Skip to main content
PeerJ logoLink to PeerJ
. 2021 Apr 27;9:e11122. doi: 10.7717/peerj.11122

Comparative transcriptome and histological analyses provide insights into the skin pigmentation in Minxian black fur sheep (Ovis aries)

Xiaolei Shi 1, Jianping Wu 1,, Xia Lang 2,, Cailian Wang 2,3, Yan Bai 1, David Greg Riley 4, Lishan Liu 2, Xiaoming Ma 1
Editor: Pedro Silva
PMCID: PMC8086576  PMID: 33986980

Abstract

Background

Minxian black fur (MBF) sheep are found in the northwestern parts of China. These sheep have developed several special traits. Skin color is a phenotype subject to strong natural selection and diverse skin colors are likely a consequence of differences in gene regulation.

Methods

Skin structure, color differences, and gene expression (determined by RNA sequencing) were evaluated the Minxian black fur and Small-tail Han sheep (n = 3 each group), which are both native Chinese sheep breeds.

Results

Small-tail Han sheep have a thicker skin and dermis than the Minxian black fur sheep (P < 0.01); however, the quantity of melanin granules is greater (P < 0.01) in Minxian black fur sheep with a more extensive distribution in skin tissue and hair follicles. One hundred thirty-three differentially expressed genes were significantly associated with 37 ontological terms and two critical KEGG pathways for pigmentation (“tyrosine metabolism” and “melanogenesis” pathways). Important genes from those pathways with known involvement in pigmentation included OCA2 melanosomal transmembrane protein (OCA2), dopachrome tautomerase (DCT), tyrosinase (TYR) and tyrosinase related protein (TYRP1), melanocortin 1 receptor (MC1R), and premelanosome protein (PMEL). The results from our histological and transcriptome analyses will form a foundation for additional investigation into the genetic basis and regulation of pigmentation in these sheep breeds.

Keywords: Sheep, Skin, Pigmentation, RNA sequencing, Histology

Introduction

Sheep are important fiber and fur producing domestic animals. Minxian black fur (MBF) sheep and Small-tail Han (STH) sheep are both Chinese native breeds and are included on the list of protected genetic resources of livestock and poultry in China. MBF sheep are found in the Tao River basin region of Gansu Province in northwestern China. This black fur sheep breed has developed several special traits, including dark skin and hair covering their full body including the visible mucous membranes, lips, and tongues. This pattern is similar to the phenotype of black-boned sheep (Deng et al., 2006) and the dark goat (Ren et al., 2017). The STH sheep is one of the most famous local breeds for its reproductive performance and strong adaptability and is widely distributed in most parts of northern China. We used STH sheep breeds as the control group for their nearly white skin color and white coat color.

Skin color variation is one of the most common examples of phenotypic diversity in animals. Skin color in sheep is predominantly determined by the amount, type, and packaging of melanin polymers. Those polymers are produced by melanocytes and then secreted into keratinocytes (Rees, 2003). Melanocytes in skin are present in hair follicles and in the basal skin layer. However, the numbers of melanocytes vary in these locations (Tobin & Bystryn, 1996). Melanin polymer molecules can have protective or harmful biological functions. Melanin provides protection against DNA-damage from ultraviolet radiation, yet the melanin in pathogenic fungi can aid host infection. Melanin is also a component of a recently described antifungal defense pathway in mammals (Casadevall, 2018). Melanocytes and neighboring cells interact in keratinocytes and fibroblasts to regulate skin color (Choi, Kolbe & Hearing, 2012). The distribution of melanin in the epidermis appears to protect DNA from photodamage, as evidenced by the considerable range of skin colors and corresponding incidence of keratinocyte cancers in humans (Fajuyigbe et al., 2018).

Skin pigmentation in animals is a polygenic trait, and may be influenced by different kinds of multi-gene interactions (Barsh, 1996). The proteins and genes associated with skin color in humans, mice, chickens, and sheep include agouti signaling protein (ASIP) (Lu et al., 1994), melanocyte-stimulating hormone receptor (MSH) (Robbins & Nadeau, 1993), microphthalmia transcription factor (MITF) (Dong, Yoshiaki & Vijayasaradhi, 2002; Vetrini et al., 2004; Wang et al., 2018), tyrosinase (TYR) (Deng et al., 2008; Yu et al., 2017), tyrosinase-related protein-1 (TYRP1) (Chun et al., 2016), dopachrome tautomerase (DCT) (Xue et al., 2018), melanocortin 1 receptor (MC1R) (Fontanesi et al., 2010; Bourgeois et al., 2016; Wolf Horrell, Boulanger & D’Orazio, 2016), solute carrier family 45 member 2 (SLC45A2) (Wang et al., 2016), and others. There are over 100 known color loci in mice and many of them have been cloned and sequenced (Bennett & Lamoreux, 2003).

Many biological mechanisms in sheep skin can be assessed using comparative anatomy, transcriptomics, and genomics (Jablonski, 2004). The transcriptome of the skin of fine and coarse wool sheep breeds in China have been evaluated (Zhang et al., 2017a). Skin transcriptome profiles associated with coat color in sheep (Fan et al., 2013) or goats (Ren et al., 2017) have also been characterized. Melanin in the skin of other species, including koi carp (Luo et al., 2019), raccoon dog (Du et al., 2017), turtle (Si et al., 2019) and mink (Song et al., 2017) has been genetically characterized by sequencing the RNA populations. However, there is a lack of understanding regarding the underlying genetic mechanisms of pigmentation. The dark pigmentation of the MBF sheep represents an opportunity to assess and characterize the genetic and structural properties of skin in this unusual breed when compared to a white breed of sheep. We sought to investigate the genetic mechanisms associated with pigmentation by: (1) physically characterizing skin melanin distribution and other skin characteristics, and (2) assessing the genes expressed in skin using RNA sequencing technology in MBF sheep compared to the white Small-tail Han breed.

Materials & Methods

Ethics Statement

This study was approved by the Committee for Animal Ethics of the College of Animal Science and Technology, Gansu Agricultural University (approval number 2019-75). Experiments were conducted in accordance with approved guidelines.

Animals and tissue sampling

Three healthy MBF males and three STH males one year of age were obtained from specialized sheep farming cooperatives in Min county, Gansu Province, China. Sheep were selected to minimize relatedness. Sheep were fed under the same conditions and were humanely sacrificed. Two adjacent skin samples were obtained from the scapular region of each animal using surgical scissors. One sample was designated for RNA extraction and immediately placed into liquid N and subsequently stored at −80 °C (ULT Freezer Model DW-86L828; Haier Biomedical, Qingdao, China). The other sample was designated for histological examination and fixed in a 4% paraformaldehyde solution.

Sample histological examination and analysis

Samples were soaked in the 4% paraformaldehyde solution for 3 days, dehydrated in a graded ethanol series, and embedded in paraffin. Samples were partitioned into 6-µm sections using a rotary microtome (Leica RM2265, Germany) and were subjected to haematoxylin and eosin (H&E) and Fontana-Masson (FM) staining. FM staining identified the presence and distribution of melanin (Barbosa et al., 1984; Carriel et al., 2011). H&E staining was conducted to observe morphologic parameters. After staining, slides were scanned using a Panoramic Scanner (P-MIDI; 3DHISTECH Ltd., Hungary). The thickness of the epidermis and the dermis of each sample were measured five times using CaseViewer (C.V 2.0; 3DHISTECH Ltd., Hungary). Fontana-Masson (FM) is a specific staining method used to detect melanin granules, which appear black under the stain. The content of melanin granules was determined by detecting the relative area of the granules in the sample slices. We detected the relative content, rather than the absolute content, using this method. Slide images were analyzed using Image-Pro Plus (6.0; Media Cybernetics, MD, USA) software.

RNA Extraction, transcriptome library construction, and sequencing

Total RNA in each sample was isolated after pulverizing the sample in liquid N using the RNA simple Total RNA Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The concentration and purity of total RNA were detected using a NanoDrop-2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). All samples exhibited optical density 260/280 ratios from 1.8 to 2.0. RNA integrity was determined by 1.0% agarose gel electrophoresis. Samples were stored at −80 °C for subsequent library construction and sequencing.

Approximately 5 µg RNA per sample was used as input material in constructing the sequencing library. First, ribosomal RNA was removed using an Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre, Madison, WI, USA) and a fragmentation buffer was added to process mRNA into short fragments. The first cDNA strand was synthesized using random hexamer primers and the second-strand cDNA was synthesized using dNTPs, buffer, RNaseH, and DNA polymerase where dTTP were replaced by dUTP. The cDNA fragments were purified using a QIAquick PCR extraction kit (Qiagen, Gmbh, Germany). The fragment ends were repaired and poly-adenosine tails were ligated to sequencing adaptors. Suitable size fragments were selected following agarose gel electrophoresis and were used as templates for polymerase chain reaction (PCR) amplification.

Sequencing was performed using the HiSeq™ 2000 (Illumina, Inc., San Diego, CA, USA) system to create the library.

Quality control and reads mapping

Raw data were first processed using in-house Perl scripts. Clean data were obtained by removing reads containing adapters, reads containing over 10% of poly-N, and low-quality reads (more than 50% of bases whose Phred scores Q20error rate were less than 5%). The Phred scores and guanine-cytosine (GC) contents of the quality-edited data were calculated and used as metrics in this process. Subsequent analyses were conducted using the quality-edited data.

Reads from RNA sequencing were mapped to the Ovis aries genome (Oar_v4.0; https://www.ncbi.nlm.nih.gov/assembly/GCF_000298735.2/). The paired-end clean reads were aligned to the reference genome with HISAT2 (V2.0.4) (Kim, Langmead & Salzberg, 2015) and the assembled transcripts were constructed using String Tie (V1.3.1) (Pertea et al., 2016).

The strands specific parameter was the main parameter setting (–rna-strandness RF) and the name and location of the input and output files were set while all other alignments were set to default parameters. String Tie software was used for assembling and counting the original sequences of reads from each sample. The default settings were used for most parameters, aside from the name and location of the input or output file.

Screening and identification of differentially expressed genes

String Tie software was used for counting the original sequences of reads from each sample. Then, we calculated the fragments per kilo base of exon model per million reads mapped (FPKM) (Trapnell et al., 2010) of coding genes relative to the expression levels of known genes. We used the R package DESeq (Love, Huber & Anders, 2014) to screen differentially expressed genes. Differentially expressed genes were declared (Audic & Claverie, 1997; Benjamini & Yekutieli, 2001) with fold change thresholds of 2 and FDR controlled at less than 0.05. We created a hierarchically clustered heatmap of known differentially expressed genes using Omicshare software tools (https://www.omicshare.com/tools/Home/Soft/heatmap).

Enrichment analysis of differentially expressed genes

Known DEGs were used in functional enrichment analysis. We conducted enrichment analysis of differentially expressed genes after annotation (Gene Ontology, 2015) using the online version of omicShare (Gene Denovo Ltd., Guangzhou, China) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways using KOBAS (V3.0) (Mao et al., 2005) software. KOBAS is a widely used gene set enrichment (GSE) analysis tool (KOBAS 3.0, 2019). All genes of the reference genome (the Ovis aries genome -Oar_v4.0) were used as the background gene set while conducting functional enrichment analysis.

Verification of differentially expressed genes

We verified the reliability and accuracy of the RNA-Seq results using RT-qPCR for eight of the differentially expressed genes. cDNA was synthesized from extracted RNA using a PrimeScript™ RT Reagent kit (Takara, Dalian, China) and stored at −20 °C. The specific primers of these target genes were designed using NCBI Primer-BLAST online software; those sequences and related information are presented in Table 1. The reaction volume for RT-qPCR included 9.5 µl SYBR® Green PCR Master Mix (Takara, Dalian, China), 1 µl cDNA, 1 µl forward and reverse primers, and 7.5 µl RNase free ddH2O. Each reaction was performed in triplicate. The relative expression of target genes was calculated using the 2−ΔΔCt method (Livak & Schmittgen, 2001). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference gene.

Table 1. Primers used in this study for qRT-PCR.

Gene Primer sequences (5′–3′) Accession No. Products length (bp)
OCA2 AGGATTTTGGCTCATGCCTCA XM_004004469.4 140
GCACCATGACCCTTTTTCTTGTG
DCT TTCAATCCCCCTGTGGATGC NM_001130024.1 170
TCTGGAGTTTCTTCAACTGGCA
TYR CTTCTTCTCCTCTTGGCAGATCAT NM_001130027.1 100
ATTGCGCAGTAATGGTCCCT
DDC TTCCTTTCTTCGTGGTGGCTA XM_027968422.1 179
TGCAAACTCCACGCCATTCA
TYRP1 CGCGGTATTTGATGAATGGCTG NM_001130023.1 195
AAACTCCGACCTGGCCATTG
MC1R GCTGCTGGGTTCCCTTAACT NM_001282528.1 149
CCAGCACGTTCTCCACAAGA
PMEL AGATGCCAACTGCAAAGGGT XM_012174772.3 187
AGGGAGCCTGCAGTACCTT
TMEM231 GAACTGCCGAGGGAACAAGA XM_004014913.4 188
TTTTAGCCAAAACCCGTGGC
GAPDH ATGGCCTCCAAGGAGTAAGGT NM_001190390.1 123
AGGTCGGGAGATTCTCAGTG

Statistical analysis

We assessed the differences in melanin content, and the thickness of the epidermis, dermis, and skin of the two breeds were using the two-tailed Student’s t-test method with SPSS (IBM, Armonk, NY, USA) software. Results were presented as means and standard errors.

Results

Histological characterization

There are obvious phenotypic differences in the pigmentation of MBF and STH breeds (Fig. 1). Morphologic features of the skin from the two breeds were similar but differed in the thickness of the dermis (Fig. 2). The thickness of the skin and dermis of MBF samples were lower (P < 0.01) than in STH samples, but the thickness of the epidermis did not differ by breed (Figs. 3A, 3B and 3C). The data for the thickness measurements are shown in Table S1.

Figure 1. The main phenotypic characteristics of Minxian Black Fur sheep and Small-tail Han sheep.

Figure 1

Overall appearance of Minxian Black Fur sheep and Small-tail Han sheep (A and D), Minxian Black Fur sheep have dark skin and tongue(B and C), While Small-tail Han sheep have white skin and tougue (E and F).

Figure 2. Histological comparison of sheep skin tissue by H&E staining.

Figure 2

Morphological comparisons of skin tissues in MBF sheep and STH sheep. The representative images of MBF and STH at a scale of 200 um (A, B); the representative images of MBF and STH at a scale of 50 um (C, D); e, epidermis; d, dermis; h, hypodermis.

Figure 3. The thickness of skin and melanin content.

Figure 3

The results of thickness and melanin content between MBF sheep and STH sheep. The thickness of epidermis (A, P > 0.05); The thickness of dermis (B, P < 0.01); The thickness of whole skin layer (C, P < 0.01); The melanin granules content (D, P < 0.01).

There were clearly differences between the breeds in the distribution of melanin granules in the skin (Fig. 4). Melanin pigment was distributed across the epidermal layer and wool follicles in MBF samples, but was limited to the dermis in STH samples. There were substantially higher quantities of melanin pigment in the MBF samples (P < 0.01) (Fig. 3D) (Table S2). Histological examination and analysis of the skin from two sheep breeds showed that the skin structure of MBF sheep is similar to that of STH sheep, with the exception of the melanin and the thickness of the dermis.

Figure 4. The result of skin tissues Fontana-Masson staining in MBF sheep and STH sheep.

Figure 4

Skin tissues Fontana-Masson staining in MBF sheep and STH sheep. The images of MBF sheep (A:200 um; B:20 um); The images of STH sheep (C:200 um; D:20 um). Red, green, and blue arrows indicate the presence of melanin in wool follicles, epidermis, and dermis, respectively.

RNA sequencing and mapping of skin transcriptome

We obtained 103.18 GB clean reads from the six skin libraries after filtering. The total number of reads ranged from 53.84 to 61.81 million. The GC contents of the six samples were within 51.45% to 52.64%, and Q30 scores were greater than 92.62% for each sample. Mapping ratios ranged from 87.40% to 90.57%. Detailed information of RNA sequencing and mapping by sample are listed in Table S3. Samples were further analyzed when the results of sequencing and quality control were good.

Identification of differentially expressed genes

The six samples had similar overall gene expression levels (Fig. 5A). There were 133 differentially expressed genes identified, with 78 up regulated genes and 55 down regulated genes. Of those differentially expressed genes, there were 90 with known functions, and the remainder were potentially novel genes (Figs. 5B and 5C). Clustered heatmap visualization of the differentially expressed genes revealed two that separated according to the different sheep breeds (Fig. 5D). Additional details of the differentially expressed genes are presented in Table S4. There were less than 150 differentially expressed genes found, and the number of known genes was less than 100, suggesting a much more limited number of candidate genes.

Figure 5. The analysis of Overall gene expression and differentially expressed genes.

Figure 5

(A) The overall expression of genes in two breeds of sheep (MBF:B1,B2,B3; STH:W1, W2, W3). (B) Differentially expressed genes between MBF and STH sheep, different colors represent the numbers of upregulated, downregulated, novel, and known DEGs. (C) Volcano plot of differential gene expression in MBF and STH sheep, red and yellow dots indicate upregulated and downregulated genes, respectively. (D) Clustered heatmap of the DEGs in samples of MBF and STH sheep, rows represent DEGs while columns represent different samples.

Functional enrichment analysis of differentially expressed genes

There were 90 known differentially expressed genes that were significantly enriched in 37 GO terms, including 28 in the category “biological process” and 9 in “cellular component” (Table S5). The 20 most significant (lowest P values) GO terms in the “biological process” and “cellular component” categories are shown in Figs. 6A and 6B. Some observed significant GO categories were associated with skin and pigmentation. Those included the “melanosome”, “pigment granule”, “tissue development”, and “cell differentiation” categories. The differentially expressed genes were enriched in 114 pathways (Table S6). The 20 most significant pathways are presented in Fig. 6C. Two pathways were involved in the regulation of skin pigmentation (q < 0.05): the “tyrosine metabolism” pathway (ko00350, 4 differentially expressed genes) and the “melanogenesis” pathway (ko04916, 5 differentially expressed genes). We found 16 differentially expressed genes in the most significant GO terms and critical signal pathways associated with melanin pigmentation (Table S7). The results demonstrated that enrichment analysis of differentially expressed genes can define their biological function and narrowed the number of candidate genes that may regulate skin.

Figure 6. Functional analysis results for differentially expressed genes.

Figure 6

(A) The 20 most significant GO terms in the “biological process” category; (B) The 20 most significant GO terms in the “cellular component” category; (C) The 20 most significant pathways identified through KEGG pathway enrichment analysis.

RT-qPCR validation of RNA-seq data

Eight significant differentially expressed genes were identified from the RNA sequencing results for RT-qPCR validation. These differentially expressed genes were chosen from the significantly enriched pathways involved in pigmentation regulation and for their known involvement in the pigmentation of multiple species: OCA2 melanosomal transmembrane protein (OCA2), DCT, TYR, dopa decarboxylase (DDC), TYRP1, MC1R, premelanosome protein (PMEL), and transmembrane protein (TMEM231). The RT-qPCR expression patterns in the two breeds for these genes were consistent with those from RNA sequencing (Fig. 7). Our results demonstrated that the RNA-Seq data and the differentially expressed genes were highly reliable. The identified genes were differentially expressed in the skins of MBF and STH sheep.

Figure 7. Verification of RT-qPCR for eight differentially expressed genes.

Figure 7

FPKM values were used to calculate gene expression in RNA-seq, to normalize the expression of STH group as “1”. Data shown on the y-axis represent the fold change. A–H are, respectively, OCA2, DCT, TYR, DDC, TYRP1, MC1R, PMEL, and TMEM231.

Discussion

Melanin is the most common pigment in most organisms, animals, plants, bacteria, and fungi. The function and mechanism of melanin in the skin and hair have been well-researched. Melanin formation in the skin is induced by long-wave ultraviolet and visible light (Pathak et al., 1962); melanin granules in mammalian melanocytes are formed from the melanosome (Seiji et al., 1963). Melanin granules may move from melanocytes to the cortical cells as a consequence of phagocytosis (Swift, 1964). Melanin pigments in the skin are synthesized and stored in melanosomes, which are functionally and morphologically unique. Melanosomes are distinct organelles similar to lysosomes (Marks & Seabra, 2001). Melanin’s chemical nature is a polyphenolic polymer formed by the oxidative polymerization of phenolic and/or indolic compounds (Bell & Wheeler, 1986). Some studies have shown that melanin may protect against UV and visible light (Singaravelan et al., 2008), antioxidants (Jacobson & Tinnell, 1993; Wolbarsht, Walsh & George, 1981), and radiation (Meredith & Riesz, 2004). Traditional Chinese medicine has promoted chicken soup made with Silkie meat as a curative food as far back as the seventh century. Foods that are naturally rich in melanin including black sesame seed, black fungus, and black bone chicken are considered to have health-giving properties in traditional Chinese medicine. Melanin has been proven to have these functions, but modern beauty standards have promoted lighter skin and current research has focused on inhibiting melanin production (Chen et al., 2014; Li et al., 2017). There are 42 indigenous sheep breeds in China but only a few specialized breeds are used for the production of lambskin and lamb fur (Wei et al., 2015). MBF is a famous sheep breed used for its skin and wool, however, as artificial fur production has improved, the market for natural wool has decreased. The MBF sheep in this study is rich in melanin and can be produced as a specialized breed with health benefits from its meat.

The coloration of the skin and hair in mammals is quite obvious and diverse. Coloration and melanin pigmentation in mammals is an explicit adaptation of natural selection and it is highly related to the average dose of ultraviolet radiation corresponding with the geographic latitude. For example, humans typically have a lighter skin color at latitudes near the polar regions and darker skin in equatorial latitudes (Trivedi & Gandhi, 2017). However, the coloration in MBF sheep may be the result of both natural and artificial selection, for survival in higher altitude environments and stronger ultraviolet rays, as well as a human preference for darker fur. There is a long-held preference for darker wool among the people of the Tao River Basin for its warmth and stain resistance. The evolution of animal coloration can be divided into concealment, communication, and regulation of physiological processes (Caro, 2005). Melanism is a prevailing form of concealment in many organisms (Singaravelan et al., 2010). Communication signaling among mammals includes aposematism, health or reproductive condition, and sexual selection (for example, lionesses prefer to mate with the darkest-maned male in their coalition) (West & Packer, 2002). We believe that there is strong evidence to show that the evolutionary forces responsible for coloration vary greatly between MBF sheep and STH sheep. However, the causes of this variation are not yet understood. Our results may show the gene regulation mechanism implicated in melanin in MBF sheep at the molecular level.

Our study may be the first effort to study melanin pigmentation in this exceptionally pigmented sheep breed. The structural basis of pigment deposition patterns differed markedly in skin samples from these two native Chinese breeds. Skin, epidermal, and dermal thickness in MBF sheep differed from those of STH. Fine wool sheep breeds, such as the Merino, have been shown to have thinner skin thicknesses than other breeds (Zhang et al., 2017a). These results are similar to ours in that MBF sheep have a greater thickness of dermis. Skin color is dependent on the melanin content in the dermis and coat color does not remain static throughout an animal’s life; acute stress or age may cause a depigmentation (Caro, 2005). Technological advances in sequencing have revolutionized evolutionary biology (Sreedharan et al., 2014) and sequencing data have provided a better understanding of biological mechanisms (Alyass, Turcotte & Meyre, 2015). Sequencing of RNA transcripts has been used to investigate mechanisms of pigmentation in different species, and many pigmentation related genes have been identified (Du et al., 2017; Song et al., 2017; Zhang et al., 2017a; Yu et al., 2018; Si et al., 2019). We identified 133 differentially expressed genes, including 90 known genes and 43 new genes. We used software to align the reads to the sheep reference sequence to obtain new genes. The unannotated transcription units which filtering out the sequences that encode too short peptide (only contained a single exon or less than 50 amino acids) were defined as new genes.

Most genes and mutations are identified by their effects on coat color and few are known to alter skin color (Fitch et al., 2003). There are a large number of genes that influence the pigmentation of mammals (Bennett & Lamoreux, 2003) but there are fewer than 15 genes directly associated with skin pigmentation variation in humans (Martin et al., 2017). Some of the identified regulatory genes coincided with our results, including TYR, TYRP1, OCA2, and MC1R. We found that a small number of critical genes appeared to support the differential regulation of melanin pigmentation in MBF sheep. The candidate genes all come from the significant GO terms and KEGG pathways which regulated and influenced the skin phenotypes. Six differentially expressed genes were components of signal pathways associated with regulating skin pigmentation, including the “tyrosine metabolism” pathway (ko00350) and the “melanogenesis pathway” (ko04916). Those included TYR, TYRP1, DCT, DDC, MC1R, and frizzled class receptor 2 (FZD2). These genes were significantly up regulated in MBF and may be the cause of the differences in melanin deposition between the two sheep breeds. Much of our understanding of the molecular biology of melanin formation has been based on TYR (Deng et al., 2008; Wang et al., 2014; Yu et al., 2017). Tyrosine peptides are precursors of melanin (Yasunobu, 1957) and tyrosinase catalyzes three reactions in the synthesis of melanin in mammals (Fitzpatrick et al., 1950; Korner & Pawelek, 1982). The high relative expression of genes in the tyrosinase family (Guyonneau et al., 2004; Xue et al., 2018), including DCT (alias of TYRP2), TYR, and TYRP1 in MBF were similar to that observed in Nanping black-boned sheep (Deng et al., 2008). The melanin and pigmentation in the coat, skin, and muscle in Nanping black-boned sheep appears to be influenced by TYRP1 (Li et al., 2018), as well as the interaction of TYR with TYRP1 and DCT (Rad et al., 2004). Our results indicate that the high expression of the tyrosinase gene family, which encode the enzymes that form melanin, may be the major cause of the color phenotype in MBF sheep.

Other differentially expressed genes in our study were associated with pigmentation, including MC1R, OCA2, and PMEL. MC1R is a highly polymorphic gene and a melanocytic Gs protein-coupled receptor. Pigmentation, UV responses, and melanoma risk are regulated by the MC1R gene (Wolf Horrell, Boulanger & D’Orazio, 2016). Research has shown that the MC1R allelic variations are associated with black or red coat colors in Saudi sheep populations (Mahmoud et al., 2017), which provides the theoretical basis for selecting MC1R as the candidate gene in our study. Research has suggested that oculocutaneous albinism type 2 may be caused by mutations in the OCA2 (pink-eye dilution homolog) gene, resulting in diluted phenotypes (Reissmann & Ludwig, 2013) and sequence variations in OCA2 showed additional association with eye color (Mengel-From et al., 2010). The differentially expressed FZD2 gene used in our study is known to be involved in epidermal development (Brennan-Crispi et al., 2018). The expression of PMEL is limited to pigmented tissues, including skin melanocytes, uveal melanocytes, and the pigment epithelium of the retina and iris (Charon & Lipka, 2015; Theos et al., 2005). Our analysis identified no more than 20 candidate genes which could potentially regulate skin pigmentation in MBF sheep, including the tyrosinase gene family, MC1R, OCA2, and PMEL. Our results are supported by previous studies although further research should be conducted based on these candidate genes in MBF sheep. Some genes with documented influence on melanin were not differently expressed in these two breeds. Pigment deposition is influenced by ASIP (Fontanesi et al., 2009; Fontanesi et al., 2011; Zhang et al., 2017b) and MITF (Levy, Khaled & Fisher, 2006; Vachtenheim & Borovansky, 2010; Chen et al., 2018) but they were not differentially expressed in this study. One hundred seventy-one genes have been implicated in pigmentation variability across model organisms (e.g., the Color Genes database: http://www.espcr.org/micemut/), and the key genes that regulate the pigmentation of skin and hair through melanin production are different in different species due to the polygenic effect. Genes that play a regulatory role in other species may not work in sheep. There are no more than 15 genes associated with skin color in humans (Martin et al., 2017) and the number is similar to our result, but the individual genes differ. MITF and ASIP are not associated with skin color differences in humans but result in coloration differences in MBF sheep. MITF is required but is not found in sufficient amounts to induce the expression of melanogenic genes (Gaggioli et al., 2003). The result from Gaggioli et al. (2003) point to the existence of still-unknown regulatory mechanisms that cooperate or synergize with MITF to control melanogenic gene expression and melanin synthesis. This also explains why MITF is not a differential gene in our study. Research has shown that MITF is an activator of tyrosinase family genes and melanin biosynthesis, as it connects melanogenesis with other signaling pathways (Kim, Hwang & Yoon, 2014). We found that MITF is not a necessary regulatory factor for melanin synthesis in MBF sheep. ASIP is an important endogenous antagonist of melanocortin and MSH in vertebrate species (Lu et al., 1994; Jackson et al., 2006), but we did not find that is was associated with skin color.

Conclusions

The results from skin samples of Minxian black fur sheep showed greater amounts, and a more extensive distribution, of melanin in the skin. The skin samples were thinner than samples taken from white Small-tail Han sheep. A set of candidate genes that regulated melanin biosynthesis, including TYR, TYRP1, DCT, DDC, MC1R, COA 2 and FZD2 were identified as differentially expressed in Minxian black fur sheep skin samples. These genes appear to be integral for melanin synthesis through the melanogenesis and tyrosine metabolism signaling processes. Additional skin characterization of the Minxian black fur sheep may present the opportunity to clarify the genetic control of pigmentation.

Supplemental Information

Table S1. The date of skin thickness in the two breeds of sheep.

Each sample was tested five times in different positions, B and W refer to the MBF and STH sheep, respectively.

DOI: 10.7717/peerj.11122/supp-1
Table S2. Date of melanin content.

The content of melanin granules was determined by detecting the relative area of the granules in the sections of FM staining. The data in the table refers to the number of melanin spots, or the melanin area quantified by the software.

DOI: 10.7717/peerj.11122/supp-2
Table S3. Statistics and mapping results of RNA-seq data for 6 samples.
DOI: 10.7717/peerj.11122/supp-3
Table S4. Differentially expressed genes identified in Minxian Black Fur sheep and Small-Tail Han sheep by RNA-Seq.
DOI: 10.7717/peerj.11122/supp-4
Table S5. GO enrichment analysis of DEGs in MBF sheep and STH sheep.
DOI: 10.7717/peerj.11122/supp-5
Table S6. KEGG enrichment analysis of DEGs in MBF sheep and STH sheep.
DOI: 10.7717/peerj.11122/supp-6
Table S7. Candidate genes screened from the critical signal pathways and GO terms.
DOI: 10.7717/peerj.11122/supp-7

Acknowledgments

We thank the Minxian specialized sheep farming cooperatives in Min County, Gansu, China for providing the experimental animals.

Funding Statement

This work was supported by China’s Agricultural Research system (CARS-39-18), the Innovation team of the Gansu Academy of Agricultural Sciences, and the Key Research and Development Plan of Gansu Province (No. 18YF1NA091). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Contributor Information

Jianping Wu, Email: wujp@gsagr.ac.cn.

Xia Lang, Email: langxiax@163.com.

Additional Information and Declarations

Competing Interests

The authors declare there are no competing interests.

Author Contributions

Xiaolei Shi conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, and approved the final draft.

Jianping Wu, Xia Lang and David Greg Riley conceived and designed the experiments, authored or reviewed drafts of the paper, and approved the final draft.

Cailian Wang and Xiaoming Ma analyzed the data, prepared figures and/or tables, and approved the final draft.

Yan Bai and Lishan Liu performed the experiments, prepared figures and/or tables, and approved the final draft.

Animal Ethics

The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers):

This study was approved by the Animal Science and Technology, Gansu Agricultural University (approval number 2019-75).

Data Availability

The following information was supplied regarding data availability:

Data is available at NCBI SRA: PRJNA650174.

References

  • Alyass, Turcotte & Meyre (2015).Alyass A, Turcotte M, Meyre D. From big data analysis to personalized medicine for all: challenges and opportunities. BMC Med Genomics. 2015;8:33. doi: 10.1186/s12920-015-0108-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Audic & Claverie (1997).Audic SP, Claverie JM. The significance of digital gene expression profiles. Genome Research. 1997;7(10):986–995. doi: 10.1101/gr.7.10.986. [DOI] [PubMed] [Google Scholar]
  • Barbosa et al. (1984).Barbosa AJA, Castro LPF, Margarida A, Nogueira MF. A simple and economical Modification of the Masson-Fontana method for staining melanin granules and enterochromaffin cells. Stain Technology. 1984;59(4):193–196. doi: 10.3109/10520298409113855. [DOI] [PubMed] [Google Scholar]
  • Barsh (1996).Barsh GS. The genetics of pigmentation: from fancy genes to complex traits. Trends in Genetics. 1996;12(8):299–305. doi: 10.1016/0168-9525(96)10031-7. [DOI] [PubMed] [Google Scholar]
  • Bell & Wheeler (1986).Bell AA, Wheeler MH. Biosynthesis and functions of fungal melanins. Annual Review of Phytopathology. 1986;24:411–451. doi: 10.1146/annurev.py.24.090186.002211. [DOI] [Google Scholar]
  • Benjamini & Yekutieli (2001).Benjamini BY, Yekutieli D. The control of the false discovery rate in multiple testing under dependency. The Annals of Statistics. 2001;29(4):1165–1188. doi: 10.2307/2674075. [DOI] [Google Scholar]
  • Bennett & Lamoreux (2003).Bennett DC, Lamoreux ML. The color loci of mice—a genetic century. Pigment Cell Research. 2003;16:333–344. doi: 10.1034/j.1600-0749.2003.00067.x. [DOI] [PubMed] [Google Scholar]
  • Bourgeois et al. (2016).Bourgeois YXC, Bertrand JAM, Delahaie B, Cornuault J, Duval T, Milá B, Thébaud C. Candidate gene analysis suggests untapped genetic complexity in melaninbased pigmentation in birds. Journal of Heredity. 2016;107(4):327–335. doi: 10.1093/jhered/esw017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Brennan-Crispi et al. (2018).Brennan-Crispi DM, Xu M, Horrell J, Frankfurter M, Zhang Y, Morrisey EE, MIllar SE. Fzd2 controls multiple aspects of epidermal development through distinct signaling mechanisms. Journal of Investigative Dermatology. 2018;138(5):S223. doi: 10.1016/j.jid.2018.03.1330. [DOI] [Google Scholar]
  • Caro (2005).Caro TIM. The adaptive significance of coloration in mammals. BioScience. 2005;55(2):125–136. doi: 10.1641/0006-3568(2005)055[0125:TASOCI]2.0.CO;2. [DOI] [Google Scholar]
  • Carriel et al. (2011).Carriel VS, Aneiros-Fernandez J, Arias-Santiago S, Garzon IJ, Alaminos M, Campos A. A novel histochemical method for a simultaneous staining of melanin and collagen fibers. Journal of Histochemistry and Cytochemistry. 2011;59(3):270–277. doi: 10.1369/0022155410398001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Casadevall (2018).Casadevall A. Melanin triggers antifungal defences. Nature. 2018;555:319–320. doi: 10.1038/d41586-018-02370-x. [DOI] [PubMed] [Google Scholar]
  • Charon & Lipka (2015).Charon KM, Lipka KR. The effect of a coat colour-associated genes polymorphism on animal health—a review. Annals of Animal Science. 2015;15(1):3–17. doi: 10.2478/aoas-2014-0066. [DOI] [Google Scholar]
  • Chen et al. (2014).Chen JH, Chang JL, Chen PR, Chuang YJ, Tang ST, Pan SF, Lin TB, Chen KH, Chen MJ. Inhibition of peroxisome proliferator-activated receptor gamma prevents the melanogenesis in murine B16/F10 melanoma cells. BioMed Research International. 2014;2014:1–9. doi: 10.1155/2014/695797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chen et al. (2018).Chen T, Zhao B, Liu Y, Wang R, Yang Y, Yang L, Dong C. MITF-M regulates melanogenesis in mouse melanocytes. Journal of Dermatological Science. 2018;90(2):253–262. doi: 10.1016/j.jdermsci.2018.02.008. [DOI] [PubMed] [Google Scholar]
  • Choi, Kolbe & Hearing (2012).Choi W, Kolbe L, Hearing VJ. Characterization of the bioactive motif of neuregulin-1, a fibroblast-derived paracrine factor that regulates the constitutive color and the function of melanocytes in human skin. Pigment Cell Melanoma Res. 2012;25(4):477–481. doi: 10.1111/j.1755-148X.2012.01002.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chun et al. (2016).Chun Q, Peng L, Jianjun B, Qing W, Linna L, Guanxiang Q, Rrenbin J, Rong J. Differential expression of TYRP1 in adult human retinal pigment epithelium and uveal melanoma cells. Oncology Letters. 2016;11:2379–2383. doi: 10.3892/ol.2016.4280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Deng et al. (2008).Deng WD, Xi DM, Gou X, Yang SL, Shi XW, Mao HM. Pigmentation in black-boned sheep (Ovis aries): association with polymorphism of the tyrosinase gene. Molecular Biology Reports. 2008;35:379–385. doi: 10.1007/s11033-007-9097-z. [DOI] [PubMed] [Google Scholar]
  • Deng et al. (2006).Deng WD, Yang SL, Huo YQ, Gou X, Shi XW, Mao HM. Physiological and genetic characteristics of black-boned sheep (Ovis aries) Animal Genetics. 2006;37:586–588. doi: 10.1111/j.1365-2052.2006.01530.x. [DOI] [PubMed] [Google Scholar]
  • Dong, Yoshiaki & Vijayasaradhi (2002).Dong F, Yoshiaki T, Vijayasaradhi S. Selective down-regulation of tyrosinase family gene TYRP1 by inhibition of the activity of melanocytetranscription factor, MITF. Nucleic Acids Research. 2002;30(14):3096–3106. doi: 10.1093/nar/gkf424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Du et al. (2017).Du Z, Huang K, Zhao J, Song X, Xing X, Wu Q, Zhang L, Xu C. Comparative transcriptome analysis of raccoon dog skin to determine melanin content in hair and melanin distribution in skin. Scientific Reports. 2017;7(1):40903. doi: 10.1038/srep40903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fajuyigbe et al. (2018).Fajuyigbe D, Lwin SM, Diffey BL, Baker R, Tobin DJ, Sarkany RPE, Young AR. Melanin distribution in human epidermis affords localized protection against DNA photodamage and concurs with skin cancer incidence difference in extreme phototypes. FASEB Journal. 2018;32:3700–3706. doi: 10.1096/fj.201701472R. [DOI] [PubMed] [Google Scholar]
  • Fan et al. (2013).Fan R, Xie J, Bai J, Wang H, Tian X, Bai R, Jia X, Yang L, Song Y, Herrid M, Gao W, He X, Yao J, Smith GW, Dong C. Skin transcriptome profiles associated with coat color in sheep. BMC Genomics. 2013;14:389. doi: 10.1186/1471-2164-14-389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fitch et al. (2003).Fitch KR, McGowan KA, Raamsdonk CD, Fuchs H, Lee D, Puech A, Herault Y, Threadgill DW, Angelis MHrabede, Barsh GS. Genetics of dark skin in mice. Genes and Development. 2003;17:214–228. doi: 10.1101/gad.1023703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Fitzpatrick et al. (1950).Fitzpatrick TB, Becker SW, Lerner AB, Montgomery H. Tyrosinase in human skin: demonstration of its presence and of its role in human melanin formation. Science. 1950;112(2904):223–225. doi: 10.1126/science.112.2904.223. [DOI] [PubMed] [Google Scholar]
  • Fontanesi et al. (2010).Fontanesi L, Beretti F, Riggio V, Dall’Olio S, Calascibetta D, Russo V, Portolano B. Sequence characterization of the melanocortin 1 receptor (MC1R) gene in sheep with different coat colours and identification of the putative e allele at the ovine extension locus. Small Ruminant Research. 2010;91(2010):200–207. doi: 10.1016/j.smallrumres.2010.03.015. [DOI] [Google Scholar]
  • Fontanesi et al. (2009).Fontanesi L, Beretti F, Riggio V, Gomez Gonzalez E, Dall’Olio S, Davoli R, Russo V, Portolano B. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors. Cytogenet Genome Res. 2009;126:333–347. doi: 10.1159/000268089. [DOI] [PubMed] [Google Scholar]
  • Fontanesi et al. (2011).Fontanesi L, Dall’Olio S, Beretti F, Portolano B, Russo V. Coat colours in the Massese sheep breed are associated with mutations in the agouti signalling protein (ASIP) and melanocortin 1 receptor (MC1R) genes. Animal. 2011;5(1):8–17. doi: 10.1017/S1751731110001382. [DOI] [PubMed] [Google Scholar]
  • Gaggioli et al. (2003).Gaggioli C, Busca R, Abbe P, Ortonne JP, Ballotti R. Microphthalmia-associated transcription factor (MITF) is required but is not sufficient to induce the expression of melanogenic genes. Pigment Cell Research. 2003;16(4):374–382. doi: 10.1034/j.1600-0749.2003.00057.x. [DOI] [PubMed] [Google Scholar]
  • Gene Ontology (2015).Gene Ontology Consortium Gene ontology consortium: going forward. Nucleic Acids Research. 2015;43(D1):D1049–D1056. doi: 10.1093/nar/gku1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Guyonneau et al. (2004).Guyonneau L, Murisier F, Rossier A, Moulin A, Beermann F. Melanocytes and pigmentation are affected in dopachrome tautomerase knockout mice. Molecular and Cellular Biology. 2004;24(8):3396–3403. doi: 10.1128/MCB.24.8.3396-3403.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Jablonski (2004).Jablonski NG. The evolution of human skin and skin color. Annu. Rev. Anthropol. 2004;33:585–623. doi: 10.1146/annurev.anthro.33.070203.143955. [DOI] [Google Scholar]
  • Jackson et al. (2006).Jackson PJ, Douglas NR, Chai B, Binkley J, Sidow A, Barsh GS, Millhauser GL. Structural and molecular evolutionary analysis of Agouti and Agouti-related proteins. Chemistry & Biology. 2006;13:1297–1305. doi: 10.1016/j.chembiol.2006.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Jacobson & Tinnell (1993).Jacobson ES, Tinnell SB. Antioxidant function of fungal melanin. Journal of Bacteriology. 1993;175(21):7102–7104. doi: 10.1128/jb.175.21.7102-7104.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kim, Langmead & Salzberg (2015).Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nature Methods. 2015;12(4):357–360. doi: 10.1038/nmeth.3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kim, Hwang & Yoon (2014).Kim SH, Hwang SY, Yoon JT. Microarray-based analysis of the differential expression of melanin synthesis genes in dark and light-muzzle Korean cattle. PLOS ONE. 2014;9(5):e96453. doi: 10.1371/journal.pone.0096453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Korner & Pawelek (1982).Korner A, Pawelek J. Mammalian tyrosinase catalyzes three reactions in the biosynthesis of melanin. Science. 1982;217(4565):1163–1165. doi: 10.1126/science.6810464. [DOI] [PubMed] [Google Scholar]
  • Levy, Khaled & Fisher (2006).Levy C, Khaled M, Fisher DE. MITF: master regulator of melanocyte development and melanoma oncogene. Trends in Molecular Medicine. 2006;12(9):406–414. doi: 10.1016/j.molmed.2006.07.008. [DOI] [PubMed] [Google Scholar]
  • Li et al. (2017).Li L, Liu Y, Xue Y, Zhu J, Wang X, Dong Y. Preparation of a ferulic acid-phospholipid complex to improve solubility, dissolution, and B16F10 cellular melanogenesis inhibition activity. Chemistry Central Journal. 2017;11:26. doi: 10.1186/s13065-017-0254-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2018).Li G, Xiong H, Xi D, Memon S, Wang L, Liu X, Deng W. An examination of melanogenic traits and TYRP1 polymorphism in Nanping and Romney Marsh sheep breeds. Archives Animal Breeding. 2018;61:131–141. doi: 10.5194/aab-61-131-2018. [DOI] [Google Scholar]
  • Livak & Schmittgen (2001).Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • Love, Huber & Anders (2014).Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lu et al. (1994).Lu D, Willard D, Patel IR, Kadwell S, Overton L, Kost T, Luther M, Chen W, Woychik RP, Wilkison WO. Agouti protein is an antagonistof the melanocyte-stimulating hormone receptor. Nature. 1994;371(27):799–802. doi: 10.1038/371799a0. [DOI] [PubMed] [Google Scholar]
  • Luo et al. (2019).Luo M, Wang L, Yin H, Zhu W, Fu J, Dong Z. Integrated analysis of long non-coding RNA and mRNA expression in different colored skin of koi carp. BMC Genomics. 2019;20:515. doi: 10.1186/s12864-019-5894-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Mahmoud et al. (2017).Mahmoud AH, Mashaly AM, Rady AM, Al-Anazi KM, Saleh AA. Allelic variation of melanocortin-1 receptor locus in Saudi indigenous sheep exhibiting different color coats. Asian-Australasian Journal of Animal Sciences. 2017;30(2):154–159. doi: 10.5713/ajas.16.0138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Mao et al. (2005).Mao X, Cai T, Olyarchuk JG, Wei L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics. 2005;21(19):3787–3793. doi: 10.1093/bioinformatics/bti430. [DOI] [PubMed] [Google Scholar]
  • Marks & Seabra (2001).Marks MS, Seabra MC. The melanosome: membrane dynamics in black and white. Nature Reviews Molecular Cell Biology. 2001;2(10):738–748. doi: 10.1038/35096009. [DOI] [PubMed] [Google Scholar]
  • Martin et al. (2017).Martin AR, Lin M, Granka JM, Myrick JW, Liu X, Sockell A, Atkinson EG, Werely CJ, Möller M, Sandhu MS, Kingsley DM, Hoal EG, Liu X, Daly MJ, Feldman MW, Gignoux CR, Bustamante CD, Henn BM. An unexpectedly complex architecture for skin 1 pigmentation in Africans. Cell. 2017;171(6):1340–1353. doi: 10.1016/j.cell.2017.11.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Mengel-From et al. (2010).Mengel-From J, Borsting C, Sanchez JJ, Eiberg H, Morling N. Human eye colour and HERC2, OCA2 and MATP. Forensic Science International: Genetics. 2010;4(5):323–328. doi: 10.1016/j.fsigen.2009.12.004. [DOI] [PubMed] [Google Scholar]
  • Meredith & Riesz (2004).Meredith P, Riesz J. Radiative relaxation quantum yields for synthetic eumelanin. Photochemistry and photobiology. 2004;79(2):211–216. doi: 10.1562/0031-8655(2004)079¡0211:rcrqyf¿2.0.co;2. [DOI] [PubMed] [Google Scholar]
  • Pathak et al. (1962).Pathak MA, Riley FJ, Fitzpatrick TB, Curwen WL. Melanin formation in human skin induced by long-wave ultra-violet and visible light. Nature. 1962;193(4811):148–150. doi: 10.1038/193148a0. [DOI] [PubMed] [Google Scholar]
  • Pertea et al. (2016).Pertea M, Kim D, Pertea GM, Leek JT, Salzberg SL. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nature Protocols. 2016;11(9):1650–1667. doi: 10.1038/nprot.2016.095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Rad et al. (2004).Rad HH, Yamashita T, Jin HY, Hirosaki K, Wakamatsu K, Ito S, Jimbow K. Tyrosinase-related proteins suppress tyrosinase-mediated cell death of melanocytes and melanoma cells. Experimental Cell Research. 2004;298(2):317–328. doi: 10.1016/j.yexcr.2004.04.045. [DOI] [PubMed] [Google Scholar]
  • Rees (2003).Rees JL. Genetics of hair and skin color. Annual Review of Genetics. 2003;37(1):67–90. doi: 10.1146/annurev.genet.37.110801.143233. [DOI] [PubMed] [Google Scholar]
  • Reissmann & Ludwig (2013).Reissmann M, Ludwig A. Pleiotropic effects of coat colour-associated mutations in humans, mice and other mammals. Seminars in Cell & Developmental Biology. 2013;24(6–7):576–586. doi: 10.1016/j.semcdb.2013.03.014. [DOI] [PubMed] [Google Scholar]
  • Ren et al. (2017).Ren H, Wang G, Jiang J, Li J, Fu L, Liu L, Li N, Zhao J, Sun X, Zhang L, Zhang H, Zhou P. Comparative transcriptome and histological analyses provide insights into the prenatal skin pigmentation in goat (Capra hircus) Physiological Genomics. 2017;49(12):703–711. doi: 10.1152/physiolgenomics.00072.2017. [DOI] [PubMed] [Google Scholar]
  • Robbins & Nadeau (1993).Robbins SL, Nadeau HJ. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell. 1993;72(6):827–834. doi: 10.1016/0092-8674(93)90572-8. [DOI] [PubMed] [Google Scholar]
  • Seiji et al. (1963).Seiji M, Fitzpatrick TB, Simpson RT, Birbeck MSC. Chemical composition and terminology of specialized organelles (melanosomes and melanin rranules) in mammalian melanocytes. Nature. 1963;197:1082–1084. doi: 10.1038/1971082a0. [DOI] [PubMed] [Google Scholar]
  • Si et al. (2019).Si Y, Zhang L, Zhang L, Zhao F, Wang Q, Qian G, Yin S. Transcriptome analysis provides insight into the role of the melanin pathway in two differently pigmented strains of the turtle Pelodiscus sinensis. Development Genes and Evolution. 2019;229:183–195. doi: 10.1007/s00427-019-00639-3. [DOI] [PubMed] [Google Scholar]
  • Singaravelan et al. (2008).Singaravelan N, Grishkan I, Beharav A, Wakamatsu K, Ito S, Nevo E. Adaptive melanin response of the soil fungus Aspergillus niger to UV radiation stress at Evolution Canyon, Mount Carmel, Israel. PLOS ONE. 2008;3(8):e2993. doi: 10.1371/journal.pone.0002993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Singaravelan et al. (2010).Singaravelan N, Pavlicek T, Beharav A, Wakamatsu K, Ito S, Nevo E. Spiny mice modulate eumelanin to pheomelanin ratio to achieve cryptic coloration in evolution canyon, Israel. PLOS ONE. 2010;5(1):e8708. doi: 10.1371/journal.pone.0008708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Song et al. (2017).Song X, Xu C, Liu Z, Yue Z, Liu L, Yang T, Cong B, Yang F. Comparative transcriptome analysis of mink (Neovison vison) skin reveals the key genes involved in the melanogenesis of black and white coat colour. Scientific Reports. 2017;7:1. doi: 10.1038/s41598-017-12754-0. 12461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sreedharan et al. (2014).Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Gornitz N, Zeller G, Ratsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics. 2014;30(9):1300–1301. doi: 10.1093/bioinformatics/btt731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Swift (1964).Swift JA. Transfer of melanin granules from melanocytes to the cortical cells of human hair. Nature. 1964;203(4948):976–977. doi: 10.1038/203976b0. [DOI] [PubMed] [Google Scholar]
  • Theos et al. (2005).Theos AC, Truschel ST, Raposo G, Marks MS. The Silver locus product Pmel17/gp100/Silv/ME20: controversial in name and in function. Pigment Cell Research. 2005;18(5):322–336. doi: 10.1111/j.1600-0749.2005.00269.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Tobin & Bystryn (1996).Tobin DJ, Bystryn JC. Different populations of melanocytes are present in hair follicles and epidermis. Pigment Cell Research. 1996;9(6):304–310. doi: 10.1111/j.1600-0749.1996.tb00122.x. [DOI] [PubMed] [Google Scholar]
  • Trapnell et al. (2010).Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, Van Baren MJ, Salzberg SL, Wold BJ, Pachter L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511–515. doi: 10.1038/nbt.1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Trivedi & Gandhi (2017).Trivedi A, Gandhi J. The evolution of human skin color. JAMA Dermatology. 2017;153(11):1165–1165. doi: 10.1001/jamadermatol.2017.3695. [DOI] [PubMed] [Google Scholar]
  • Vachtenheim & Borovansky (2010).Vachtenheim J, Borovansky J. Transcription physiology of pigment formation in melanocytes: central role of MITF. Experimental Dermatology. 2010;19(7):617–627. doi: 10.1111/j.1600-0625.2009.01053.x. [DOI] [PubMed] [Google Scholar]
  • Vetrini et al. (2004).Vetrini F, Auricchio A, Du J, Angeletti B, Fisher DE, Ballabio A, Marigo V. The microphthalmia transcription factor (Mitf) controls expression of the ocular albinism type 1 gene: link between melanin synthesis and melanosome biogenesis. Molecular and Cellular Biology. 2004;24(15):6550–6559. doi: 10.1128/mcb.24.15.6550-6559.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2014).Wang Y, Li SM, Huang J, Chen SY, Liu YP. Mutations of TYR and MITF Genes are asociated with plumage colour phenotypes in geese. Asian-Australasian Journal of Animal Sciences. 2014;27:778–783. doi: 10.5713/ajas.2013.13350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2018).Wang G, Liao J, Tang M, Yu S. Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens. British Poultry Science. 2018;59(4):21–27. doi: 10.1080/00071668.2017.1379053. [DOI] [PubMed] [Google Scholar]
  • Wang et al. (2016).Wang H, Xue L, Y L, Zhao B, Chen T, Liu Y, Chang L, Wang J. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors. Folia Histochemica et Cytobiologica. 2016;54(3):143–150. doi: 10.5603/FHC.a2016.0015. [DOI] [PubMed] [Google Scholar]
  • Wei et al. (2015).Wei C, Wang H, Liu G, Wu M, Cao J, Liu Z, Liu R, Zhao F, Zhang L, Lu J, Liu C, Du L. Genome-wide analysis reveals population structure and selection in Chinese indigenous sheep breeds. BMC Genomics. 2015;16:194. doi: 10.1186/s12864-015-1384-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • West & Packer (2002).West PM, Packer C. Sexual selection, temperature, and the lion’s mane. Science. 2002;297(5885):1339–1343. doi: 10.2307/3832107. [DOI] [PubMed] [Google Scholar]
  • Wolbarsht, Walsh & George (1981).Wolbarsht ML, Walsh AW, George G. Melanin, a unique biological absorber. Applied Optics. 1981;20(13):2184–2186. doi: 10.1364/ao.20.002184. [DOI] [PubMed] [Google Scholar]
  • Wolf Horrell, Boulanger & D’Orazio (2016).Wolf Horrell EM, Boulanger MC, D’Orazio JA. Melanocortin 1 receptor: structure, function, and regulation. Frontiers in Genetics. 2016;7:95. doi: 10.3389/fgene.2016.00095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Xue et al. (2018).Xue L, Li Y, Zhao B, Chen T, Dong Y, Fan R, Li J, Wang H, He X. TRP2 mediates coat color pigmentation in sheep skin. Molecular Medicine Reports. 2018;17:5869–5877. doi: 10.3892/mmr.2018.8563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yasunobu (1957).Yasunobu K. Tyrosine peptides as precursors of melanin in mammals. Nature. 1957;180(4583):441–442. doi: 10.3892/mmr.2018.8563. [DOI] [PubMed] [Google Scholar]
  • Yu et al. (2017).Yu S, Liao J, Tang M, Wang Y, Wei X, Mao L, Zeng C. A functional single nucleotide polymorphism in the tyrosinase gene promoter affects skin color and transcription activity in the black-boned chicken. Poultry Science. 2017;96(11):4061–4067. doi: 10.3382/ps/pex217. [DOI] [PubMed] [Google Scholar]
  • Yu et al. (2018).Yu S, Wang G, Liao J, Tang M, Sun W. Transcriptome profile analysis of mechanisms of black and white plumage determination in black-bone chicken. Cellular Physiology and Biochemistry. 2018;46(6):2373–2384. doi: 10.1159/000489644. [DOI] [PubMed] [Google Scholar]
  • Zhang et al. (2017b).Zhang X, Li W, Liu C, Peng X, Lin J, He S, Li X, Han B, Zhang N, Wu Y, Chen L, Wang L, Yila M, Huang J, Liu M. Alteration of sheep coat color pattern by disruption of ASIP gene via CRISPR Cas9. Scientific Reports. 2017b;7:8149. doi: 10.1038/s41598-017-08636-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zhang et al. (2017a).Zhang L, Sun F, Jin H, Dalrymple BP, Cao Y, Wei T, Vuocolo T, Zhang M, Piao Q, Ingham AB. A comparison of transcriptomic patterns measured in the skin of Chinese fine and coarse wool sheep breeds. Scientific Reports. 2017a;7:14301. doi: 10.1038/s41598-017-14772-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1. The date of skin thickness in the two breeds of sheep.

Each sample was tested five times in different positions, B and W refer to the MBF and STH sheep, respectively.

DOI: 10.7717/peerj.11122/supp-1
Table S2. Date of melanin content.

The content of melanin granules was determined by detecting the relative area of the granules in the sections of FM staining. The data in the table refers to the number of melanin spots, or the melanin area quantified by the software.

DOI: 10.7717/peerj.11122/supp-2
Table S3. Statistics and mapping results of RNA-seq data for 6 samples.
DOI: 10.7717/peerj.11122/supp-3
Table S4. Differentially expressed genes identified in Minxian Black Fur sheep and Small-Tail Han sheep by RNA-Seq.
DOI: 10.7717/peerj.11122/supp-4
Table S5. GO enrichment analysis of DEGs in MBF sheep and STH sheep.
DOI: 10.7717/peerj.11122/supp-5
Table S6. KEGG enrichment analysis of DEGs in MBF sheep and STH sheep.
DOI: 10.7717/peerj.11122/supp-6
Table S7. Candidate genes screened from the critical signal pathways and GO terms.
DOI: 10.7717/peerj.11122/supp-7

Data Availability Statement

The following information was supplied regarding data availability:

Data is available at NCBI SRA: PRJNA650174.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES