRNA-seq) involving assessments of gene expression in regenerating vs non-regenerating neurons could be important for studying directly pro-regenerative vs anti-inflammatory/pro-resolving mechanisms.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: No

Reviewer #4: Yes: Elizabeth Bradbury

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: 

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-20-01501R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

Acceptance letter

Gregory S Barsh, Cecilia Moens

8 Apr 2021

PGENETICS-D-20-01501R1

CRISPR gRNA phenotypic screening in zebrafish reveals pro-regenerative genes in spinal cord injury

Dear Dr Becker,

We are pleased to inform you that your manuscript entitled "CRISPR gRNA phenotypic screening in zebrafish reveals pro-regenerative genes in spinal cord injury" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Katalin Szabo

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Injecting two haCRs simultaneously effectively disrupts gene function.

    A-C: Direct sequencing of mutant alleles in embryos injected with two haCRs per gene demonstrates induction of frameshift frequencies of 72% (A; haCr #1) and 60% (B; haCR #2), when either sCrRNA is analysed individually. This rises to 87% when frame-shift frequencies are combined (C). D: At the protein level, dual haCR injection against hexb reduces enzyme activity by 80% in vivo (ANOVA with Tukey post-test; p < 0.0001). Single haCRs also reduce enzyme activity (p < 0.0001 for both). haCR#2 is more efficient than haCR#1 (p = 0.0051). Error bars represent SEM.

    (TIF)

    S2 Fig. Inhibition of axon bridging is observed for some of the selected genes at 24 hpl.

    Significant reductions in bridging were detected after acute injection of haCRs for sparc (p = 0.0424), tnfa (p = 0.0068), tgfb1a (p = 0.0225) and cst7 (p = 0.0418). Fisher’s Exact test, p<0.05.

    (TIF)

    S3 Fig. Mutations likely lead to non-functional protein.

    Deletions are shown in red and insertions are shown in blue. All stable mutations produce frameshifts (cst7, tnfa, tgfb1a and sparc) and premature stop codons, with the exception of the mutation in the tgfb3 gene. The latter contains an in-frame indel in which the large quantity of inserted material contains a nonsense mutation.

    (TIF)

    S4 Fig. Inhibiting Tgf signalling with SB31442 impairs axonal bridging.

    Experimental timeline, lateral views of embryos and quantification are shown. Fisher’s Exact test, p<0.05. The white arrow indicates the axonal bridge. Scale bar 50 μm.

    (TIF)

    S5 Fig. Glial bridging is impaired in the tgfb3 mutant.

    Lateral views of whole-mounted larvae at 5 dpf are shown; rostral is left, dorsal is up. A: Gfap immunohistochemistry shows longitudinal processes over the injury site (centred in right column) for wildtype (WT), sparc, tnfa, and tgfb1a mutants, but not for tgfb3 mutants at 48 hours post-injury (hpf). B: Quantification of the phenotypes shows a significant reduction in the proportion of larvae with glial bridging only for tgfb3 mutants (Fisher’s Exact test).

    (TIF)

    S6 Fig. Functional recovery is not significantly impaired in the tgfb1a mutant.

    No change is observed in the distance that tgfb1a mutants swim after a touch evoked stimulus (Unpaired t test, p = 0.2590).

    (TIF)

    S1 Table. List of sCRNAs.

    This is a list all sCrRNAs used in this study and their efficiencies as determined by RFLP.

    (XLSX)

    S2 Table. Genes used in spinal cord injury screen.

    This is a list of genes that are used in the spinal cord injury in vivo screen, also containing information on expression and regulation after injury.

    (XLSX)

    Attachment

    Submitted filename: Plos_Genet_rebuttal_090321.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS Genetics are provided here courtesy of PLOS

    RESOURCES