A Novel Esterase, DacA_pva, from Comamonas sp. Strain NyZ500 with Deacetylation Activity for the Acetylated Polymer Polyvinyl Alcohol

Water-soluble PVA, which possesses a very robust ability to accumulate in the environment, has a very grave environmental impact due to its widespread use in industrial and household applications. On the other hand, chemical transformation of PVA derivatives is currently being carried out under high-energy-consumption and high-pollution conditions using hazardous chemicals (such as NaOH and methanol) under high temperatures.

ABSTRACT

As a water-soluble polymer, the widely used polyvinyl alcohol (PVA) is produced from hydrolysis of polyvinyl acetate. Microbial PVA carbon backbone cleavage via a two-step reaction of dehydrogenation and hydrolysis has been well studied. The content of the acetyl group is a pivotal factor affecting performance of PVA derivatives in industrial applications, and deacetylation is a nonnegligible part of PVA degradation. However, the genetics and biochemistry of its deacetylation remain largely elusive. Here, Comamonas sp. strain NyZ500 was isolated for its capability of growing on acetylated PVA from activated sludge. The spontaneous PVA utilization-deficient mutant strain NyZ501 was obtained when strain NyZ500 was cultured in rich media. Comparative analysis between the genomes of these two strains revealed a fragment (containing a putative hydrolase gene, dacA_pva) deletion in strain NyZ501, and in the dacA_pva-complemented strain NyZ501 the ability to grow on PVA was restored. DacA_pva, which shares 21% identity with xylan esterase AxeA1 from Prevotella ruminicola 23, is a unique deacetylase catalyzing the conversion of acetylated PVA and its derivatives to deacetylated counterparts. This indicates that strain NyZ500 utilizes acetylated PVA via acetate as a carbon source to grow. DacA_pva also possesses the ability to deacetylate acetylated xylan and the antibiotic intermediate 7-aminocephalosporanic acid (7ACA), but the enzymes responsible for the conversion of those two compounds have no activity against PVA derivatives. This study enhanced our understanding of the diversity of microbial degradation of PVA, and DacA_pva characterized here is also a potential biocatalyst for the eco-friendly biotransformation of PVA derivatives and other acetylated compounds.

IMPORTANCE Water-soluble PVA, which possesses a very robust ability to accumulate in the environment, has a very grave environmental impact due to its widespread use in industrial and household applications. On the other hand, chemical transformation of PVA derivatives is currently being carried out under high-energy-consumption and high-pollution conditions using hazardous chemicals (such as NaOH and methanol) under high temperatures. The DacA_pva reported here performs PVA deacetylation under mild conditions, so it has great potential to be developed into an eco-friendly biocatalyst for biotransformation of PVA derivatives. DacA_pva also has deacetylation activity for compounds other than PVA derivatives, which facilitates its development into a broad-spectrum deacetylation biocatalyst for production of certain desired compounds.

INTRODUCTION

Polyvinyl alcohol (PVA) and its derivatives are widely used in the manufacturing of papers, textiles, adhesives, coatings, and membranes as well as in drug delivery (1–3). Thousands of kilometric tons of PVA are produced annually (1). The countries in Asia (especially China and Japan) and Western Europe, as well as the United States, are the most significant contributors of PVA production and consumption (4). PVA is distinctly different from other polymers because of its water solubility (5, 6). Industrial-scale production of PVA was conducted by hydrolysis of polyvinyl acetate as shown in Fig. 1. PVA with different contents of acetyl groups was produced with the control set as the degree of polyvinyl acetate hydrolysis. The content of acetyl groups is an important factor affecting the physicochemical properties of PVA derivatives. A case in point is that fully hydrolyzed PVA (the degree of hydrolysis [DH] is about 98% to 99.8%) can only be dissolved in water at temperatures over 80°C, while partially hydrolyzed PVA can often be dissolved in water at lower temperatures (7). Another good example termed “stickies control” is used in the pulp and paper industry, where polyvinyl acetate serving as “stickies” is hydrolyzed to a less sticky form by removing the acetyl groups (8). Commonly used PVA derivatives and their property parameters are listed in Table 1.

FIG 1.

Chemical production of polyvinyl alcohol (PVA). PVA, a water-soluble polymer, is produced from polyvinyl acetate by hydrolysis. The partially or fully hydrolyzed PVA is produced under the control of the degree of polyvinyl acetate hydrolysis, which can be achieved by controlling the ratio of catalyst (NaOH), solvent (menthol), and substrate (polyvinyl acetate).

TABLE 1.

PVA and derivatives used in this study

PVA or derivative	Degree of polymerization	Degree of hydrolysis (%)b
Polyvinyl acetate	NAa	0
PVA1788	1,700	88
PVA1799	1,700	99
PVA105	500	99
PVAxx78	NAa	78

^aNA, not available.

^bDegree of hydrolysis (DH) is a parameter representing the content of acetyl groups (or hydroxyl groups) in PVA. The higher the hydrolysis degree is, the less acetyl groups (or the more hydroxyl groups) are in PVA.

PVA was considered a “green polymer” and truly biodegradable material because of its excellent hydrophilicity and bioavailability. Previous reports have clearly revealed the mechanism of bacterial PVA carbon backbone cleavage, which was accomplished by a two-step reaction (4, 9, 10). First, PVA was catalyzed by an oxidase (11, 12) or dehydrogenase (13–15) to form a breakpoint structure of β-diketone or β-hydroxyl ketone, and then the carbon backbone was cleaved by a β-diketone hydrolase (11, 16, 17) or aldolase (13) at the breakpoint to form fragmented organic ketone, aldehyde, or acid. The content of acetyl groups in PVA is one of the factors affecting its degradation (9, 10). It was generally considered that a content of less than 20% of acetyl groups has no significant effect on PVA degradation (10, 18). However, it has also been shown that PVA with 72% DH caused significant growth delay in PVA-degrading microorganisms compared to that with higher DH (19). A similar result was that PVA with high DH is better for growth of, and PVA-degrading enzyme production by, Streptomyces venezuelae GY1 compared with PVA with low DH (20). The presence of acetyl groups requires PVA-degrading microorganisms to possess specific hydrolytic enzymes to remove the acetyl groups. However, most reported PVA degraders do not have such enzymes, thus hampering its degradation (9). Interestingly, an esterase that functioned in PVA deacetylation was purified from PVA utilizer Pseudomonas vesicularis PD and 30 residues at its N terminus were determined (21). On the other hand, commercial cutinases (22) and an inefficient esterase from Pseudomonas putida mt-2 (23) also showed modest deacetylation activities toward polyvinyl acetate. So far, reports on biochemical characterization of deacetylation of PVA derivatives are extremely scarce, and no gene encoding such an enzyme was characterized. In this study, we initially aimed to isolate a bacterial strain capable of utilizing PVA via “C-C” backbone cleavage, but it turned out that the isolated PVA degrader Comamonas sp. strain NyZ500 was grown on acetate sourced from PVA hydrolysis catalyzed by a novel enzyme. We report here its characterization as an acetyl esterase with activity for deacetylation of partially hydrolyzed PVA, its derivatives, and other acetyl compounds. It will enhance our understanding of microbial diversity in PVA degradation and may provide a potential biocatalyst for the conversion of other acetyl compounds.

RESULTS

Isolation and characterization of strain NyZ500 grown on PVA1788.

Selective enrichment with PVA1788 (PVA derivatives and their property parameters are listed in Table 1) as the sole carbon source yielded an isolate designated strain NyZ500. Taxonomical classification based on its 16S rRNA gene sequence revealed that strain NyZ500 comes from the genus Comamonas, and it was identified as Comamonas sp. strain NyZ500, which was deposited to the China Center for Type Culture Collection (CCTCC); its catalog number is CCTCC M 2021114. This strain utilized acetylated PVA1788 and PVAxx78 for growth but was unable to grow with PVA105 or PVA1799, both with a higher degree of hydrolysis (99%) than PVA1788 (88%) and PVAxx78 (78%) (Fig. 2a). The sequenced draft genome (5.4 Mb) of strain NyZ500 consists of 66 scaffolds in total.

FIG 2.

Growth curves of strains NyZ500, NyZ501, and dacA_pva-complemented NyZ501. (a) Strain NyZ500 was grown on PVA1788 as the sole carbon and energy source. (b) Complementation of the dacA_pva gene in NyZ501 restored its ability to utilize PVA1788. Cultivation was carried out in 100 ml of liquid carbon-free basal medium (LCFBM) with 0.3% (wt/vol) PVA1788 serving as the carbon and energy source. Data points represent the mean values of triplicate trials, and error bars indicate standard deviations.

Spontaneous deletion of gene dacA_pva in strain NyZ500 resulted in PVA1788 utilization deficiency.

Generally, the degradation phenotypes of xenobiotic-metabolizing bacteria are not stable since many catabolic genes are part of mobile genetic elements (e.g., catabolic transposons), which facilitate interspecies or intraspecies transmissions of catabolic genes (24, 25). Consistent with the expectation, the phenotype of PVA1788 utilization in strain NyZ500 was unstable. One such mutant, which was designated strain NyZ501 and lost the ability to utilize PVA1788 for its growth (Fig. 2b), was obtained by continuous cultivation of wild-type strain NyZ500 on lysogeny broth (LB) medium. In order to explore the cause of its growth deficiency on PVA1788, all 14 annotated transposases in the genome of strain NyZ500 were screened against strain NyZ501 by PCR. A segment deletion in the genome of strain NyZ501 was observed compared to its locus in the chromosome of strain NyZ500. A scaffold that included an annotated putative hydrolase gene designated dacA_pva and an adjacent IS5 family transposase gene was lost in the genome of NyZ501. To further characterize the significance of the dacA_pva gene to utilize PVA1788, gene dacA_pva was transformed into strain NyZ501. The complementation of the dacA_pva gene in strain NyZ501 restored its ability to utilize PVA1788 (Fig. 2b). In addition, gene dacA_pva transcription levels were increased by 5 to 10 times when incubated with PVA1788 as well as other compounds with acetyl groups (xylan and 7-aminocephalosporanic acid [7ACA]), as revealed by reverse transcription-quantitative PCR (qRT-PCR) analysis. These results indicated that the dacA_pva gene was essential for PVA1788 utilization in strain NyZ500.

DacA_pva is a novel member of SGNH/GDSL family hydrolases.

The GDSL/SGNH hydrolase family was featured as the presence of four strictly conserved residues, Ser-Gly-Asn-His, in four conserved blocks, I, II, III, and V, respectively (26, 27). Sequence analysis showed that the dacA_pva gene consists of 1,284 bp and encodes a protein of 427 amino acids. A putative signal peptide was at the N terminus of DacA_pva, with the most likely cleavage site located between residues Gly₃₀ and Cys₃₁, theoretically resulting in a 397-residue mature protein. A BLASTp search against the nonredundant (nr) protein sequence database revealed that DacA_pva exhibited moderate sequence identity (highest identity is 61%) with many hypothetical SGNH/GDSL family proteins whose secondary structures are composed of a typical SGNH_hydro domain. A search for manually annotated and reviewed sequences in Swiss-Prot with the BLASTp program was unsuccessful because of low identity, and then a domain enhanced lookup time accelerated BLAST (DELTA-BLAST) was used instead to search for distant homologues. Among the functionally characterized proteins, DacA_pva shared the highest identify (21%) with AxeA1 (GenPept accession number D5EV35.1), which catalyzes the hydrolysis of xylan analogs. Amino acid sequence alignment showed the presence of the conserved residues of SGNH/GDSL family hydrolases in DacA_pva, with Ser₂₂₇, Gly_267, Asn₃₀₃, and His₄₀₈ residing on blocks I, II, III, and V, respectively (Fig. 3a). Apart from containing a signature SGNH_hydro domain at the C terminus, a stretch of approximately 180 residues without evident domains was found to be situated on the N terminus of DacA_pva, but it is absent in all other characterized SGNH family hydrolases (Fig. 3b). The truncated DacA_pva omitting this stretch was not successfully expressed (data not shown). Furthermore, phylogenetic analysis between DacA_pva and other reported SGNH hydrolases showed that DacA_pva occupied a distinct branch (Fig. 3c). Collectively, these analyses indicated that DacA_pva seemed to be a novel member of SGNH/GDSL family hydrolases and that the N-terminal domain of DacA_pva may be involved in protein scaffold construction and substrate specificity maintenance via interacting with the SGNH_hydro domain.

FIG 3.

Sequence analysis of DacA_pva. (a) Amino acid sequence alignment of DacA_pva with other proteins belonging to the SGNH/GDSL family. The sequences used for alignment were retrieved from NCBI, including proteins from Oxalobacteraceae bacterium (GenPept accession number RYE79050.1), Variovorax sp. (GenPept accession numbers RZL47615 and RZL53423), Caenimonas sp. strain SL110 (WP_082151425), and Pseudomonas acidophila (WP_096717652). All the sequences were aligned by ClustalW and rendered with ESPript (38). The blue box highlights relatively conserved residues, and the red background describes absolutely conserved residues. Four conserved blocks, I, II, III, and V, in GDSL family proteins are bracketed, and four conserved residues, S-G-N-H, located in the four blocks are marked with black arrows. (b) Domain analyses of DacA_pva showing an N-terminal signal peptide (SP), a C-terminal SGNH_hydro domain, and a large functionally unknown region (FUR) at the N terminus. The N-terminal amino acid sequences of DacA_pva and esterase from Pseudomonas vesicularis strain PD are displayed for comparison. (c) Evolutionary relationship of DacA_pva with its homologs. The evolutionary history was inferred using the neighbor-joining method (39). The bootstrap consensus tree inferred from 1,000 replicates represents the evolutionary history of the taxa analyzed (40). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Evolutionary analyses were conducted in MEGA5 (41). The enzyme DacA_pva characterized in this study is labeled with a star.

DacA_pva catalyzes deacetylation of partially hydrolyzed PVA and polyvinyl acetate.

Expressed recombinant DacA_pva was purified from Escherichia coli BL21(DE3) as an N-terminally His₆-tagged fusion protein, and its purity and expected size (44 kDa) were confirmed by SDS-PAGE analysis. Deacetylation activity on PVA was characterized by measuring the amount of released acetate and acetyl groups that remained in PVA via high-performance liquid chromatography (HPLC) and Fourier transform infrared spectroscopy (FTIR), respectively. With the extension of the reaction period, the yield of acetate product was increased, while the substrate PVA was completely deacetylated within 40 min (Fig. 4) under conditions specified in Materials and Methods. The difference between the acetyl content of PVA and the value of acetate released is likely due to the different analytic methods applied. As expected, the insoluble substrate polyvinyl acetate was more difficult to be hydrolyzed than the soluble substrate PVA (specific activities of DacA_pva for PVA1788, PVAxx78, and polyvinyl acetate were 272.79 ± 12.02 U/mg, 308.47 ± 12.25 U/mg, and 12.71 ± 2.71 U/mg, respectively), consistent with the fact that strain NyZ500 was incapable of growing on polyvinyl acetate. The possibility of inhibitors being present in polyvinyl acetate was excluded by observing normal growth of strain NyZ500 after adding sodium acetate (2 mM) to the medium with polyvinyl acetate.

FIG 4.

Time course of PVA1788 deacetylation by DacA_pva. DacA_pva was added into 500 μl PVA1788 solution (3%, wt/vol) dissolved in PB buffer (100 mM, pH 7.4), and the reaction for the appropriate time was at 37°C; the reactions were stopped by boiling at 85°C for 10 min, and the released acetate (solid circle) from PVA in the reaction fluid was analyzed by HPLC. The acetyl content (empty circle) in PVA1788 was analyzed by FTIR (Fourier transform infrared spectroscopy) after drying thoroughly. Data points represent the mean values of triplicate trials, and error bars indicate standard deviations.

The substrate specificity of the purified DacA_pva was examined with other acetylated compounds, including cellulose acetate, ethylene vinyl acetate (EVA), acetylated xylan, and 7ACA. Among these compounds, only acetylated xylan and 7ACA can be deacetylated by DacA_pva, as shown in Fig. 5. On the other hand, two identified SGNH hydrolases, EstD1 (GenBank accession number AIY63728.1) (28) and AxeA1 (GenBank accession number D5EV35.1) (29), closely related to DacA_pva in the phylogenetic analysis (Fig. 3c), happened to be the active enzymes for 7ACA and acetylated xylan. Then, a comparative study of these three enzymes was performed to detect their activity against PVA and its derivatives. It turned out that only DacA_pva was capable of deacetylating all PVA derivatives tested. However, neither AxeA1 nor EstD1 exhibited detectable activities toward the above PVA derivatives.

FIG 5.

Deacetylation of acetylated xylan and 7ACA by DacA_pva. HPLC traces of the metabolites from DacA_pva-catalyzed deacetylation of acetylated xylan (Ac_xylan) (a) and 7ACA (b). Deacetylation of acetylated xylan was monitored by detection of acetate using HPLC. Substrate 7ACA and product D7ACA were analyzed by HPLC. The same reaction system without DacA_pva served as a negative control for both reactions.

DISCUSSION

The global production of PVA and its environmental problems have been reviewed previously (28). Microbial degradation of PVA has been investigated in several PVA utilizers at the biochemical and molecular levels, but they are limited to degradation via carbon backbone cleavage through a two-step reaction of dehydrogenation and hydrolysis (9, 10). On the other hand, PVA with different contents of acetyl groups as a side chain is very common in industrial applications (4), and the presence of acetyl groups has been shown to give rise to an increase in the difficulty of PVA degradation to some extent (19, 20). However, studies on PVA deacetylation are limited. The esterase activities were only detected intracellularly from several PVA-utilizing strains (20, 21), but there are no reports on the genes encoding enzymes involved in PVA deacetylation. Since it shares only 21% and 20% identity with its closest characterized homologs xylan esterase AxeA1 and 7ACA esterase EstD1, respectively, but has exclusive PVA deacetylation activity compared to its counterparts, DacA_pva from Comamonas sp. strain NyZ500 in this study represents a novel esterase catalyzing the deacetylation of PVA to produce acetate, which serves as the carbon source for the growth of this PVA utilizer.

Horizontal gene transfer (HGT) could circumvent the slow step of complete gene creation and accelerate genome innovation by rapidly introducing new genes into existing genomes (24, 29). To survive in an environment where PVA is abundant, one of the ubiquitous Comamonas strains (the predecessor of strain NyZ500) may have recruited dacA_pva through HGT to liberate acetate from inert PVA as a carbon source for its growth, resulting in the birth of strain NyZ500. This is supported by the presence of an IS5 family transposon adjacent to dacA_pva and absence of homologs of dacA_pva among available genomes of Comamonas strains.

So far, the only identified esterase specific for PVA deacetylation comes from PVA utilizer Pseudomonas vesicularis PD (21). For PVA deacetylation, this purified native enzyme showed a specific activity of 6.52 U/mg for PVA500 (0.5% [wt/vol]; DP, 500; DH, 86.5 to 89.0%) at 30°C. The corresponding activities of DacA_pva for PVA1788 (3% [wt/vol]; DP, 1,700; DH, 88%) and PVAxx78 (3% [wt/vol]; DP, unknown; DH, 78%) were 272.79 and 308.47 U/mg, respectively, at 37°C. DacA_pva reported here was more efficient than the esterase of Pseudomonas vesicularis PD at deacetylation of PVA. In contrast to the esterase which was localized in the cytoplasm of strain PD (21), DacA_pva was predicted to function in the periplasmic space. Furthermore, the available sequence of 30 amino acids at the N terminus of purified esterase from strain PD significantly differs from its counterpart of DacA_pva, as shown in Fig. 3b. Despite both having deacetylation activity against PVA, the differences in their subcellular locations, catalytic activities, and N-terminal sequences clearly indicate that the esterases from strains PD and DacA_pva are not the same deacetylase.

DacA_pva identified in this study is also a promising biocatalyst for the deacetylation of PVA derivatives and other acetylated compounds which are useful in industrial applications (8, 30). In addition to the efficient deacetylation of PVA derivatives, DacA_pva also exhibits deacetylation activity toward other acetylated compounds, such as acetyl xylan and 7ACA. Its property of extended activity is favorable for its development as a potential broad-spectrum deacetylation biocatalyst. On the other hand, DacA_pva also holds promise for conversion of polyvinyl acetate to PVA with various degrees of hydrolysis under mild reaction conditions, but with the drawback of limited ability to catalyze the water-insoluble substrate polyvinyl acetate. This could be improved by protein engineering (31). The advantage of enzymatic conversion of PVA and its derivatives is that it could bypass the use of toxic chemicals and reduce energy consumption, generating an eco-friendly conversion route.

MATERIALS AND METHODS

Chemicals, media, plasmids, primers, and bacterial strains used in this study.

Polyvinyl acetate was purchased from Sinopharm Chemical Reagent Co., Ltd., Shanghai, China, and its average molecular weight is 30 to 50 kDa. PVA with different degrees of polymerization and hydrolysis (listed in Table 1) is from Aladdin Industrial Corporation, Shanghai, China. Acetylated xylan from corn cob is from Meryer Chemical Technology Co., Ltd. Shanghai, China. The chemicals 7-aminocephalosporanic acid (7ACA) and 7-amino-deacetylcephalosporanic acid (D7ACA) are from Bide Pharmatech Ltd., Shanghai, China.

Lysogeny broth (LB) (32) and liquid carbon-free basal medium (LCFBM) (33) were prepared as previously reported, and their corresponding agar media were prepared by adding 1.5% (wt/vol) agar. Plasmids, primers, and bacterial strains used in this study are listed in Table 2.

TABLE 2.

Plasmid, primers, and bacterial strains used in this study

Plasmid, primer, or strain	Description or sequence (5′ to 3′)	Source or reference no.
Plasmids
pET-28a(+)	Overexpression vector for E. coli, Kmr	Novagen
pBBR1MCS-2	Broad-host-range vector, Kmr	42
Primers
F(dacApva-MCS)	AGGGAACAAAAGCTGGGTACCGATGTATAAACTAAAGCCCAATCCATTT	This study
R(dacApva-MCS)	CAGGAATTCGATATCAAGCTTCTATTGTAACTTGCTAAGATCAATTGCC	This study
F(dacApva-pET)	GTGCCGCGCGGCAGCCATATGGGAAGCAACGATAACGCCAA	This study
R(dacApva-pET)	ACGGAGCTCGAATTCGGATCCCTATTGTAACTTGCTAAGATCAATTGCC	This study
F(16S-qPCR)	AGCAACTAATGGCAAGGG	This study
R(16S-qPCR)	GCGGTGGATGATGTGGT	This study
F(dacApva-qPCR)	AAACTAAAGCCCAATCCA	This study
R(dacApva-qPCR)	GGTCGCATCAGACATCG	This study
Bacterial strains
E. coli DH5a	supE44 ΔlacU169 (φ80dlacZΔM15) hsdR17 recA1 endA1 thi-1 gyrA96 relA1	Novagen
E. coli BL21(DE3)	F− ompT hsdSB(rB−mB−) gal (λcI857 ind1 Sam7 nin5 lac UV5-T7 gene 1) dcm (DE3)	Novagen
Comamonas sp. strain NyZ500	Wild type, PVA1788+	This study
Comamonas sp. strain NyZ501	Spontaneous mutant of strain NyZ500, PVA1788−	This study
Comamonas sp. strain NyZ501 (dacApva)	Strain NyZ501 complemented with dacApva gene with pBBR1MCS-2	This study

Isolation of PVA1788 degrader.

Activated sludge from sewage treatment plants was added into LCFBM containing 0.3% (wt/vol) PVA1788 and served as an enrichment medium, which was incubated at 30°C with shaking at 180 rpm. A fraction of turbid culture was subcultured into fresh medium as above for second-round enrichment. After three rounds of such enrichments, a PVA degrader was obtained by spreading the enrichment culture on agar LCFBM containing 0.3% PVA1788 (wt/vol), and an emerged pure colony was subjected to taxonomic classification based on its 16S rRNA gene amplified using universal primers 27F and 1492R (34).

Draft genome sequencing of PVA degrader.

A single colony of PVA degrader strain NyZ500 was cultured with 100 ml LB medium plus 0.3% (wt/vol) PVA1788 until the optical density at 600 nm (OD₆₀₀) reached 0.8. The cells were washed and harvested for genome extraction before being sequenced using an Illumina HiSeq 4000 system (Illumina, San Diego, CA, USA) at the Beijing Genomics Institute.

Acquisition of a PVA1788 utilization mutant derived from strain NyZ500.

A spontaneous mutant (designated strain NyZ501) deficient in PVA1788 utilization was obtained when strain NyZ500 was cultured on an LB plate. Considering that spontaneous mutations are most likely caused by transposition, all annotated transposase-encoding genes in the genome of strain NyZ500 were screened by PCR to locate the possible mutation site in strain NyZ501. A fragment containing such a mutation site, as well as its flanking sequence, was PCR amplified from strain NyZ500 and sequenced to reveal the genes spontaneously deleted.

Complementation of PVA1788 utilization-deficient mutant strain NyZ501 with dacA_pva.

The entire dacA_pva gene was amplified from the strain NyZ500 genome with primers F(dacA_pva-MCS) and R(dacA_pva-MCS) (listed in Table 2) and then fused into pBBR1MCS-2 by using a One Step cloning kit (Vazyme, Nanjing, China). The sequence-validated plasmid was introduced into mutant strain NyZ501 by electrotransformation with 2.5 kV. The positive transformants were screened on LB plates with kanamycin (50 μg/ml), and the obtained recombinant strain was subjected to a growth test on PVA1788.

Bioinformatics analysis of DacA_pva.

Functional prediction of DacA_pva was conducted by BLASTp against nonredundant protein sequences (nr) and Swiss-Prot databases. Manually curated protein sequences were aligned and a phylogenetic tree constructed by MEGA 5.0 using the neighbor-joining method (1,000 bootstrap replicates). Multiple-sequence alignment was also used to analyze the protein signatures with DNAman software. Signal peptides and subcellular localization of DacA_pva were predicted with SignalP 5.0 (35) and the Gneg-mPLoc (36) Web server, respectively.

Expression and purification of DacA_pva.

The dacA_pva gene-omitted nucleic acid sequence corresponding to signal peptides was amplified from strain NyZ500 genome with primers F(dacA_pva-pET) and R(dacA_pva-pET) (listed in Table 2) and then fused into pET-28a(+) (digested with NdeІ and BamHІ) to produce His₆-DacA_pva overexpression plasmid pET-28a(+)-dacA_pva by using a One Step cloning kit. The sequence-validated plasmid was transformed into E. coli BL21(DE3) by a standard procedure (37). The generated strain BL21(DE3)[pET-28a(+)-dacA_pva] was cultured in LB with kanamycin (50 μg/ml) at 180 rpm and 37°C until an OD₆₀₀ of 0.6 was reached and then induced with 0.1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) at 150 rpm and 16°C overnight. After being washed and resuspended with PB buffer (100 mM, pH 7.4; 200 mM NaCl, 10% [vol/vol] glycerol) following ultrasonic fragmentation, the cell extracts were obtained through centrifugation at 13,000 × g at 4°C for 40 min and then filtered with 0.45-μm filter membranes. Protein purification was conducted using the ÄKTA start system (GE Healthcare) equipped with a 5-ml HisTrap HP column (GE Healthcare). The recombinant His₆-DacA_pva was eluted with 250 mM imidazole dissolved in PB buffer, and imidazole was then removed from the protein solution through an ultrafiltration tube. The resulting recombinant His₆-DacA_pva was assessed by SDS-PAGE, and the concentration was measured by a Nano-300 spectrophotometer (Allsheng Instruments Co., Ltd. Hangzhou, China). The proteins AxeA1 and EstD1 were expressed and purified with the same methods.

HPLC analysis of reaction products.

The HPLC (Waters) equipped with an organic acid analysis column (Aminex HPX-87H, 300 by 7.8 mm, 9 μm; Bio-Rad) was used to analyze the acetate produced by deacetylation of PVA derivatives and acetylated xylan. Ten microliters of sample was injected and analyzed after filtration with a 0.22-μm filter membrane. The single mobile phase of 5 mM H₂SO₄ was used to elute products with a flow rate of 0.6 ml/min at 50°C. The detection wavelength was 210 nm. Under these conditions, the retention time of acetate was 14.80 min.

The conversion of 7ACA to D7ACA was measured using HPLC equipped with a C₁₈ column (Zorbax SB-C₁₈, 250 × 4.6 mm, 5 μm; Agilent). Ten microliters of sample was injected and analyzed by isocratic elution with a mobile phase consisting of 20 mM sodium acetate (pH 5.5) and acetonitrile (93:7, vol/vol) at a flow rate of 0.5 ml/min and 30°C. The detection wavelength was 254 nm. Under these conditions, the retention times of 7ACA and D7ACA were 7.64 min and 4.14 min, respectively.

Enzyme activity assay.

The substrates PVA1788, PVAxx78, acetylated xylan, and 7ACA were dissolved in PB buffer (100 mM, pH 7.4) with concentrations of 3% (wt/vol), PVA1788 and PVAxx78, 10% (wt/vol) acetylated xylan, and 5 mM 7ACA. The reaction was started by adding 14 μg DacA_pva into 500 μl of each substrate at 37°C and maintained for appropriate reaction times. The samples were acidified by adding H₂SO₄ at a final concentration of 5 mM and boiled at 85°C for 10 min to stop the reaction before being subjected to HPLC analysis. The same reaction system was used without enzyme as a control. For 7ACA deacetylation, 0.60 μg DacA_pva was used instead to slow down the reaction, and the boiling step was omitted for 7ACA due to its instability at high temperature. For water-insoluble polyvinyl acetate, 28 μg DacA_pva and 20 mg polyvinyl acetate (average molecular weight was 30 to 50 kDa) were added into 500 μl PB buffer to initiate the reaction; the rest of the procedures were the same as for other substrates mentioned above. One unit of activity was defined as the amount of enzyme required to produce 1 μmol acetate per minute at 37°C.

FTIR analysis of acetyl contents in PVA.

Acetyl group contents in PVA were calculated from the ratio of absorbances at wavenumbers of 1,251 cm⁻¹ and 1,093 cm⁻¹ in FTIR spectra by a method reported previously (21).

qRT-PCR.

Cells of strain NyZ500 was cultured on LB agar plates at 30°C overnight, and a formed single colony was inoculated into fresh LB medium until an OD₆₀₀ of 0.6 was reached. Then, the cells were washed and inoculated into 5-ml volumes of LCFBM containing sodium succinate (2 mM), 7ACA (2 mM), acetylated xylan (0.3%, wt/vol), or PVA1788 (0.3%, wt/vol). After incubation at 30°C and 180 rpm for 4.5 h, 3 ml cells was harvested and their RNAs extracted using RNA isolation kit (Sangon Biotech, Shanghai, China). After measurement of the concentration of isolated RNA using a microplate reader (Epoch 2; BioTek, USA), an equal amount of RNA (540 ng) for each sample was reverse transcribed to cDNA using a reverse transcription kit (HiScript III RT SuperMix for qPCR; Vazyme). The 16S rRNA gene from strain NyZ500 served as an internal reference, and the primers for the 16S rRNA gene and dacA_pva gene are listed in Table 2. The qRT-PCR proceeded per the instructions of TB Green Premix Ex Taq kit (TaKaRa) using a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA).

Data availability.

The draft genome (accession number JAEIJE000000000) of strain NyZ500 containing dacA_pva and the 16S rRNA gene (accession number MW356895) have been deposited in GenBank.