Dynamic Polyphosphate Metabolism Coordinating with Manganese Ions Defends against Oxidative Stress in the Extreme Bacterium Deinococcus radiodurans

The Mn-phosphate complex (Mn-Pi) plays a key role in the cellular resistance of radioresistant bacteria. The evolutionarily ancient polyphosphate polymers (polyphosphate [PolyP]) could effectively chelate Mn²⁺ and donate phosphates.

ABSTRACT

Deinococcus radiodurans is an extreme bacterium with unparalleled resistance to oxidative stresses. Accumulation of intracellular Mn²⁺ complexing with small metabolites is the key contributor to the tolerance of D. radiodurans against oxidative stress. However, the intracellular reservoir of Mn ions and homeostatic regulation of the Mn complex in D. radiodurans remain unclear. We identified an evolutionarily ancient and negatively charged phosphate polymer (polyphosphate [PolyP]) in D. radiodurans. We investigated PolyP metabolism in the response of D. radiodurans to oxidative stress. The genes dr1939, encoding polyphosphatase kinase (PPK_Dr; the subscript “Dr” refers to D. radiodurans), and dra0185, encoding exopolyphosphatase (PPX_Dr), were identified. PPX_Dr is a novel exopolyphosphatase with a cofactor preference to Mn²⁺, which enhances the dimerization and activity of PPX_Dr to allow the effective cleavage of PolyP-Mn. PPK_Dr and PPX_Dr exhibited different dynamic expression profiles under oxidative stress. First, ppk_Dr was upregulated leading to the accumulation of PolyP, which chelated large amounts of intracellular Mn ions. Subsequently, the expression level of ppk_Dr decreased while ppx_Dr was substantially upregulated and effectively hydrolyzed inactive PolyP-Mn to release phosphate (Pi) and Mn²⁺, which could form into Mn-Pi complexes to scavenge O₂⁻ and protect proteins from oxidative damage. Hence, dynamic cellular PolyP metabolites complexed with free Mn ions highlight a defense strategy of D. radiodurans in response to oxidative stress.

IMPORTANCE The Mn-phosphate complex (Mn-Pi) plays a key role in the cellular resistance of radioresistant bacteria. The evolutionarily ancient polyphosphate polymers (polyphosphate [PolyP]) could effectively chelate Mn²⁺ and donate phosphates. However, the intracellular reservoir of Mn ions and homeostatic regulation of the Mn-Pi complex remain unclear. Here, we investigated the relationship of PolyP metabolites and Mn²⁺ homeostasis and how they function to defend against oxidative stress in the radioresistant bacterium Deinococcus radiodurans. We found that PPX_Dr (the subscript “Dr” refers to D. radiodurans) is a novel exopolyphosphatase with a cofactor preference for Mn²⁺, mediating PolyP-Mn degradation into Pi and Mn ions. The formed Mn-Pi complexes effectively protect proteins. The dynamic PolyP metabolism coordinating with Mn ions is a defense strategy of D. radiodurans in response to oxidative stress. The findings not only provide new insights into the resistance mechanism of the extreme bacterium D. radiodurans but also broaden our understanding of the functions of PolyP metabolism in organisms.

INTRODUCTION

Ionizing radiation (IR) and UV radiation cause the damage of cellular molecules through radiation-mediated generation of reactive oxygen species (ROS). Radioresistant microorganisms usually contain a high cellular content of manganous ions (Mn²⁺s) in the form of complexes with small metabolites (e.g., orthophosphate, amino acids, and peptides) (1), which act as antioxidants to protect proteins from radiation-induced oxidative damage (2, 3). Deinococcus radiodurans is an extremophilic bacterium known for its resistance to oxidative stresses, including IR, UV radiation, and oxidants (4–6), and has been used as a model organism to study the mechanism of oxidative stress resistance. D. radiodurans contains a particularly high level of intracellular Mn²⁺ that is approximately 100 times higher than that of radiosensitive Escherichia coli when grown in a defined minimal medium, and the dominant form of Mn in D. radiodurans cells is Mn²⁺ (7). Moreover, an in vitro study demonstrated that the Mn-phosphate complex (Mn-Pi) and Mn-carbonate complex can catalyze superoxide disproportionation at physiological concentrations (8). These results indicate that Mn complexes with small metabolites are important for the D. radiodurans defense against oxidative stress. However, the intracellular reservoir and homeostatic regulation of the Mn complex in D. radiodurans under oxidative stress remain unknown.

Polyphosphate (PolyP) is a linear polymer consisting of three to hundreds of phosphate (Pi) molecules held together by high-energy phosphoanhydride bonds (9, 10). Prebiotically, PolyP could be produced by dehydration of phosphate rock at high temperatures in volcanoes and deep-oceanic steam vents and is unique in its likely role in the origin and survival of life (11). Because of its abundance on Earth long before the emergence of biological molecules, PolyP is a plausible source of energy and phosphate in the early evolution of life (11, 12). Recent studies have revealed the function of PolyP in protecting the structure of proteins as a primordial protein chaperone (13–15). PolyP is found to be ubiquitously present in all living organisms and is involved in many cellular processes, including as a phosphorous reservoir and donor (16), in energy storage (17), as a cation chelator (18), in virulence (19), in the cell cycle (20–22), and in gene regulation (23). As negatively charged phosphate polymers, PolyPs could effectively chelate metal cations, including Mn²⁺ (24). PolyP-Mn complexes with 6 to 20 phosphate units in length and complexed with 1 to 3 metal ions on average per chain were found in Saccharomyces cerevisiae (25). In Chlamydomonas reinhardtii, Mn accumulation depends on cellular polyphosphate, but most Mn²⁺ is unstably complexed with PolyP, indicating that PolyP may not be the final ligand for Mn ions (26). In bacteria, PolyP synthesis is catalyzed by PolyP kinase (PPK) using ATP or GTP as the substrate (11). PolyP catabolism in bacteria uses exopolyphosphatase (PPX) or endopolyphosphatase (PPN) (11). PPN cleaves long chains of PolyP to generate shorter chains, while PPX hydrolyzes and releases the terminal Pi processively from a linear PolyP. We have found the presence of PolyP in D. radiodurans. However, PolyP metabolism and corresponding enzymes, the relationship of PolyP metabolites and Mn²⁺ homeostasis, and how they collaborate to defend against oxidative stress in the extreme bacterium need to be clarified.

In the present study, we investigated the enzymes involved in PolyP metabolism in D. radiodurans. Time course expression profiles of polyphosphatase kinase (PPK_Dr) responsible for PolyP biosynthesis and of exopolyphosphatase (PPX_Dr) responsible for PolyP catabolism were analyzed under oxidative stress. The PPX_Dr-mediated PolyP metabolites complexed with Mn ions were investigated to reveal the relationship between PolyP metabolism and Mn-dependent stress resistance in D. radiodurans.

RESULTS

Identification of polyphosphate kinase and exopolyphosphatase in D. radiodurans.

The genome of D. radiodurans R1 was screened for genes encoding PPK and PPX homologs by using the BLASTP program (NCBI, https://blast.ncbi.nlm.nih.gov/Blast.cgi) and using the established E. coli PPK and E. coli PPX, respectively, as query sequences. The putative PPK- and PPX-encoding genes found in the D. radiodurans genome are dr1939 and dra0185 (see Fig. S1 in the supplemental material) and were tentatively designated ppk_Dr and ppx_Dr (the subscript “Dr” refers to D. radiodurans), respectively. In contrast to ppx and ppk forming a single transcriptional unit in E. coli (27) or the adjacent ppk and ppx in Pseudomonas aeruginosa (28), ppk_Dr and ppx_Dr are found at two different locations on the chromosomes.

DR1939, which contains the conserved phosphorylation site H464 and the two putative autophosphorylation sites D499 and E651 (Fig. S1A), has 34% amino acid sequence identity to the PPK of E. coli. DRA0185 has conserved catalytic site E114 and showed a 28% sequence identity to the PPX of E. coli (Fig. S1B). However, no endopolyphosphatase (PPN) homologs were found in D. radiodurans.

To determine whether dr1939 and dra0185 correspond to the ppk and ppx of D. radiodurans, mutants of dr1939 and dra0185 (Δppk_Dr mutant and Δppx_Dr mutant, respectively) were constructed and verified (see Fig. S2A and C in the supplemental material). Previous studies showed that PolyP accumulated in E. coli and Lactobacillus sp. under oxidative stress could be detected by 4′,6-diamidino-2-phenylindole (DAPI) staining in vivo (29, 30). The living cells of D. radiodurans were stained by DAPI (green for PolyP-DAPI and blue for DNA-DAPI) and Synapse C1 (red for membrane). Under nonstress conditions, little PolyP was found in the wild-type R1 and mutants (Fig. 1A). After treatment with 30 mM H₂O₂, PolyP accumulation was shown in the wild-type R1 and the Δppx_Dr mutant, while the accumulation of PolyP was not detected in the Δppk_Dr mutant (Fig. 1A). This finding indicated that PolyP accumulation could be induced under oxidative stress conditions and that the ppk_Dr mutation might block the synthesis of PolyP. Moreover, PolyP was extracted from the cells for detection. Consistent with the results of DAPI staining, no PolyP was detected in the Δppk_Dr mutant, whereas PolyP accumulated in wild-type R1 and Δppx_Dr mutant (Fig. 1B). The Δppx_Dr mutant contains much more PolyP than the wild-type under oxidative stress conditions, which might be due to lack of a PolyP degradation enzyme, indicating that DRA0185 was involved in the catabolism of PolyP.

FIG 1.

Identification of polyphosphate kinase (PPK_Dr) and exopolyphosphatase (PPX_Dr) in D. radiodurans. (A) Fluorescence microscopic detection of PolyP in cells in the absence (untreated) or presence of 30 mM H₂O₂ treatment. Nucleoids (blue fluorescence) and PolyP (green fluorescence) were stained with DAPI. Cell membrane (red fluorescence) was stained with Synapse C1. Merged images indicated the localization of PolyP. R1, the wild type. (B) Analysis of PolyP extracts using urea PAGE. Lane 1, the wild-type R1; lane 2, Δppk_Dr mutant; lane 3, Δppx_Dr mutant; P100 and P20 indicate the PolyP markers with 100 Pi and 20 Pi units, respectively. (C) In vitro activity assays of PPK_Dr using the HPLC method. HPLC profiles of 1 mM ATP standard with 0.1 mM PolyP (P100) and hydrolyzed products of ATP from the reaction mixture containing 1 mM ATP, 0.1 mM PolyP (P100), and 0.5 μg PPK_Dr are shown. (D) In vitro activity assays of PPX_Dr using the urea PAGE method. Lane 1, P100 (100 ng); lane 2, P100 (100 ng) + PPX_Dr (3 μg) + Mg²⁺ (5 mM).

Purified DR1939 can catalyze the synthesis of PolyP using ATP as the substrate (Fig. 1C) and also can catalyze the synthesis of ATP using ADP (see Fig. S3 in the supplemental material), confirming that dr1939 encodes PPK in D. radiodurans (PPK_Dr). Purified DRA0185 was able to degrade PolyP in vitro (Fig. 1D), indicating that DRA0185 acts as a PPX in D. radiodurans (PPX_Dr). Cell growth of the Δppk_Dr mutant was slightly higher than that of the wild-type strain (see Fig. S4 in the supplemental material), probably because growth is facilitated by preventing consumption of ATP in the Δppk_Dr mutant. On the other hand, the Δppx_Dr mutant grew slightly slower than the wild-type strain.

PPX_Dr is a manganese ion-preferring exopolyphosphatase.

Previous study has shown that divalent cations are required for the exopolyphosphatase activity of PPX (31). To determine the metal preference of PPX_Dr, various metal ions, including Mn²⁺, Ca²⁺, or Mg²⁺, were tested. PPX_Dr treated with EDTA showed nearly no exopolyphosphatase activity (Fig. 2A). The exopolyphosphatase activity of PPX_Dr was stimulated by all the divalent cations tested; however, Mn²⁺ promoted stronger PPX_Dr activity than the other divalent cations (Mg²⁺ or Ca²⁺) (Fig. 2A). Moreover, the elution peak of PPX_Dr from the gel filtration chromatography suggests that PPX_Dr forms a dimer (Fig. 2B). In the presence of 5 mM EDTA, the elution profile suggests PPX_Dr shifts toward the monomer form (Fig. 2B). Following the addition of 2 mM Mn²⁺, the elution peak suggests it is shifted back to the dimer (Fig. 2B). In the meantime, the relative molecular masses of the PPX_Dr dimer (125.9 kDa) and monomer (66.1 kDa) of PPX_Dr were obtained by the mathematical relations of molecular mass and elution volumes from a standard elution curve (Fig. 2C). These values indicated that metal ions, especially Mn²⁺, were required for the dimerization and activity of PPX_Dr, which is different from the other PPX homologs where metal ions are dispensable (32, 33). Previous reports showed that some proteins like beta-lactamases (Pseudomonas aeruginosa) and RNase J (D. radiodurans) can be converted into dimers in the presence of metal ions (34, 35). The two forms (monomer and dimer) of PPX_Dr may be mutually interconverted depending on available Mn²⁺. These results suggest that PPX_Dr is manganese ion preferring and active as a dimer.

FIG 2.

PPX_Dr is a manganese ion-preferring exopolyphosphatase. (A) Enzyme activity of PPX_Dr using different metal ions. Lane 1, polyp P100; lane 2, P100 + PPX_Dr + 5 mM EDTA; lanes 3 and 4, P100 + PPX_Dr + 0.5 mM or 2 mM Mn²⁺; lanes 5 and 6, P100 + PPX_Dr + 0.5 mM or 2 mM Ca²⁺; lanes 7 and 8, P100 + PPX_Dr + 0.5 mM or 2 mM Mg²⁺. (B) Size exclusion chromatography of PPX_Dr incubated with EDTA or additional Mn²⁺ using the Superdex 200 10/300 GL column. The peaks corresponding to the migration positions of monomeric or dimeric forms of PPX_Dr are labeled and colored differently. (C) The relative molecular masses of the dimer and monomer of PPX_Dr were obtained by the mathematical relations of molecular mass and elution volumes from a standard elution curve. The standard elution curve (squares) was generated from the elution volumes of the standards divided by 20 ml (Ve/Vo) plotted against the log of the molecular mass of the standards. The elutions of PPX_Dr monomer (open circles) and PPX_Dr dimer (open triangle) are shown. The Ve/Vo of the PPX_Dr dimer is 0.67, and the relative molecular mass is 125.9 kDa, which is 1.9 higher than the relative molecular mass of the monomer (66.1 kDa; Ve/Vo = 0.74).

PolyP metabolites are involved in the cellular resistance of D. radiodurans to oxidative stress.

Cell survival experiments under oxidative stress were performed. The Δppx_Dr mutant was more sensitive to H₂O₂ than the wild-type R1, whereas the gene complemented the mutant phenotype in strain Δppx_Dr/C-ppx_Dr resulting in resistance like the wild-type R1 (Fig. 3A and B), suggesting that the exopolyphosphatase PPX_Dr and PolyP degradation products might be involved in the resistance of D. radiodurans to oxidative stress. On the other hand, the Δppk_Dr mutant displayed increased resistance to H₂O₂, indicating that blocked PolyP synthesis results in a surplus of intracellular Pi that might lead to strong resistance in D. radiodurans. Extracellular oxidative stress causes an increase in ROS level in cells through the Fenton reaction or Haber-Weiss reaction. Following the treatment with H₂O₂, the cells of the Δppx_Dr mutant generated 1.7-fold more ROS, whereas the Δppk_Dr mutant had less ROS than the wild-type R1 (Fig. 3C). These results indicate that PolyP metabolites were involved in the resistance of D. radiodurans to oxidative stress.

FIG 3.

PolyP metabolites are involved in cell resistance of D. radiodurans to oxidative stress. (A) Survival assay of the wild-type R1 and mutant cells exposed to 50 mM H₂O₂. The cells were spotted onto the plates and incubated on TGY plates at 30°C for 3 days. Different dilutions of cell cultures are indicated in the figure. The untreated cells were used as the controls. (B) Survival curves of wild-type R1 and mutants following exposure to different concentration of H₂O₂. Cells were plated and cultured on TGY plates for 3 days before colonies were counted. (C) ROS accumulation in the wild-type R1 and mutant cells in the presence or absence of 30 mM H₂O₂ treatment. ***, P < 0.001, significant compared with the wild-type R1. (D) Contents of Mn binding in PolyP extracts (PolyP-binding Mn) from wild-type R1 and mutant cells. ***, P < 0.001, significant compared with the wild-type R1.

Small metabolites complexed with Mn ions, e.g., Mn-phosphate (Mn-Pi) and Mn-carbonate, act as efficient ROS scavengers in D. radiodurans (8). The intracellular concentration of metal ions (Fe, Mn, Zn, and Cu) in the Δppk_Dr and Δppx_Dr mutants was measured using inductively coupled plasma mass spectrometry (ICP-MS) and compared with that of the wild-type strain. All the metal ion levels in the mutants were approximately identical with those of the wild-type R1 (see Fig. S5 in the supplemental material). However, the amount of manganese that binds to PolyP was different between these strains. The PolyP from the Δppx_Dr mutant contains an approximately three times greater amount of manganese ions than the level in the wild-type R1 (Fig. 3D), suggesting that accumulated PolyP could effectively chelate free Mn ions in the mutant cells and PolyP-binding Mn increased because there is more PolyP to which Mn ions can bind. Due to the lack of PolyP, the PolyP-binding Mn in the Δppk_Dr mutant was negligible (Fig. 3D). This finding indicated that surplus free Mn ions were bound and stored in PolyP. PPX_Dr might be used to hydrolyze the PolyP-Mn complex under oxidative stress, releasing free Pi and Mn²⁺ to generate Mn-Pi.

PPX_Dr releases Pi and Mn²⁺ from the PolyP-Mn complex to defend against oxidative stress.

PolyP not only is a protein-protecting chaperone (13) but also could efficiently chelate divalent cations like Mn²⁺ (9). Mn²⁺ is the key factor for oxidative stress resistance in D. radiodurans (1); however, Mn²⁺ chelated by PolyP might fail to detoxify free radicals and protect proteins (14). To verify the roles of PolyP metabolites with Mn ions in defending against oxidative stress, we examined the protective effects of PolyP and PolyP hydrolysis products complexed with or without Mn ions on the endonuclease activity of BamHI.

Under the treatment of 150 mM H₂O₂, BamHI showed no endonuclease activity due to oxidative damage (Fig. 4A). It was reported that Mn²⁺ or phosphate alone did not protect BamHI from oxidative damage (7). The metal ions Mn²⁺, Mg²⁺, and Ca²⁺ were not able to protect BamHI from oxidative damage, while BamHI displayed full endonuclease activity with the addition of PolyP (Fig. 4A). However, when the PolyP-Mn complex generated from mixing PolyP with Mn²⁺ was applied, the PolyP lost a large part of the protection effect on BamHI (Fig. 4A). Meanwhile, the PolyP-Ca²⁺and PolyP-Mg²⁺ complexes still functioned in a similar way to PolyP. With the increase of Mn ion concentration, PolyP correspondingly decreased protection (Fig. 4B), probably because its binding sites to proteins were occupied by chelated surplus Mn ions and formed an inactivated PolyP-Mn complex. Following the incubation of PolyP with PPX_Dr and Mn²⁺, the PolyP was increasingly degraded into Pi with an increase in Mn ion concentration (Fig. 4C). The released Pi was able to coordinate with Mn²⁺ into Mn-Pi (7). The generated Mn-Pi demonstrated effective protection on the endonuclease activity of BamHI, and its protective capacity was increased with increasing Mn²⁺ concentrations (Fig. 4D). The in vitro protection of Mn-Pi on BamHI was lost when the concentration of Mn²⁺ in phosphate buffer was lowered from 1 mM (7).

FIG 4.

In vitro protection of enzyme BamHI by PolyP products with Mn²⁺ against oxidative stress. (A) BamHI in the indicated metal ions and/or PolyP mixtures was treated with 150 mM H₂O₂ and then assayed for residual activity. The mixture was incubated with DNA and subjected to urea PAGE. DNA, uncleaved DNA; DNA + BamHI, DNA incubated with BamHI; control, DNA + BamHI treated with H₂O₂. (B) BamHI in the indicated mixtures of PolyP and Mn²⁺ was treated with 150 mM H₂O₂, then incubated with DNA, and subjected to urea PAGE. Lanes represent the mixture with the addition of PolyP and different concentrations of Mn²⁺. (C) PolyP was incubated with PPX_Dr and Mn²⁺ for 15 min. Lanes represent mixtures with the addition of PolyP, PPX_Dr, and different concentrations of Mn²⁺. (D) BamHI in the indicated mixtures of PolyP, PPX_Dr, and Mn²⁺ was treated with 150 mM H₂O₂, then incubated with DNA, and subjected to urea PAGE. Lanes represent the mixtures with the addition of PolyP, PPX_Dr, and different concentrations of Mn²⁺.

We conducted an ex vivo assay of cell survival supplemented with PolyP products and Mn²⁺ under oxidative stress. Although PolyP and PolyP-Mn²⁺ (1 and 2 mM Mn²⁺) exhibited a slight protective effect on the cell survival phenotype, PolyP-Mn²⁺ with a high Mn²⁺ content (4 mM Mn²⁺) failed to protect cells from oxidative stress (Fig. 5A). These results are in agreement with in vitro assays (Fig. 4A) and suggest that the PolyP-Mn complex did not play critical roles in cell survival under oxidative stress. With the addition of PolyP-Mn degradation products (Mn-Pi) by PPX_Dr at 4 mM Mn²⁺ into the cell culture, cell survival was increased compared with that of the cells supplemented with PolyP-Mn under oxidative stress (Fig. 5B). Moreover, the PolyP-Mn complex exhibited hardly any catalytic activity on the O₂⁻ disproportionation reaction, while the PolyP metabolite (Pi) complexed with Mn²⁺ (Mn-Pi) had strong O₂⁻ scavenging activity (Fig. 5C), confirming that Mn-Pi plays a key role in cellular resistance to oxidative stress. A previous study demonstrated that the Mn²⁺ in D. radiodurans could be complexed with small molecules, such as PO₄³⁻, amino acids, or nucleosides, to defend against free radicals (5). Mn deficiency will lead to an increase of intracellular oxidative stress because of decreased intracellular Mn-antioxidants (36, 37). These results indicated that PPX_Dr induced the release of Pi and Mn²⁺ from the inactive PolyP-Mn to form an antioxidant Mn-Pi complex, which is involved in cell defense against oxidative stress.

FIG 5.

Ex vivo protection of cells by PolyP products with Mn²⁺ against oxidative stress. (A) Effects of PolyP(P100) or PolyP(P100) mixed with Mn²⁺ on the survival of D. radiodurans cells treated with 80 mM H₂O₂. The cells were spotted onto the plates and incubated on TGY plates at 30°C for 3 days. Different dilutions of cell cultures are indicated in the figure. (B) Effects of PolyP(P100) or PolyP-Mn degradation product (Mn-Pi) using PPX_Dr on the survival of D. radiodurans cells treated with 80 mM H₂O₂. (C) The nonenzymatic O₂⁻ scavenging activity assay of PolyP-Mn complex and Mn-Pi products by PPX_Dr. The Mn-Pi products were generated from the degradation of PolyP-Mn containing 0.5 to 5 mM Mn²⁺ by PPX_Dr.

Dynamic PolyP metabolism in response to oxidative stress.

To determine how PolyP accumulates and decomposes in D. radiodurans under oxidative stress, the time course profile of PolyP level as well as expression levels of ppk_Dr and ppx_Dr were measured in the cells under H₂O₂ treatment. As shown in the wild-type cells stained by DAPI (Fig. 6A), there are low PolyP fluorescence signals in the absence of H₂O₂ treatment. Following H₂O₂ treatment, the level of PolyP increased with treatment time and reached the highest level at 30 min (∼60% cells containing PolyP signal) and then decreased (Fig. 6A and B). Moreover, the levels of intracellular ROS and protein carbonylation exhibited similar profiles as those of PolyP (Fig. 6B), suggesting that the PolyP metabolites were involved in the oxidative stress response of D. radiodurans. The transcription levels of ppk_Dr and ppx_Dr were initially stimulated upon exposure to H₂O₂. The transcription level of ppk_Dr increased with the H₂O₂ exposure time, reached the highest level (approximate 7-fold higher than the untreated control) at 30 min, and then decreased, while the expression of ppx_Dr increased and reached the highest level (approximate 21-fold higher than the untreated control) at 45 min and then gradually decreased (Fig. 6C; see Fig. S6A in the supplemental material). The transcriptional profiles of ppk_Dr and ppx_Dr are consistent with the accumulation profile of PolyP under oxidative stress (Fig. 6B). Western blot results of PPK_Dr and PPX_Dr demonstrated similar expression profiles to those of transcription level assays (Fig. 6D; Fig. S6B). The dynamic expression profiles of ppk_Dr and ppx_Dr in response to oxidative stress might be a defense strategy in the resistance of D. radiodurans to oxidative stress.

FIG 6.

Dynamic profiles of PolyP level, intracellular oxidative damage level, and expression levels of ppk_Dr and ppx_Dr in cells under oxidative stress. (A) PolyP accumulation as stained by DAPI at different time periods in the wild-type R1 cells under H₂O₂ treatment (30 mM). (B) Analysis of intracellular oxidative damage level under H₂O₂ treatment. Levels of PolyP, intracellular ROS, and protein carbonylation over the time course of H₂O₂ treatment were shown. PolyP level was indicated using the percentage of cells with PolyP fluorescence in the population stained by DAPI. (C) RT-qPCR assays of ppk_Dr and ppx_Dr over the time course of H₂O₂ treatment. (D) Western blot assays of ppk_Dr and ppx_Dr over the time course of H₂O₂ treatment. GroEL was used as a control and detected using anti-GroEL antibody under the same treatment conditions.

DISCUSSION

In the present study, we identified the polyphosphate kinase (PPK_Dr) and exopolyphosphatase (PPX_Dr) in D. radiodurans, which is known for its resistance to oxidative stress. PolyP emerged on the Earth long before other biological molecules (38), raising the possibility that PolyP was prebiotically made directly by a proton motive force bypassing PPK and ATP as an intermediate (11). As a metal cation chelator, PolyP has a unique role in the homeostasis of metals (39, 40).

PPX_Dr is a Mn²⁺-preferring exopolyphosphatase. Mn²⁺ is crucial for the dimerization and activity of PPX_Dr, which is different from other PPX homologs where metal ions are dispensable (33, 41). The monomer and dimer of PPX_Dr could be interconverted depending on the available Mn²⁺. The Mn²⁺-preferring PPX_Dr is an example of the evolutionary adaptation to extreme stress by maintaining an intracellular equilibrium of PolyP and Mn²⁺. However, the molecular mechanism of PPX_Dr dimerization and its activity using Mn ions are not clearly understood and need further study using structural biology.

D. radiodurans can accumulate as much as 30 mM Mn ions (42), and the most common state of Mn in cells is Mn²⁺ (43). It was suggested that surplus Mn²⁺ (the portion of free Mn²⁺ that is not bound to proteins) forms ROS-scavenging complexes with metabolites, which provide global protein protection and preserve the structure of enzymes (2). Our results demonstrate that PolyP metabolites complexed with Mn ions are involved in the cell resistance of D. radiodurans to oxidative stress. Evidence from several lines supports the roles of PolyP metabolites. First, PolyP accumulation was observed in the wild-type R1 and the Δppx_Dr mutant under oxidative stress (Fig. 1A and B), indicating that PolyP synthesis can be induced by oxidative stress. Second, the Δppx_Dr mutant was more sensitive to H₂O₂ than the wild type (Fig. 3A to C). The cells of the Δppx_Dr mutant containing high levels of PolyP generated more ROS, while the Δppk_Dr mutant had less ROS than the wild type following treatment with H₂O₂ (Fig. 3C), suggesting that exopolyphosphatase PPX_Dr and PolyP degradation products are involved in the resistance of D. radiodurans to oxidative stress. Third, the PolyP from the Δppx_Dr mutant contains approximately three times the amount of Mn ions compared with the wild type, while the PolyP-binding Mn in the Δppk_Dr mutant was negligible (Fig. 3D), inferring the role of PolyP in effectively chelating free Mn ions and facilitating the accumulation of Mn ions as an “Mn pool” in D. radiodurans. Fourth, in vitro experiments demonstrate that the PolyP degradation product (Pi) mediated by PPX_Dr complexed with Mn²⁺ (Mn-Pi), but not the PolyP-Mn, can effectively protect proteins and had strong O₂⁻ scavenging activity (superoxide dismutase [SOD] mimic) (Fig. 4 and Fig. 5C). The protective capacity of Mn-Pi increased with the increasing Mn²⁺ concentration. Moreover, cells supplemented with Mn-Pi exhibited increased survival (Fig. 5B), confirming that Mn-Pi plays a key role in cellular resistance to oxidative stress. The expression profiles of ppk_Dr and ppx_Dr are consistent with the time course of PolyP products and intracellular oxidative damage levels under oxidative stress. Hence, PPX_Dr mediated the release of Pi and Mn²⁺ from the inactive PolyP-Mn complex to form Mn-Pi, which is involved in cell defense against oxidative stress. We did not exclude the possibility that Mn²⁺ in D. radiodurans could be complexed with other small molecules such as amino acids and nucleosides to form Mn-antioxidants as described in previous studies (7, 44). However, PolyP metabolites complexed with Mn ions indeed contribute greatly to the oxidative stress resistance of D. radiodurans.

PolyP metabolites mediated by PPK_Dr and PPX_Dr in D. radiodurans may have dual functions, as follows: direct protein-binding chaperone activity of PolyP (13), Mn homeostasis regulation, and Mn-Pi generation for ROS scavenging. The PolyP could protect proteins from oxidative damages; however, PolyP complexing with a high concentration of Mn lost its ability to protect proteins (Fig. 4). Our results are consistent with those of previous studies that show Mn-Pi, but not PolyP-Mn²⁺, can compensate for the loss of SOD and serves as a cellular antioxidant (8). The Δppk_Dr mutant displayed a high resistance to H₂O₂, and the Δppx_Dr mutant showed sensitivity to H₂O₂, which are findings in contrast to results of previous studies in other bacteria (10, 30). This contrast could be because D. radiodurans is a bacterium with a high level of Mn accumulation, which would invalidate the protective effect of PolyP on proteins. Moreover, the paradox of the functions of PolyP metabolites can be explained using the time course profile of PolyP production and profiles of ppk_Dr and ppx_Dr expression following oxidative stress. Following H₂O₂ treatment, the level of PolyP increased over time, reached the highest level at 30 min, and decreased from that point. PolyP and PolyP-Mn²⁺ containing 1 to 2 mM Mn²⁺ exhibited only a slight protective effect on cell survival, and PolyP-Mn²⁺ containing a high Mn²⁺ content (4 mM) failed to protect cells from oxidative stress, suggesting that the accumulation of the PolyP-Mn complex could not play critical roles in cell survival under oxidative stress.

A model of PolyP metabolism coordinating with Mn ions in the response of D. radiodurans to oxidative stress is proposed (Fig. 7). Under nonstress conditions, intracellular PolyP metabolism is in an equilibrium that is regulated by PPK_Dr and PPX_Dr (Fig. 7A). PolyP chelated Mn ions to form a PolyP-Mn complex. When cells were exposed to oxidative stress, the expression of PPK_Dr and PPX_Dr was upregulated. At the early time phase of oxidative stress (0 to 30 min), increased PPK_Dr leads to the accumulation of PolyP, which acts as a chaperone for protecting proteins from ROS damage. At the late time phase (30 min to 1 h), PPK_Dr gradually decreased, while PPX_Dr was substantially upregulated to cleave accumulated PolyP and release Pi and Mn²⁺ from the PolyP-Mn complex. Then, Mn²⁺ could enhance the dimerization and the activity of PPX_Dr to cleave polyP more efficiently. Finally, the degradation products of PolyP complexed with Mn ions form into Mn-Pi to scavenge ROS. This dynamic PolyP metabolism coordinates with Mn²⁺ to maximize the functions of PolyP metabolites under oxidative stress. However, the induction and dynamic PolyP metabolism might be controlled by a complicated regulation system, which remains unclear and requires further investigation.

FIG 7.

Proposed scheme of PolyP metabolism coordinating with Mn ions in the response of D. radiodurans to oxidative stress. (A) Cells under nonstress conditions; the PolyP metabolism is in equilibrium which is regulated by PPK_Dr and PPX_Dr. PolyP chelates Mn ions to form PolyP-Mn complex. (B) Cells upon exposure to oxidative stress at early time phase (0 to 30 min); expression of PPK_Dr and PPX_Dr are upregulated. The increased PPK_Dr leads to accumulation of PolyP, which acts as chaperone to protect intracellular proteins from ROS damage. (C) Cells upon exposure to oxidative stress at late time phase (30 min to 1 h); PPX_Dr is substantially upregulated to cleave accumulated PolyP and release Pi and Mn²⁺. Then, Mn²⁺ could enhance the dimerization and activity of PPX_Dr to cleave polyP more efficiently. Finally, the degradation products of polyP complexed with Mn ions form into Mn-Pi to scavenge ROS.

In conclusion, the coordination of PolyP metabolism and Mn ions is an adaptive strategy of D. radiodurans to cope with oxidative stress. These results help to explain the interaction between PolyP metabolites and Mn ions, which were dynamically regulated by PPK_Dr and PPX_Dr, and verify the important role of Mn-Pi in defense against oxidative stress. From an evolution of life view, the simple inorganic Mn-Pi in cells might carry out the functions of antioxidant enzymes (SOD mimic) long before the emergence of SOD to defend against extreme stresses. Our findings not only provide new insights into the resistance mechanisms of the extreme bacterium D. radiodurans but also broaden our understanding of the functions of PolyP metabolism in organisms under oxidative stress.

MATERIALS AND METHODS

Bacterial strains and growth media.

All strains and plasmids used in this study are listed in Table 1. D. radiodurans strains were grown at 30°C in tryptone, glycose, and yeast extract (TGY) medium (0.5% tryptone, 0.1% glucose, and 0.3% yeast extract) with aeration or on TGY plates supplemented with 1.5% Bacto-agar. E. coli was grown in Luria-Bertani (LB) broth or LB agar at 37°C unless otherwise noted.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant marker	Reference or source
Strains
Deinococcus radiodurans R1	ATCC 13939	Lab stock
ΔppkDr	Disruptant of R1-deleted ppkDr (DR_1939), Kanr	This study
ΔppxDr	Disruptant of R1-deleted ppxDr (DR_A0185), Kanr	This study
ΔppkDr/C-ppkDr	ΔppkDr complemented with pRAD-dr1939	This study
ΔppxDr/C-ppxDr	ΔppxDr complemented with pRAD-dra0185	This study
Escherichia coli DH5α	F− φ80lacZΔM15 Δ(lacZYA-argF)U169 endA1 recA1 hsdR17(rK−, mK+) supE44 λ− thi-1 gyrA96 relA1 phoA	TransGen
Plasmids
pRADZ3	E. coli-D. radiodurans shuttle vector carrying the lacZ and groEL promoter (Apr Cmr)	Lab stock
pRADK	pRADZ3 derivative in which lacZ is replaced with the kanamycin gene (AprKmrCmr)	Lab stock
pRAD-dr1939	pRADK derivative in which the kanamycin gene is replaced with gene dr_1939	This study
pRAD-dra0185	pRADK derivative in which the kanamycin gene is replaced with gene dr_a0185	This study
pET28a+	Expression vector with strong T7 promotor, His tag	Lab stock
pET28a-ppxDr	pET28a ligated with dr_a0185	This study
pET28a-ppkDr	pET28a ligated with dr_1939	This study

Growth curve assay.

To examine bacterial growth, 1 ml of cultures (optical density at 600 nm [OD₆₀₀] of 1.0) was added to 100 ml fresh TGY medium. The cultures were incubated at 30°C with agitation at 250 rpm, and samples were taken to measure the OD₆₀₀ value at stationary interval time. All data are represented as mean ± SD from three independent experiments

Construction of gene mutant and complemented strains.

Tripartite ligation and double-crossover recombination methods were used for gene mutation as described previously (45) with some modifications. Briefly, upstream and downstream fragments of the target gene were amplified using primers with BamHI and HindIII restriction enzyme sites, respectively. After digestion, fragments were ligated to a kanamycin resistance fragment, and the amplified ligation product was transformed into D. radiodurans. Primers used in this study are listed in Table 2. Primer pairs P1-P2 and P3-P4 with a BamHI restriction site and a HindIII restriction site were used to amplify DNA fragments upstream and downstream of the targeted gene, respectively. These two fragments were digested with BamHI and HindIII (TaKaRa Biotechnology Ltd., Japan), respectively, and ligated to the kanamycin-resistant DNA fragment pretreated with the same enzymes. The ligation product was amplified by PCR using primers P1 and P4. The PCR product was then purified using a Wizard SV gel and PCR clean-up system kit (Promega Co., USA) and transformed into the D. radiodurans R1 strain using the CaCl₂ method (46). Competent cells of D. radiodurans were obtained as follows: the wild-type R1 strain was cultured in TGY broth to an OD₆₀₀ of 0.8, and then the cells collected by centrifugation were rinsed three times and cultured using 4× TGY containing 60 mM CaCl₂ for 2 h. The ligation product was added into the competent cell culture, which was incubated on ice for 45 min. Finally, 100 μl of the culture was transferred into 1× TGY for culture at 30°C for 20 h. Mutant colonies were selected on TGY plates containing 20 μg/ml kanamycin. Null mutants were confirmed by PCR product size and DNA sequencing. Primers P5 and P6 (Table 2 and Fig. S2) were used to clone the interior fragment of the targeted gene.

TABLE 2.

Primers used in this study

Primer name by use	Sequencea (5′-3′)
Construction of ppkDr and ppxDr mutants and complemented strains
dr1939-P1	CGCGGAAACTTTCAATTGCTG
dr1939-P2	CGGGATCCTCCTTGAGATTTAGCGCACG
dr1939-P3	CCCAAGCTTTAGAGCATTGGGCAGAATGAGG
dr1939-P4	GGTCAATCTGGAAGCCCCCATC
dr1939-P5	GCAACACCGATTACGAGTTCGAG
dr1939-P6	GGCGACCAGGAGGTGCTGG
dra0185-P1	GCTGGTAGGTGTTCACCTGGGTC
dra0185-P2	CGGGATCCATGGTGCAGAGTAATCCCTGCG
dra0185-P3	CCCAAGCTTCGCAGGACATCGAACTCATTGC
dra0185-P4	CGTCGAGCAGCTCGGCAATC
dra0185-P5	CAGTCACCTCCTGATTGCCGAG
dra0185-P6	GCTCGACAGGAAAAACTGGGT
dr1939-Phis1	CGGCTCAAGTTCAACTCGCTCA
dr1939-Phis2	GCGGATCCTTAGTGATGATGATGATGATGGGGATGCCGCCGGTCCGC
dr1939-Phis3	CCCAAGCTTAGCATTGGGCAGAATGAGGGTT
dr1939-Phis4	GCCACATCGTCAACATCGGCT
dra0185-Phis1	GCTGTCACGCGAACTCTTTGA
dra0185-Phis2	CGGGATCCTTAGTGATGATGATGATGATGGGTGGCTTTGGCCTCTGC
dra0185-Phis3	CCCAAGCTTACGCGGTCCTTCCCCTATCC
dra0185-Phis4	GCAGGTCAGGATGCACGAACA
Kanamycin Fb	CGCGGATCCCTGCAGACGCGTCATCTGCAG
Kanamycin Rb	CCCAAGCTTTAGAAAAACTCATCGAGCATCAAATG
Real-time quantitative PCR
dr1343-F	CGGCTGGTTTTCCGCATCC
dr1343-R	CTCGCCCCACTTGATGTTGGC
ppkDr-F	CGACCTGTCCTACCCCGACT
ppkDr-R	CGGTAGAGCGTCTGCTTGATG
ppxDr-F	GACACCCTCAAGGACCGCA
ppxDr-R	CTGATGACCGCCGGGTAC
Primer annealing
BamHI-p1	FAMc-ATGTGATCGGATCCTACGTACGTGTACGTACGTATGTCAT
BamHI-p2	ATGACATACGTACGTACACGTACGTAGGATCCGATCACAT
Protein expression
PPXDr-P1	GGAATTCCATATGATGCGGGTCGCCGTCG
PPXDr-P2	CGGGATCCTCAGGTGGCTTTGGCCTCTG
PPKDr-P1	GGAATTCCATATGGTGAACACCGTGTCTGCCGATTC
PPKDr-P2	CGGGATCCCTAGGGATGCCGCCGGTCC

^aUnderlines indicate the respective restriction sites.

^bF, forward; R, reverse.

^cFAM, 6-carboxyfluorescein.

In order to complement the mutation, genomic DNA was isolated from the wild-type R1 strain using a DNA kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions and purified using the Wizard SV gel and PCR clean-up system kit (Promega Co.) (46). The genes of DR1939 were amplified with primers dr1939-P1 and dr1939-P4, and the genes of DRA0185 were amplified with primers dr0185-P1 and dr0185-P4 (Table 2). The genes were ligated to the pRADK vector to obtain pRAD-dr1939 and pRAD-dra0185 (Table 1), which were subsequently transformed into the mutant using the CaCl₂ method and screened as described above to yield gene-complemented strains Δppk_Dr/c-ppk_Dr and Δppx_Dr/c-ppx_Dr.

Cell survival assays.

D. radiodurans wild-type R1 and mutant strains were cultured in TGY broth to an OD₆₀₀ of 1.0. The cell cultures were centrifuged, washed using phosphate-buffered saline (PBS; pH 7.5), and resuspended in PBS buffer. A total of 100 μl of the cell suspension was diluted with PBS to 10⁷ CFU ml⁻¹. For the survival assay of the wild-type R1 and mutant cells exposed to H₂O₂, cell suspensions were treated with 50 mM H₂O₂ for 30 min. Then, 6 μl of the cells at different dilutions using PBS was spotted onto the plates and incubated on TGY plates at 30°C for 3 days. The untreated cells were used as the controls. For survival curves, cell suspensions were treated with H₂O₂ at different concentrations for 30 min, and 100 μl of the cells was plated and cultured on TGY plates for 3 days before colonies were counted. Survival fractions were calculated as the ratio of the number of colonies from the treated wild-type or mutant cells to those from the untreated respective cells. All data are represented as mean ± SD from at least three independent experiments. For the effects of PolyP-Mn complex or PolyP hydrolysis products on cell survival under H₂O₂ treatment, 500 μl of cell suspensions was incubated with a mixture of 10 μg PolyP with different concentrations of Mn²⁺ in the absence or presence of 2.5 μl PPX_Dr (1 mg/ml), and then cells were treated with 80 mM H₂O₂. Next, 6 μl of cells at different dilutions using PBS was spotted onto the plates and incubated on TGY plates at 30°C for 3 days.

Detection of intracellular PolyP using DAPI staining method and urea PAGE assay.

In vivo polyphosphate detection using DAPI was carried out as described previously (47, 48). The wild-type strain R1 and mutant strain were cultured to an OD₆₀₀ of 1.0. Cells were collected by centrifugation, washed using phosphate-buffered saline (pH 7.5) to remove culture medium residue, and resuspended in the phosphate-buffered saline. The cell suspension was incubated with 50 μg/ml DAPI for 10 min. Then, the cells were placed onto specimen slides, covered with a glass cover, and sealed with nail polish at the periphery of the cover glass to prevent evaporation and flow. Images were obtained using a Leica DM4000 fluorescence microscope. DAPI-stained spectra were measured using a laser at 405 nm for excitation. The membrane was stained using Synapase C1 with red fluorescence.

For polyphosphate detection in vitro using the urea PAGE assay, the wild-type strain R1 and mutant strain were cultured to an OD₆₀₀ of 1.0. The cells were collected by centrifugation, washed using phosphate-buffered saline (pH 7.5) to remove culture medium residue, and resuspended with 400 μl of a 20% SDS solution and 3 ml of a saturated phenol solution. The suspension was incubated at 65°C for 10 min, and then 3 ml of chloroform was added and mixed. After centrifugation, the supernatant was treated with a mixture of DNase and RNase (50 mg/ml each) at 37°C for 1 h to remove DNA and RNA, respectively. A total of 20 μl of the obtained PolyP extract was loaded to 20% urea gels. After electrophoresis using the urea gel for 50 min at voltage of 120 V, the gel was rinsed with water 3 times, and finally stained with DAPI for 10 min. The stained gels were imaged under UV light.

PolyP extraction.

PolyP extraction and purification were performed as described by Josep Clotet (21), with some modifications as follows: 50-ml cell cultures (OD₆₀₀ of 1.0) were pelleted and resuspended in 400 μl of SDS (20%) and 3 ml of phenol. The suspension was boiled at 65°C for 10 min and subsequently 3 ml of chloroform was added. Cell debris was removed by centrifugation, and the supernatant was collected and treated with a DNase/RNase solution (50 mg/ml each) for 1 h at 39°C.

Metal ions assays.

Intracellular concentrations of metal ions were determined as described in our previously published paper (46). For an analysis of metal ions in polyphosphate extracts, 5 ml Ultrex II nitric acid (Fluka AG, Buchs, Switzerland) and 1 ml H₂O₂ were added to the PolyP extracts and incubated at 100°C for 2 h. The metal ion concentration in samples was measured using inductively coupled plasma mass spectrometry (ICP-MS; ELAN DRC-e, PerkinElmer, USA). The contents of Mn ion binding in PolyP extracts from cells were indicated as PolyP-binding Mn nmol/mg of dried cells. All data are represented as means and standard deviation of three independent experiments (mean ± SD).

Protein purification.

The gene encoding PPX_Dr or PPK_Dr was amplified from the D. radiodurans R1 genome (GenBank accession number CP015081.1) and cloned into pET-28a (Novagen) for generating a fusion protein with an N-terminal (His)₆ tag. Then, the plasmids were transformed into the E. coli BL21(DE3) strain. Cell cultures grown in LB medium were supplemented with 100 μM isopropyl-β-d-thiogalactopyranoside (IPTG) to induce gene expression. Cell pellets separated using centrifugation were resuspended in lysis buffer A (20 mM Tris-Cl [pH 7.5], 500 mM NaCl, 5% [vol/vol] glycerol, 10 mM β-mercaptoethanol, and 1% [vol/vol] Triton X-100). Cells were lysed using the high pressure cracker cell (Shanghai Litu Ltd., China). Following ultracentrifugation (15,000 × g, 30 min, and 4°C), the obtained protein supernatant was loaded onto a HisTrap HP column (GE Healthcare, USA) and eluted with elution buffer B (20 mM Tris-HCl [pH 7.5], 500 mM NaCl, and 500 mM imidazole). The collected protein fractions were further purified on a Superdex 200 10/300 GL column (GE Healthcare) with elution buffer C (20 mM Tris-HCl [pH 7.5] and 250 mM NaCl). Fractions containing the target proteins were pooled, concentrated, flash-frozen in liquid nitrogen, and stored in –80°C. The relative molecular masses of the dimer and monomer of PPX_Dr were obtained by the mathematical relations of molecular mass and elution volumes from standard elution curve.

Polyacrylamide gel electrophoretic analysis of exopolyphosphatase activity.

To assess exopolyphosphatase enzyme activity using urea-PAGE, the reaction mixture included 400 ng of PolyP (P100; a gift of PolyP standard from Adolfo Saiardi, University College London) dissolved in 20 mM Tris-NaCl (pH 7.5) and 3 μg PPX_Dr protein. The reaction was performed in the presence or absence of metal ion at 37°C for 15 min. Reaction products were electrophoresed on a urea-polyacrylamide gel, including 12% (wt/vol) acrylamide with 7 M urea and stained with DAPI.

Analysis of polyphosphatase kinase activity.

The PolyP synthesis assay was performed using a previously published method of detection based on ATP cleavage by the reaction mixture (49, 50). Briefly, the catalytic reaction by PPK_Dr was conducted in a 200-μl volume of 50 mM Tris-HCl (pH 8.0), 5 mM MgCl₂, 1 mM dithiothreitol (DTT), 1 mM ATP, 0.1 mM PolyP (P100), and 0.5 μg PPK_Dr at 37°C for 60 min, in which the ATP was used for PolyP chain extension. The reaction products were detected by a high-performance liquid chromatography (HPLC) system (Thermo, USA) with a Tnature C₁₈ column (4.6 by 250 mm; Waters, USA) at 30°C. The mobile phase contained a mixture of 30 mM monopotassium phosphate and 20 mM dipotassium phosphate (adjusting pH to 8.0 by hydrochloric acid) with methanol (95:5 [vol/vol]) at a flow rate of 0.6 ml/min. The detection wavelength was set at 254 nm.

Effect of PolyP metabolite with metal ions on BamHI enzyme activity.

For PolyP-metal ion complex preparation, a 50-μl reaction solution containing 10 μg PolyP was added with Mn²⁺, Mg²⁺, or Ca²⁺ at different concentrations (0.5, 1, 2, 3, 4, or 5 mM). The reaction solution was mixed and placed stably for 10 min at 25°C. For PolyP-metal degradation product preparation, a 50-μl solution of the PolyP-metal ion complex was added with 2.5 μl PPX_Dr (1 mg/ml) and incubated at 37°C for 15 min.

In order to determine the effect of the PolyP-metal complex and its products on BamHI activity, 5 μl (75 U) BamHI (TaKaRa Biotechnology) was mixed with 5-μl PolyP-metal complex or its degradation products and treated by addition of 150 mM H₂O₂ for 30 min. A total of 10 μl of the reaction solution and 1 μl (50 ng) double-stranded DNA (dsDNA; containing an enzyme-cutting site of BamHI) were mixed and incubated at 37°C for 1.5 h. After incubation, 15 μl quench buffer (50 mM EDTA, 0.05% SDS, and 0.01% bromophenol blue) was added, and 5 μl was taken for urea PAGE analysis.

Intracellular ROS and protein carbonylation assays.

Intracellular ROS level assays were performed using 2′, 7′-dichlorofluorescein diacetate (DCFH-DA) as a molecular probe (51). DCFH-DA is hydrolyzed into DCFH by intracellular esterase and then oxidized by intracellular ROS into DCF, which produces fluorescence that can be measured using a fluorescence spectrophotometer (SpectraMax M5) at an excitation wavelength of 485 nm and an emission wavelength of 525 nm (51). Protein carbonylation assays were carried out as described previously (46).

Assays of superoxide scavenging activities.

The superoxide scavenging activity of PolyP-Mn complex and PolyP-Mn hydrolysis products was determined by a total superoxide dismutase assay kit with WST‐8 (water-soluble tetrazolium dye-8; Beyotime Institute of Biotechnology) according to the manufacturer’s instructions.

Real-time quantitative PCR.

Real-time quantitative PCR (RT-qPCR) was used to measure ppk and ppx gene expression under oxidative stress conditions. First, cells were grown to an OD₆₀₀ of 0.6 and treated with 30 mM H₂O₂. Cells were then harvested by centrifugation at 5,000 × g at 4°C. Total RNA was extracted from 5 ml of cell cultures using TRIzol reagent (Invitrogen Corp., Carlsbad, CA, USA). cDNA synthesis was carried out by using the PrimeScript RT reagent kit, and RT-qPCR experiments were performed using SYBR premix Ex Taq (TaKaRa Biotechnology Ltd.). Primers used for RT-qPCR are listed in the Table 2. Differences in relative transcript abundance level were calculated and indicated by threshold cycle (2^−ΔΔCT) (46). Gene dr1343 which encodes glyceraldehyde 3-phosphate dehydrogenase (GADPH) was used as an internal control. All assays were performed using the Stragene Mx3005P real-time detection system.

Western blot analysis.

Protein synthesis levels were confirmed using Western blotting as described previously (46). Briefly, a 6× His tag was fused to the C terminus of PPK_Dr and PPX_Dr using the tripartite ligation and double-crossover recombination method as shown in Fig. S2B and D. Monoclonal anti-6× His mouse antibody (Proteintech, USA) was used to detect PPK_Dr-6× His, and PPX_Dr-6× His. Horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit IgG were added as secondary antibodies. The expression level of GroEL detected by a rabbit anti-GroEL polyclonal antibody served as an internal control (Sigma, USA). The commercial anti-GroEL was used to detect GroEL in D. radiodurans (46).

Statistical analysis.

Student’s t tests were used to assess the significance between results, and P values of <0.05 were considered significant.