Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2021 Mar 10;95(7):e02455-20. doi: 10.1128/JVI.02455-20

A Potent Anti-Simian Immunodeficiency Virus Neutralizing Antibody Induction Associated with a Germ Line Immunoglobulin Gene Polymorphism in Rhesus Macaques

Saori Matsuoka a,#, Takeo Kuwata b,✉,#, Hiroshi Ishii a,#, Tsuyoshi Sekizuka c, Makoto Kuroda c, Masato Sano a, Midori Okazaki a, Hiroyuki Yamamoto a, Mikiko Shimizu b, Shuzo Matsushita b, Yohei Seki d, Akatsuki Saito d, Hiromi Sakawaki e, Vanessa M Hirsch f, Tomoyuki Miura e, Hirofumi Akari d,e, Tetsuro Matano a,b,g,✉
Editor: Guido Silvestrih
PMCID: PMC8092685  PMID: 33441342

Vaccines against a wide variety of infectious diseases have been developed mostly to induce antibodies targeting pathogens. However, a small but significant percentage of people fail to mount potent antibody responses after vaccination, while the underlying mechanism of host failure in antibody induction remains largely unclear.

KEYWORDS: BCR, genetic polymorphisms, neutralizing antibodies, simian immunodeficiency virus

ABSTRACT

Virus infection induces B cells with a wide variety of B-cell receptor (BCR) repertoires. Patterns of induced BCR repertoires are different in individuals, while the underlying mechanism causing this difference remains largely unclear. In particular, the impact of germ line BCR immunoglobulin (Ig) gene polymorphism on B-cell/antibody induction has not fully been determined. In the present study, we found a potent antibody induction associated with a germ line BCR Ig gene polymorphism. B404 class antibodies, which were previously reported as potent anti-simian immunodeficiency virus (anti-SIV) neutralizing antibodies using the germ line VH3.33 gene-derived Ig heavy chain, were induced in 5 of 10 rhesus macaques after SIVsmH635FC infection. Investigation of VH3.33 genes in B404 class antibody inducers (n = 5) and noninducers (n = 5) revealed association of B404 class antibody induction with a germ line VH3.33 polymorphism. Analysis of reconstructed antibodies indicated that the VH3.33 residue 38 is the determinant for B404 class antibody induction. B404 class antibodies were induced in all the macaques possessing the B404-associated VH3.33 allele, even under undetectable viremia. Our results show that a single nucleotide polymorphism in germ line VH genes could be a determinant for induction of potent antibodies against virus infection, implying that germ line VH gene polymorphisms can be a factor restricting effective antibody induction or responsiveness to vaccination.

IMPORTANCE Vaccines against a wide variety of infectious diseases have been developed mostly to induce antibodies targeting pathogens. However, a small but significant percentage of people fail to mount potent antibody responses after vaccination, while the underlying mechanism of host failure in antibody induction remains largely unclear. In particular, the impact of germ line B-cell receptor (BCR)/antibody immunoglobulin (Ig) gene polymorphism on B-cell/antibody induction has not fully been determined. In the present study, we found a potent anti-simian immunodeficiency virus neutralizing antibody induction associated with a germ line BCR/antibody Ig gene polymorphism in rhesus macaques. Our results demonstrate that a single nucleotide polymorphism in germ line Ig genes could be a determinant for induction of potent antibodies against virus infection, implying that germ line BCR/antibody Ig gene polymorphisms can be a factor restricting effective antibody induction or responsiveness to vaccination.

INTRODUCTION

Vaccines have been developed to control epidemics of infection with a wide variety of pathogens. Antibodies (Abs) are a major effector in acquired immune responses and Ab induction is important for most vaccines to prevent infection. In antigen-specific Ab induction, naive B cells having B-cell receptors (BCRs) that can bind to the antigen are stimulated by antigen-BCR interaction. This priming is followed by boosting with further antigen-BCR interaction, leading to B-cell maturation with somatic mutations in BCR genes to acquire BCRs having higher antigen-binding affinity. Potent Abs are produced from plasma cells differentiated from these matured B cells (1, 2).

It is known that vaccination fails to mount potent effective antibody responses in a small but significant percentage of people (3, 4). Such vaccine failure is attributed to vaccine- and host-related factors (3). The former vaccine-related factors include suboptimal immunization protocols, inadequate antigenicity, and insufficient immunogenicity of vaccines, which can be logically overcome. Regarding the latter host-related factors, host immune conditions and genetic factors may be associated with nonresponsiveness, but the underlying mechanisms of the nonresponsiveness remain largely unexamined or unclear (3–7). Determination of host factors associated with induction of potent Abs is an important issue to be addressed for improvement of vaccine efficacy.

We previously reported potent monoclonal anti-simian immunodeficiency virus (anti-SIV) B404 and related B404 class neutralizing Abs (NAbs) isolated from rhesus macaques infected with SIVsmH635FC, a neutralization-sensitive strain obtained by passage from neutralization-resistant SIVsmE543-3-infected macaques (8–10). In the previous study (10), all four rhesus macaques infected with SIVsmH635FC showed induction of B404 class Abs under persistent viremia in the chronic phase of infection. The B404 class Abs, which consist of heavy chains having a variable region (VH), VH3.33 (11), with a long complementarity determining region (CDR3) and λ light chains, recognize a conformational epitope comprising SIV Env V3 and V4 loops and have potent NAb activity against various SIV strains. In the present study, to examine the mechanism for B404 class Ab induction, we performed another experiment with SIVsmH635FC infection in rhesus macaques. Unexpectedly, B404 class Ab induction was detected in only one of six SIVsmH635FC-infected macaques in the second experiment. We then examined why B404 class Ab was induced in some animals (all four macaques in the first [previous] experiment and one of six in the second [present] experiment) but not in others (five of the six in the second experiment). Analysis of germ line VH genes in these 10 animals found association of B404 class Ab induction with a macaque germ line VH3.33 polymorphism and revealed a VH3.33 residue determining the B404 class Ab induction. Our results suggest that germ line VH gene polymorphisms can be a factor affecting effective antibody induction.

RESULTS

Analysis of anti-SIV NAb responses in SIVsmH635FC-infected rhesus macaques.

Six Indian rhesus macaques were used for SIVsmH635FC infection in this study. At the screening of macaques, we examined TRIM5α polymorphism, which is known to affect SIVsm replication (12, 13). TRIM5_Q is permissive for SIVsm infection, whereas TRIM5_TFP and TRIM5Cyp are resistant (14–16). We do not know what level of SIV replication is optimal for potent antibody induction; it is expected that too high a viral load resulting in rapid immune deficiency may not be good for NAb induction, while too low a viral load may not be good for NAb induction either because of poor antigen stimulation. We thus selected, for this study, six rhesus macaques consisting of two (1964 and 1967) with TRIM5_Q/Q, two (1978 and 1994) with TRIM5_Q/TFP, and two (1980 and 2008) with TRIM5_Q/Cyp. In vitro SIVsmH635FC replication in peripheral blood mononuclear cells (PBMCs) was higher in macaque 1964 but lower in macaques 1980 and 2008 (Fig. 1).

FIG 1.

FIG 1

Open in a new tab

In vitro SIVsmH635FC replication in macaque PBMCs. SIV p27 concentrations in the culture supernatants from individual animal-derived PBMCs 6 days after SIVsmH635FC infection are shown.

After intravenous SIVsmH635FC infection, animals 1964 and 1967, possessing TRIM5_Q/Q, had relatively higher viral loads (Fig. 2). One of them, 1967, showed rapid AIDS progression and was euthanized at week 21 postinfection. Macaques 1978 and 1994, possessing TRIM5_Q/TFP, also showed persistent SIV infection. In contrast, viremia was detected only in the acute phase in macaques 1980 and 2008, possessing TRIM5_Q/Cyp.

FIG 2.

FIG 2

Open in a new tab

Plasma viral loads after SIVsmH635FC infection. Plasma viral loads (SIV gag RNA copies/ml plasma) were determined as described previously (54). The lower limit of detection is approximately 4 × 102 copies/ml. Data on macaques 1964 and 1967, possessing TRIM5_Q/Q, 1978 and 1994, possessing TRIM5_Q/TFP, and 1980 and 2008, possessing TRIM5_Q/Cyp, are shown. Macaque 1967 showed rapid AIDS progression and was euthanized at week 21 postinfection. Macaques 1978 and 1994 were euthanized at week 51. Macaques 1964, 1980, and 2008 (marked by asterisks here and in Fig. 3) were superchallenged with SIVsmH805-24w-3 at week 51 and euthanized at week 55.

We examined postinfection plasma NAb titers against SIVsmH635FC, SIVsmE543-3, and SIVmac316 (Fig. 3). Macaque 1967 showed rapid disease progression with no induction of detectable NAb responses. Macaques 1964, 1978, and 1994 showing persistent viremia efficiently induced NAb responses against the inoculated SIVsmH635FC and the genetically divergent, neutralization-sensitive SIVmac316, whereas lower NAb responses were detected in macaques 1980 and 2008, without persistent viremia. NAb responses against neutralization-resistant SIVsmE543-3 were undetectable or marginal in most animals but induced in macaque 2008, although not so efficiently. Macaques 1978 and 1994 were euthanized at week 51, while macaque 1964, one of the three animals with efficient induction of anti-SIVsmH635FC NAb responses, and macaques 1980 and 2008, showing poor anti-SIVsmH635FC NAb induction, were superchallenged with SIVsmH805-24w-3 at week 51 and euthanized at week 55. In macaques 1980 and 2008, viremia was undetectable by nested reverse transcription-PCR (RT-PCR) using primers that can detect SIVsmH805-24w-3 as well as SIVsmH635FC, even after the SIVsmH805-24w-3 superchallenge. Anti-SIVsmE543-3 NAb responses were increased after the superchallenge in macaques 1980 and 2008.

FIG 3.

FIG 3

Open in a new tab

NAb responses after SIVsmH635FC infection. Plasma neutralizing titers against SIVsmH635FC (open circles), SIVsmE543-3 (open triangles), and SIVmac316 (open inverted triangles) are shown.

Analysis of anti-SIV Fab clones obtained from LNs by biopanning.

We then attempted to obtain monoclonal anti-SIV Env Ab antigen-binding fragment (Fab) clones by biopanning using phage display libraries from peripheral lymph node (LN) samples around 1 year postinfection (Fig. 4A and Table 1). Interestingly, VH3.33-derived B404 class Fab clones with NAb activity were isolated only from macaque 1980, which showed undetectable persistent viremia and inefficient anti-SIVsmH635FC NAb induction. These B404 class Fab clones showed neutralizing activity against SIVsmE543-3 and SIVmac316, as well as SIVsmH635FC (Fig. 4B). While varieties of anti-Env Fab clones derived from various VH alleles were obtained from macaques other than 1980, the majority did not show anti-SIVsmH635FC neutralizing activity (Fig. 4A and Table 1). Some non-1980-derived Fab clones had anti-SIVsmH635FC neutralizing activity, but most of them showed relatively lower anti-SIVmac316 neutralizing activity compared with 1980-derived B404 class Fab clones (Fig. 4B).

FIG 4.

FIG 4

Open in a new tab

Anti-Env monoclonal Fab clones obtained by biopanning. (A) Total numbers of SIV Env-specific monoclonal Fab clones obtained from macaque peripheral LNs at weeks 51 and 55 postinfection (wpi) by biopanning. The numbers of Fab clones showing detectable anti-SIVsmH635FC NAb responses [NA(+)] are also shown. ND, not determined (because macaques 1978 and 1994 were euthanized at week 51). (B) NAb titers against SIVsmH635FC, SIVsmE543-3, SIVmac316, and SIVmac239. NAb titers (IC50 [50% inhibitory concentration] [μg/ml]) of the NA(+) anti-Env Fab clones are shown.

TABLE 1.

Anti-Env monoclonal Fab clones obtained by biopanning

graphic file with name JVI.02455-20-t0001.jpg

Open in a new tab
a

The germ line gene was analyzed by Ig BLAST.

b

H-chain CDR amino acid sequence and length were analyzed by IMGT.

c

Anti-SIVsmH635FC neutralization activity was examined.

NGS analysis of BCR VH sequences derived from PBMCs and LNs.

To examine if B404 class Ab was induced only in macaque 1980 but not in the other five animals, we performed next-generation sequencing (NGS) analysis of BCR VH genes in these six animals at several time points. PBMC- or LN-derived IgG VH cDNAs were amplified by using a VH3-specific forward primer and an IgG-specific reverse primer and subjected to NGS analysis (Table 2). PBMCs obtained before infection and around 3, 6, and 12 to 13 months postinfection and LNs obtained around 12 to 13 months were used for the analyses. The phylogenetic tree of all of the IgG VH sequences with B404 class Fab controls obtained by biopanning from four macaques (H704, H709, H714, and H723) in the previous study (10) found a group of sequences clustered with B404 class Abs (Fig. 5A). None of these sequences were derived from postinfection samples of animals other than macaque 1980. B404 class Ab sequences that shared a long CDR3 having almost identical 23-amino-acid sequences were confirmed in 1980 LNs (Fig. 5B and C). One of these sequences derived from 1980 LN had the same VH sequence, with a B404 class neutralizing Fab clone obtained from 1980 LN by biopanning. These results confirmed that B404 class Abs were induced only in macaque 1980 even under undetectable viremia but not in the other five macaques.

TABLE 2.

Reads in NGS analysis of IgG VH genes

Animal Sample PBMCsa No. of reads
Total VH3.33b ET (38E 65T)c VI (38V 65I) ETS (38E 65T 88S)
1964 PBMC Pre 133,638 5,559 0 744 0
W13 91,991 6,060 0 381 0
W22 212,037 18,854 0 1,131 0
W51 66,550 12,540 0 595 0
W55 160,260 9,646 0 416 0
LN W51 331,832 13,716 0 2,008 0
W55 196,168 12,004 0 1,171 0
1967 PBMC W13 44,597 5,529 0 570 0
W21 205,494 17,107 0 811 0
LN W21 560,272 78,379 0 9,425 0
1978 PBMC Pre 108,001 18,589 27 820 0
W13 119,734 3,912 0 935 0
W22 97,921 6,697 0 471 0
W51 64,481 5,027 0 225 0
LN W51 386,893 41,771 0 5,183 0
1994 PBMC Pre 142,468 5,980 62 524 0
W13 85,924 2,924 0 239 0
W22 171,007 4,092 0 1,272 0
W51 16,460 1,784 0 91 0
LN W51 307,771 15,497 1 2,750 0
1980 PBMC Pre 180,532 9,798 1,678 673 0
W13 96,672 5,737 636 429 0
W22 167,250 9,954 1,181 798 1
W51 100,230 6,261 1,285 317 13
W55 107,721 6,450 398 375 74
LN W51 279,422 22,881 2,440 606 0
W55 523,605 25,921 3,109 3,554 152
W55* 330,004 23,023 4,523 2,999 0
2008 PBMC Pre 142,703 13,051 0 359 0
W13 150,669 12,998 1 579 0
W22 287,585 23,629 0 1,359 0
W51 161,749 16,418 0 465 35
W55 224,171 20,660 0 1,173 0
LN W51 202,048 23,198 0 1,990 0
W55 336,180 43,291 0 3,495 42
Open in a new tab
a

Shown are the times PBMCs or LNs were obtained. W, week; Pre, preinfection. An asterisk indicates that mesenteric LNs were obtained in macaque 1980 at week 55 (W55*). The other LNs represented were inguinal or axillary.

b

Sequences closer to VH3.33 than other VH genes. These sequences may contain VH sequences other than VH3.33, such as unidentified VH genes and VH genes with many somatic mutations.

c

Sequences with ETS are not included.

FIG 5.

FIG 5

Open in a new tab

NGS analysis of IgG VH genes. We used PBMCs obtained preinfection (Pre) and at weeks (W) 13 and 22 from macaque 1967, at weeks 13, 21, and 51 from macaques 1978 and 1994, and at weeks 13, 21, 51, and 55 from macaques 1964, 1980, and 2008. We also used inguinal or axillary LNs at week 21 in macaque 1967, at week 51 in macaques 1964, 1978, 1994, 1980, and 2008, and at week 55 in macaques 1964, 1980, and 2008, as well as mesenteric LNs at week 55 (W55*) in macaque 1980. BCR VH regions were amplified from these PBMC- and LN-derived cDNAs using the VH3-specific forward primer and the reverse primer specific for the constant region of IgG and were subjected to NGS analysis. (A) Phylogenetic tree of all of the obtained VH sequences from six macaques in the present study and B404 class Ab controls obtained by biopanning from four macaques in the previous study (10). Sequences clustered with B404 class Abs are shown in light blue. (B) Phylogenetic tree of VH sequences clustered with B404 class Abs (which are shown in light blue in panel A). The B404 class Ab controls obtained by biopanning are shown in dark blue. Macaque 1980-derived sequences defined as B404 class Abs are shown in red. (C) List of LN-derived VH sequences that clustered with B404 class Abs. A list of VH clones obtained by biopanning from macaque 1980 LNs is also shown at the bottom. In individual sequences, derived samples, CDR3 amino acid (aa) sequences and lengths, and VH residues 38, 63, and 65 are shown. All of the sequences were derived from only macaque 1980.

Analysis of germ line VH3.33 polymorphisms.

Next, to examine a possible determinant for the B404 Ab induction, we analyzed germ line VH3.33 allele sequences in 10 SIVsmH635FC-infected macaques consisting of four B404 class Ab inducers in the previous study (10) and six macaques in the present study. We found polymorphisms in the rhesus macaque VH3.33 gene, coding for aspartic acid (E) or valine (V) at residue 38 in CDR1 and threonine (T) or isoleucine (I) at residue 65 in CDR2 (Fig. 6). VH3.33 alleles having 38E and 65T (VH3.33_ET), 38V and 65I (VH3.33_VI), and 38V and 65T (VH3.33_VT) were identified in these macaques. Remarkably, the VH3.33_ET allele was found in all five B404 class Ab inducers but not in the remaining five noninducers (Fig. 6). Indeed, all of the B404 class Abs isolated by biopanning and B404 class Ab sequences from macaque 1980 had 38E and 65T (Fig. 5C), suggesting that these B404 class Abs were derived from the VH3.33_ET allele but not from VH3.33_VI.

FIG 6.

FIG 6

Open in a new tab

Germ line VH3.33 polymorphisms. (A) Alignment of germ line VH3.33 allele sequences. VH3.33 alleles ET-1, ET-2, VI-1, VI-2, and VT are shown with a related sequence, ETS. Codons for 38E/V and 65T/I polymorphisms are indicated by shadow. (B) Numbers of VH3.33 allele clones obtained from individual animals. Amplified full-length VH3.33 genes were cloned and subjected to sequencing for allele determination. (C) VH3.33 allele distribution in 10 macaques. The VH3.33 allele was determined by direct sequencing of the PCR products amplified using VH3.33-specific primers. (D) Schema of germ line VH3.33 allele structure and polymorphism. Nucleotide and amino acid sequences in CDR1 and CDR2 are shown. (E) Germ line VH3.33 alleles and B404 class Ab induction in six macaques in the present study and four in the previous study (10). ET, VH3.33 allele having 38E and 65T; VI, VH3.33 having 38V and 65I; VT, VH3.33 having 38V and 65T. Animals having VH3.33_ET showed B404 class Ab induction, but others did not.

To clarify the effect of VH3.33 gene polymorphism on B404 class Ab induction, we constructed B404 Fab mutants by replacing the VH CDR1, CDR2, and/or FR3 regions of B404 Fab with those of germ line VH3.33_ET- or VH3.33_VI allele (Fig. 7A). These germ-line-reverted B404 Fab mutants were examined for their ability to bind to SIVsmH635FC Env (Fig. 7B). SIVsmH635FC Env binding function was maintained in the mutant ET having the region from CDR1 to FR3 of VH3.33_ET but lost in VI having the same region of VH3.33_VI. The binding function was lost by replacement of CDR1 with VH3.33_VI (CDR1V) but not by replacement of CDR2 with VH3.33_VI (CDR2I). The G63D substitution frequently observed in B404 class Abs enhanced the Env reactivity of VH3.33_ET-reverted CDR1&2ET mutant but showed no increase in the reactivity of the VH3.33_VI-reverted CDR1&2VI mutant. Further analysis revealed loss of Env binding of B404-derived Fabs having CDR1 with 38V: i.e., E-to-V substitution at residue 38 in CDR1 abolished Fab binding to SIVsmH635FC, SIVsmE543-3, SIVmac316, and SIVmac239 Env (Fig. 7C). Neutralizing activity against SIVsmH635FC was lost by the E-to-V substitution at the residue 38 (Fig. 7D). Consistently, the 38E was conserved in all of the obtained B404 class Abs, although substitutions were often observed at residue 65, the other polymorphic site of VH3.33. These results indicate that the E at VH3.33 residue 38 is essential for B404 class Ab binding to SIV Env and the determinant for B404 class Ab induction.

FIG 7.

FIG 7

Open in a new tab

Germ-line-reverted B404 mutants. (A) Schema of germ-line-reverted B404 mutants. CDR1, FR2, CDR2, and FR3 regions of the B404 heavy chain were entirely or partially reverted to germ line VH3.33_ET and VH3.33_VI. Substitution from 63G to 63D, a mutation frequently observed in B404-class Abs, was inserted into CDR1&2ET and CDR1&2VI, respectively. (B) SIVsmH635FC Env binding activity (OD) analyzed by ELISA of individual germ-line-reverted B404 Fab mutants. (C) Relative SIVsmH635FC, SIVsmE543-3, SIVmac316, and SIVmac239 Env binding activity of individual germ-line-reverted B404 Fab mutants to that of the wild-type B404 Fab. (D) Neutralizing activity (percentage of inhibition) of germ-line-reverted B404 Fab mutants against SIVsmH635FC infection.

DISCUSSION

In the present study, we showed association of B404 class Ab induction with a germ line VH3.33 gene polymorphism. All of the B404 class Ab inducers had the VH3.33_ET allele, but the noninducers did not. NGS analysis of BCR VH sequences revealed that macaques without VH3.33_ET, even if having efficiently induced anti-SIVsmH635FC NAb responses with persistent infection, showed no detectable B404 class Ab induction. In contrast, B404 class Ab sequences were observed in VH3.33_ET-positive macaque 1980 even under undetectable viremia in the chronic phase. The 38th amino acid in VH3.33 CDR1 is the determinant for B404 class Ab induction in SIVsmH635FC infection. This is the first report demonstrating restriction of potent NAb induction by a germ line VH gene polymorphism in macaque models of SIV infection.

Nonresponsiveness to vaccination is a critical issue to be addressed for improvement of vaccine efficacy. It is thus important to define the mechanism for the nonresponsiveness. The most documented is on hepatitis B vaccines showing failure in induction of protective antibodies in approximately 10% of vaccinated individuals (5). Association of this nonresponsiveness with obesity, heavy smoking, and certain HLA class II haplotypes (HLA-DRB1 and HLA-DQB1) has been suggested (3, 17, 18). However, contribution of germ line VH gene polymorphisms to vaccine nonresponsiveness has not been examined well, possibly because of a wide repertoire of Ig germ line genes.

NAb responses are not efficiently induced in HIV infection, while potent broadly neutralizing Abs (bNAbs) are induced in the chronic phase in a small fraction of HIV-infected individuals. Monoclonal anti-HIV bNAbs have been isolated from these individuals (19–22) and have been shown to have VH-coding genes with somatic hypermutations (SHMs) and longer CDR3 (1, 23–25). However, it is still difficult to induce these anti-HIV bNAbs by vaccination. Recent studies of induction of VRC01 class bNAbs, a representative class of bNAbs targeting the HIV Env CD4 binding site (CD4bs), have developed a germ line-targeting immunization approach to prime B cells carrying immature BCRs, precursor bNAbs (26–31). VRC01 class bNAbs are derived from VH1-2, but current analyses have found that VRC01 class Ab induction is affected by germ line VH1-2 polymorphism (32, 33). VRC01 class Abs are mostly derived from a VH1-2 allele, VH1-2*02, whose three amino acids, 50W, 58N, and 71R, were indicated to be important for the interaction of VRC01 class Abs with HIV Env. VRC01 class Ab precursors can be primed by the germ-line-targeting immunization approach but not efficiently by HIV-1 Env antigens. In contrast, B404 class Abs were induced in all of the SIVsmH635FC-infected macaques possessing the germ line VH3.33_38E allele, even under undetectable viremia. Thus, our results indicate that a single nucleotide polymorphism in germ line VH genes could govern the induction of antibodies targeting a dominant epitope, implying that germ line VH gene polymorphisms can be a factor restricting responsiveness to vaccination.

The germ-line-targeting immunogen may prime precursor VRC01 class Abs but is likely to be insufficient to induce enough somatic mutations for bNAb elicitation. Further interaction between antigens and BCRs after the priming is required for maturation of B cells with BCR SHMs, resulting in higher binding affinity of BCRs with antigens (34, 35). It has been indicated that induction of anti-HIV bNAbs needs intensive B-cell maturation under sequential antigen-BCR interaction (1, 36, 37). In our study, SIVsmH635FC infection induced B404 class Abs in all the macaques possessing VH3.33_ET. Data obtained by Fab cloning (Fig. 4) and VH NGS analysis (Fig. 5) indicated dominant induction of B404 class Abs even in a VH3.33_ET-positive macaque controlling viremia, followed by SIVsmH805-24w-3 superchallenge-mediated boosting of B404 class Abs. These results imply that, in VH3.33_ET-positive macaques, B404 class Ab responses can be primed by the SIVsmH635FC Env immunogen and may possibly be boosted by SIVsmH635FC Env-related immunogens, such as previously observed mutant Envs in SIVsmH635FC infection (38). B404 class Ab is different from anti-HIV-1 bNAbs, and analysis of its induction may not lead to elucidation of the mechanism for anti-HIV-1 bNAb induction. However, analysis of the process of B404 class Ab induction in rhesus macaques carrying the VH3.33_38E-65T allele can contribute to our understanding of the mechanism for B-cell priming and maturation toward potent NAb induction against virus infection. Additionally, macaque 2008 with undetectable viremia induced no B404 class Abs but detectable anti-SIVsmE543-3 NAbs, which may be another model for analysis of the process for potent NAb induction.

In summary, we found a potent anti-SIV NAb induction associated with a germ line Ig VH gene polymorphism in rhesus macaques. This study shows that a single nucleotide polymorphism in germ line VH genes could be a determinant for potent antibody induction against virus infection, indicating that germ line VH gene polymorphisms can be a factor restricting effective antibody induction or responsiveness to vaccination.

MATERIALS AND METHODS

Animal experiments.

Indian rhesus macaques were provided from the Primate Research Institute, Kyoto University (PRI-KU), and animal experiments were carried out in the Institute for Frontier Life and Medical Sciences, Kyoto University (IFLMS-KU) after approval (no. H26-124) by the Committee on the Ethics of Animal Experiments of PRI-KU and IFLMS-KU under the guidelines for animal experiments at PRI-KU, IFLMS-KU, and the National Institute of Infectious Diseases, which are in accordance with the Guidelines for Proper Conduct of Animal Experiments established by the Science Council of Japan (http://www.scj.go.jp/ja/info/kohyo/pdf/kohyo-20-k16-2e.pdf). Blood collection, biopsy, and virus inoculation were performed under ketamine anesthesia. Animals were euthanized at the end of experiments or at the endpoint determined by 10% loss of body weight, diarrhea, and general weakness. At euthanasia, animals were deeply anesthetized with pentobarbital under ketamine anesthesia, and then whole blood was collected from the left ventricle.

We examined TRIM5α polymorphisms of 12 Indian rhesus macaques for screening and selected for the present study six rhesus macaques, consisting of two possessing TRIM5_Q/Q, two possessing TRIM5_Q/TFP, and two possessing TRIM5_Q/Cyp. TRIM5 genotyping was conducted as described before (16, 39). Briefly, the TRIM5 exon 8 region was amplified from PBMC-derived genomic DNAs by PCR using primers with the sequences TGACTCTGTGCTCACCAAGCTCTTG and ACCCTACTATGCAATAAAACATTA. The PCR products were subcloned into the TOPO vector (Invitrogen) and sequenced. To assess infectivity of SIVsmH635FC in individual macaque-derived PBMCs, phytohemagglutinin (PHA)-stimulated PBMCs (2 × 105 cells) were infected with SIVsmH635FC (2 × 105 50% tissue culture infective doses [TCID50]), and SIV Gag p27 concentrations in the culture supernatants on day 6 postinfection were examined using a p27 antigen capture assay (Advanced BioScience Laboratories). The selected six animals were intravenously challenged with SIVsmH635FC having 50 ng of p27. Three of them (macaques 1964, 1980, and 2008) were superchallenged with SIVsmH805-24w-3 (50 ng of p27) at week 51 after SIVsmH635FC infection.

Preparation of virus stocks.

Infectious molecular clones SIVsmH635FC (8), SIVsmE543-3 (40), SIVmac316 (41), SIVmac239 (42), and SIVsmH805-24w-3 (43) were transfected into 293T cells with X-tremeGENE 9 DNA transfection reagent (Roche Diagnostics GmbH), and 2 days later, the culture supernatants were obtained and stored after filtration (0.45-μm pore) at −80°C as virus stocks.

Analysis of neutralizing activity.

Neutralizing activity of Fab clones and plasma samples was measured as the reduction in luciferase activity after infection of TZM-bl cells as described before (10). Briefly, serially diluted samples were incubated in duplicate with 200 TCID50 of virus in a 96-well plate at 37°C. After incubation for 1 h, 1 × 104 TZM-bl cells were added. Two days later (or 3 days later for the anti-SIVsmH635FC assay), cells were lysed, and the luciferase activity was measured using a Promega luciferase assay system.

Isolation of anti-Env Fab clones by biopanning.

Construction of Fab libraries and screening of Fab clones reactive to Env were performed as described previously (9). Briefly, the Fab libraries from SIV-infected rhesus macaques were constructed using the pComb3X system according to the instruction described before (44). RNA was extracted from macaque peripheral (inguinal or axillary) LN-derived lymphocytes using the RNeasy minikit (Qiagen) and subjected to reverse transcription and PCR (RT-PCR) using the oligo(dT)20 primer, ReverTra Ace (Toyobo), and Platinum Taq high-fidelity DNA polymerase (Invitrogen). For amplification of Ig cDNAs, we used previously described primers (9), except for the Vλ forward primer RhSCLam4m (5′-GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGYCSCCBTC-3′) instead of RhSCLam4 and the Vλ reverse primer RhCL5-B (5′-BTCAGACACACTAGTGTGGCCTTG-3′) instead of HCL5-B. Amplified Ig cDNAs were inserted into pComb3X, and transformed XL1-Blue cells (Stratagene) were incubated with VCSM13 helper phage (Stratagene) to obtain library phage stocks. Two libraries with κ and λ light chains, respectively, were constructed for individual macaques.

Biopanning to select anti-Env Fab clones was performed using SIV antigens, which were prepared by infection of PM1/CCR5 cells with SIVsmE543-3, as described previously (11). A MaxiSoap 96-well plate (Thermo Fisher Scientific) was coated with Fab H301, which recognizes gp120 V1, and Env proteins in SIV antigens were captured on the well. The phage library was incubated in the well for 2 h at 37°C, and the bound phages were eluted with 100 mM glycine (pH 2.2). Amplified phages were used for the next round of panning, and 5 or 6 rounds of panning were performed. This biopanning system is suitable for isolation of B404 class Fab clones, as shown previously (10).

Fab clones specific to Env were obtained after screening by concanavalin A (ConA) SIV enzyme-linked immunosorbent assay (ELISA) using SIV antigens (9). Sequencing of the Fab clones was performed using primers ompseq and pelseq. Identical clones and defective clones were not used for further study. The Ig domains were determined using IMGT/V-QUEST in the International Immunogenetics Database (IMGT [http://www.imgt.org/]). The germ line V, D, and J genes were analyzed by IgBlast (https://www.ncbi.nlm.nih.gov/igblast/), with VH sequences numbered according to IMGT/V-QUEST.

Fab production and purification.

TOP10F′ cells (Invitrogen) transformed by Fab clones were cultured in SB medium containing 50 μg/ml carbenicillin at 30°C overnight, and Fab was produced in the culture with fresh Super broth (SB) medium containing 2 mM isopropyl-β-d-thiogalactopyranoside (IPTG) (Wako Pure Chemical Industries) for 5 h at 37°C. The bacterial pellets were resuspended in phosphate-buffered saline (PBS) at 1 g/10 ml and sonicated by a Sonifier 250 (Branson, St. Louis, MO). Fab proteins were purified from the soluble fraction by a His60 Ni Superflow resin column (Clontech) according to the manufacturer’s instructions and concentrated by Amicon Ultra-4 (Millipore).

ELISA to detect anti-SIV Fab.

ELISA was performed as described before (9). Briefly, wells were coated with PBS containing 50 ng/ml ConA (Sigma) and then immobilized by addition of SIV antigens. The wells were blocked with 5% skim milk (Wako Pure Chemical Industries) in PBS (MPBS), and anti-Env Fabs with a hemagglutinin (HA) tag were detected by anti-HA peroxidase-conjugated 3F10 (1:1,000 dilution) (Roche Molecular Biochemicals) and ABTS [2,2′-azinobis(3-ethylbenzthiazolinesulfonic acid)] solution (Roche). For preparation of SIV antigens, 293T cells were transfected with SIVsmH635FC, SIVsmE543-3, SIVmac316, and SIVmac239 molecular DNA clones and lysed in 1% Triton X-100–TBS (10 mM Tris, 150 mM NaCl, pH 7.6).

NGS analysis of BCR IgG VH cDNAs.

Total RNAs were extracted from 5 × 106 PBMCs or LN-derived lymphocytes using an RNeasy minikit and subjected to RT using a QuantiTech RT kit (Qiagen) and random primers. BCR IgG VH-coding cDNAs were amplified using a VH-3-specific 5′-primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGGTGTCCAGTGTGARGTGCAG), and an IgG-specific 3′-primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCCTTGGTGGAGGCTGAGGAGACGGTGAC). PCR amplification was performed with a set of unique 8-bp Illumina barcodes to obtain DNA libraries, which were subjected to 2 × 300-bp paired-end indexed sequencing using Illumina MiSeq.

PCR amplicon deep sequencing of the BCR VH region was performed with the Illumina MiSeq reagent kit v.3 on the MiSeq instrument (Illumina) according to the manufacturer’s instructions with a 350-mer for read 1 and a 250-mer for read 2. Sequencing reads were analyzed by Sickle (https://github.com/najoshi/sickle) to remove the adapters and low-quality reads (quality score of ≤20 [≤Q20]). Trimmed paired-end reads (≥100 bp) were joined into single amplicon sequences using fastq-join (https://expressionanalysis.github.io/ea-utils/), and low-quality reads (≤Q20) were removed by “split_libraries_fastq.py” in QIIME v.1.9.1 program (45). All assembled amplicon sequences were merged, followed by excluding singleton and chimera sequences with the vsearch v.2.10.4 program by using the “derep_fulllength” and “uchime_denovo” options, respectively (46). To construct a representative sequence database clustered at ≥98% nucleotide identity, the extracted unique sequences were analyzed with the vsearch program by using the “cluster_size” option. The homology searching against the database was performed with the vsearch program by using the “usearch_global” option in each sample, followed by summarizing the number of amplicon sequences with ≥98% nucleotide identity against representative sequences. The amino acid sequences of BCR VH region were converted from representative sequences by the “transeq” program in EMBOSS (47). The multiple alignment of amino acid sequences was performed by mafft with G-INS-i options (48), followed by conversion to multiple alignment of nucleotide sequences with the PAL2NAL program (49). The phylogenetic analysis was performed with aligned nucleotide sequences by FastTree2 (50), followed by visualization using iTOL2 (51). The type of VH gene was predicted by igBLAST v.1.4 with a database of rhesus monkey V, J, and D genes (https://ftp.ncbi.nih.gov/blast/executables/igblast/release/old_internal_data/) (52, 53).

Determination of germ line VH3.33 alleles.

The whole VH3 genes were amplified by Platinum Taq high-fidelity DNA polymerase using primers VH3F (5′-ATGGAGTTTGTGCTGAGTT-3′) and VH3R (5′-CTGACTTCTCCTCACTGTG-3′). The PCR products were cloned by TA cloning kit (Invitrogen). VH3.33-specific primers VH333F (5′-TCTCTTGTGTAGCCTCTGGGT-3′) and VH333R (5′-GCTGTTCATTTGCAGAAACAGTGA-3′) were used for amplification of the VH3.33 gene, and VH3.33 allele was determined by direct sequencing of PCR products. Cloning of the VH3.33 gene identified 6 variants, ET-1, ET-2, VI-1, VI-2, VT, and ETS (Fig. 6A). Among them, there were few ETS variant reads in the NGS analysis of IgG transcripts (Table 2), suggesting that the ETS variant is a pseudogene.

Construction of B404 mutants.

All of the B404 heavy-chain mutants were constructed by PCR using the Fab B404 plasmid (9, 10) as a template and subsequent homologous recombination using Gibson assembly master mix (New England BioLabs). The CDR1/FR2/CDR2/FR3, CDR1/FR2/CDR2, CDR1, and CDR2 regions of B404 were replaced with those derived from germ line VH3.33_ET and VH3.33_VI to obtain ET, VI, CDR1&2ET, CDR1&2VI, CDR1E, CDR1V, CDR2T, and CDR2I, respectively. The mutant FR3 was constructed to have the FR3 amino acid sequence identical to those of both VH3.33_ET and VH3.33_VI. CDR1&2ET.63D and CDR1&2VI.63D were obtained by mutagenesis from 63G to 63D from CDR1&2ET and CDR1&2VI, respectively.

Data availability.

The short-read sequences obtained by NGS were deposited in the DNA Data Bank of Japan (BioProject accession no. PRJDB8484, BioSample accession no. SAMD00176318 to SAMD00176353, and DDBJ Sequence Read Archive [DRA] accession no. DRA008635). Sequence data from Ig clones are available under GenBank accession no. MN109605 to MN109944. Sequence data for VH3.33 alleles are available under GenBank accession no. MN109945 to MN109950.

ACKNOWLEDGMENTS

This work was supported by the Cooperative Research Program of PRI-KU (H26-C6 and H27-B75), the Joint Usage/Research Center Program of IFLMS-KU, and the Collaborative Research Unit for Viral Diseases between PRI-KU and IFLMS-KU. This work was also supported by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) in Japan (JSPS KAKENHI [18K06032 and 18H02666]) and the Japan Agency for Medical Research and Development (AMED) under grant no. JP20fk0410033, JP20fk0410011, JP20fk0108125, JP20fk0108139, JP20jk0210002, and JP19jm0110012.

S. Matsuoka, T. Kuwata, H. Ishii, T. Miura, H. Akari, and T. Matano conceived and designed the experiments. T. Kuwata, Y. Seki, A. Saito, H. Sakawaki, T. Miura, and H. Akari performed monkey experiments. V. M. Hirsch provided samples. S. Matsuoka, T. Kuwata, H. Ishii, T. Sekizuka, M. Sano, M. Okazaki, and M. Shimizu performed experiments for molecular, virological, and immunological analyses. S. Matsuoka, T. Kuwata, H. Ishii, T. Sekizuka, M. Kuroda, M. Sano, H. Yamamoto, S. Matsushita, H. Akari, and T. Matano analyzed the data. S. Matsuoka, T. Kuwata, H. Ishii, T. Sekizuka, M. Kuroda, V. M. Hirsch, T. Miura, H. Akari, and T. Matano contributed to preparing the manuscript. S. Matsuoka, T. Kuwata, and H. Ishii contributed equally to the work.

REFERENCES

  • 1.Haynes BF, Kelsoe G, Harrison SC, Kepler TB. 2012. B-cell-lineage immunogen design in vaccine development with HIV-1 as a case study. Nat Biotechnol 30:423–433. doi: 10.1038/nbt.2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Moir S, Fauci AS. 2017. B-cell responses to HIV infection. Immunol Rev 275:33–48. doi: 10.1111/imr.12502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wiedermann U, Garner-Spitzer E, Wagner A. 2016. Primary vaccine failure to routine vaccines: why and what to do? Hum Vaccin Immunother 12:239–243. doi: 10.1080/21645515.2015.1093263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cotugno N, Ruggiero A, Santilli V, Manno EC, Rocca S, Zicari S, Amodio D, Colucci M, Rossi P, Levy O, Martinon-Torres F, Pollard AJ, Palma P. 2019. OMIC technologies and vaccine development: from the identification of vulnerable individuals to the formulation of invulnerable vaccines. J Immunol Res 2019:8732191. doi: 10.1155/2019/8732191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kubba AK, Taylor P, Graneek B, Strobel S. 2003. Non-responders to hepatitis B vaccination: a review. Commun Dis Public Health 6:106–112. [PubMed] [Google Scholar]
  • 6.Rendi-Wagner P, Korinek M, Winkler B, Kundi M, Kollaritsch H, Wiedermann U. 2007. Persistence of seroprotection 10 years after primary hepatitis A vaccination in an unselected study population. Vaccine 25:927–931. doi: 10.1016/j.vaccine.2006.08.044. [DOI] [PubMed] [Google Scholar]
  • 7.Weinberger B, Keller M, Fischer KH, Stiasny K, Neuner C, Heinz FX, Grubeck-Loebenstein B. 2010. Decreased antibody titers and booster responses in tick-borne encephalitis vaccinees aged 50–90 years. Vaccine 28:3511–3515. doi: 10.1016/j.vaccine.2010.03.024. [DOI] [PubMed] [Google Scholar]
  • 8.Kuwata T, Dehghani H, Brown CR, Plishka R, Buckler-White A, Igarashi T, Mattapallil J, Roederer M, Hirsch VM. 2006. Infectious molecular clones from a simian immunodeficiency virus-infected rapid-progressor (RP) macaque: evidence of differential selection of RP-specific envelope mutations in vitro and in vivo. J Virol 80:1463–1475. doi: 10.1128/JVI.80.3.1463-1475.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kuwata T, Katsumata Y, Takaki K, Miura T, Igarashi T. 2011. Isolation of potent neutralizing monoclonal antibodies from an SIV-infected rhesus macaque by phage display. AIDS Res Hum Retroviruses 27:487–500. doi: 10.1089/AID.2010.0191. [DOI] [PubMed] [Google Scholar]
  • 10.Kuwata T, Takaki K, Yoshimura K, Enomoto I, Wu F, Ourmanov I, Hirsch VM, Yokoyama M, Sato H, Matsushita S. 2013. Conformational epitope consisting of the V3 and V4 loops as a target for potent and broad neutralization of simian immunodeficiency viruses. J Virol 87:5424–5436. doi: 10.1128/JVI.00201-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sundling C, Li Y, Huynh N, Poulsen C, Wilson R, O'Dell S, Feng Y, John R, Mascola JR, Wyatt RT, Karlsson Hedestam GB. 2012. High-resolution definition of vaccine-elicited B cell responses against the HIV primary receptor binding site. Sci Transl Med 4:142ra96. doi: 10.1126/scitranslmed.3003752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, Sodroski J. 2004. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 427:848–853. doi: 10.1038/nature02343. [DOI] [PubMed] [Google Scholar]
  • 13.Nakayama EE, Shioda T. 2015. Impact of TRIM5α in vivo. AIDS 29:1733–1743. doi: 10.1097/QAD.0000000000000812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Newman RM, Hall L, Connole M, Chen GL, Sato S, Yuste E, Diehl W, Hunter E, Kaur A, Miller GM, Johnson WE. 2006. Balancing selection and the evolution of functional polymorphism in Old World monkey TRIM5alpha. Proc Natl Acad Sci U S A 103:19134–19139. doi: 10.1073/pnas.0605838103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wilson SJ, Webb BL, Maplanka C, Newman RM, Verschoor EJ, Heeney JL, Towers GJ. 2008. Rhesus macaque TRIM5 alleles have divergent antiretroviral specificities. J Virol 82:7243–7247. doi: 10.1128/JVI.00307-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wilson SJ, Webb BL, Ylinen LM, Verschoor EJ, Heeney JL, Towers GJ. 2008. Independent evolution of an antiviral TRIMCyp in rhesus macaques. Proc Natl Acad Sci U S A 105:3557–3562. doi: 10.1073/pnas.0709003105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bock HL, Kruppenbacher J, Sanger R, Hobel W, Clemens R, Jilg W. 1996. Immunogenicity of a recombinant hepatitis B vaccine in adults. Arch Intern Med 156:2226–2231. doi: 10.1001/archinte.1996.00440180088011. [DOI] [PubMed] [Google Scholar]
  • 18.McDermott AB, Cohen SB, Zuckerman JN, Madrigal JA. 1998. Hepatitis B third-generation vaccines: improved response and conventional vaccine non-response - evidence for genetic basis in humans. J Viral Hepat 5(Suppl 2):9–11. doi: 10.1046/j.1365-2893.1998.0050s2009.x. [DOI] [PubMed] [Google Scholar]
  • 19.Walker LM, Phogat SK, Chan-Hui PY, Wagner D, Phung P, Goss JL, Wrin T, Simek MD, Fling S, Mitcham JL, Lehrman JK, Priddy FH, Olsen OA, Frey SM, Hammond PW, Kaminsky S, Zamb T, Moyle M, Koff WC, Poignard P, Burton DR, Protocol G Principal Investigators. 2009. Broad and potent neutralizing antibodies from an African donor reveal a new HIV-1 vaccine target. Science 326:285–289. doi: 10.1126/science.1178746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Walker LM, Simek MD, Priddy F, Gach JS, Wagner D, Zwick MB, Phogat SK, Poignard P, Burton DR. 2010. A limited number of antibody specificities mediate broad and potent serum neutralization in selected HIV-1 infected individuals. PLoS Pathog 6:e1001028. doi: 10.1371/journal.ppat.1001028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Doria-Rose NA, Klein RM, Daniels MG, O'Dell S, Nason M, Lapedes A, Bhattacharya T, Migueles SA, Wyatt RT, Korber BT, Mascola JR, Connors M. 2010. Breadth of human immunodeficiency virus-specific neutralizing activity in sera: clustering analysis and association with clinical variables. J Virol 84:1631–1636. doi: 10.1128/JVI.01482-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hraber P, Seaman MS, Bailer RT, Mascola JR, Montefiori DC, Korber BT. 2014. Prevalence of broadly neutralizing antibody responses during chronic HIV-1 infection. AIDS 28:163–169. doi: 10.1097/QAD.0000000000000106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Scheid JF, Mouquet H, Feldhahn N, Seaman MS, Velinzon K, Pietzsch J, Ott RG, Anthony RM, Zebroski H, Hurley A, Phogat A, Chakrabarti B, Li Y, Connors M, Pereyra F, Walker BD, Wardemann H, Ho D, Wyatt RT, Mascola JR, Ravetch JV, Nussenzweig MC. 2009. Broad diversity of neutralizing antibodies isolated from memory B cells in HIV-infected individuals. Nature 458:636–640. doi: 10.1038/nature07930. [DOI] [PubMed] [Google Scholar]
  • 24.Klein F, Diskin R, Scheid JF, Gaebler C, Mouquet H, Georgiev IS, Pancera M, Zhou T, Incesu RB, Fu BZ, Gnanapragasam PN, Oliveira TY, Seaman MS, Kwong PD, Bjorkman PJ, Nussenzweig MC. 2013. Somatic mutations of the immunoglobulin framework are generally required for broad and potent HIV-1 neutralization. Cell 153:126–138. doi: 10.1016/j.cell.2013.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wu X, Zhang Z, Schramm CA, Joyce MG, Kwon YD, Zhou T, Sheng Z, Zhang B, O'Dell S, McKee K, Georgiev IS, Chuang GY, Longo NS, Lynch RM, Saunders KO, Soto C, Srivatsan S, Yang Y, Bailer RT, Louder MK, Mullikin JC, Connors M, Kwong PD, Mascola JR, Shapiro L, NISC Comparative Sequencing Program. 2015. Maturation and diversity of the VRC01-antibody lineage over 15 years of chronic HIV-1 infection. Cell 161:470–485. doi: 10.1016/j.cell.2015.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.McGuire AT, Hoot S, Dreyer AM, Lippy A, Stuart A, Cohen KW, Jardine J, Menis S, Scheid JF, West AP, Schief WR, Stamatatos L. 2013. Engineering HIV envelope protein to activate germline B cell receptors of broadly neutralizing anti-CD4 binding site antibodies. J Exp Med 210:655–663. doi: 10.1084/jem.20122824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jardine JG, Kulp DW, Havenar-Daughton C, Sarkar A, Briney B, Sok D, Sesterhenn F, Ereño-Orbea J, Kalyuzhniy O, Deresa I, Hu X, Spencer S, Jones M, Georgeson E, Adachi Y, Kubitz M, deCamp AC, Julien JP, Wilson IA, Burton DR, Crotty S, Schief WR. 2016. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen. Science 351:1458–1463. doi: 10.1126/science.aad9195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Jardine JG, Ota T, Sok D, Pauthner M, Kulp DW, Kalyuzhniy O, Skog PD, Thinnes TC, Bhullar D, Briney B, Menis S, Jones M, Kubitz M, Spencer S, Adachi Y, Burton DR, Schief WR, Nemazee D. 2015. HIV-1 vaccines. Priming a broadly neutralizing antibody response to HIV-1 using a germline-targeting immunogen. Science 349:156–161. doi: 10.1126/science.aac5894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sok D, Briney B, Jardine JG, Kulp DW, Menis S, Pauthner M, Wood A, Lee EC, Le KM, Jones M, Ramos A, Kalyuzhniy O, Adachi Y, Kubitz M, MacPherson S, Bradley A, Friedrich GA, Schief WR, Burton DR. 2016. Priming HIV-1 broadly neutralizing antibody precursors in human Ig loci transgenic mice. Science 353:1557–1560. doi: 10.1126/science.aah3945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Duan H, Chen X, Boyington JC, Cheng C, Zhang Y, Jafari AJ, Stephens T, Tsybovsky Y, Kalyuzhniy O, Zhao P, Menis S, Nason MC, Normandin E, Mukhamedova M, DeKosky BJ, Wells L, Schief WR, Tian M, Alt FW, Kwong PD, Mascola JR. 2018. Glycan masking focuses immune responses to the HIV-1 CD4-binding site and enhances elicitation of VRC01-class precursor antibodies. Immunity 49:301–311. doi: 10.1016/j.immuni.2018.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Havenar-Daughton C, Sarkar A, Kulp DW, Toy L, Hu X, Deresa I, Kalyuzhniy O, Kaushik K, Upadhyay AA, Menis S, Landais E, Cao L, Diedrich JK, Kumar S, Schiffner T, Reiss SM, Seumois G, Yates JR, Paulson JC, Bosinger SE, Wilson IA, Schief WR, Crotty S. 2018. The human naive B cell repertoire contains distinct subclasses for a germline-targeting HIV-1 vaccine immunogen. Sci Transl Med 10:eaat0381. doi: 10.1126/scitranslmed.aat0381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yacoob C, Pancera M, Vigdorovich V, Oliver BG, Glenn JA, Feng J, Sather DN, McGuire AT, Stamatatos L. 2016. Differences in allelic frequency and CDRH3 region limit the engagement of HIV Env immunogens by putative VRC01 neutralizing antibody precursors. Cell Rep 17:1560–1570. doi: 10.1016/j.celrep.2016.10.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.West AP, Jr, Diskin R, Nussenzweig MC, Bjorkman PJ. 2012. Structural basis for germ-line gene usage of a potent class of antibodies targeting the CD4-binding site of HIV-1 gp120. Proc Natl Acad Sci U S A 109:E2083–E2090. doi: 10.1073/pnas.1208984109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bonsignori M, Zhou T, Sheng Z, Chen L, Gao F, Joyce MG, Ozorowski G, Chuang GY, Schramm CA, Wiehe K, Alam SM, Bradley T, Gladden MA, Hwang KK, Iyengar S, Kumar A, Lu X, Luo K, Mangiapani MC, Parks RJ, Song H, Acharya P, Bailer RT, Cao A, Druz A, Georgiev IS, Kwon YD, Louder MK, Zhang B, Zheng A, Hill BJ, Kong R, Soto C, Mullikin JC, Douek DC, Montefiori DC, Moody MA, Shaw GM, Hahn BH, Kelsoe G, Hraber PT, Korber BT, Boyd SD, Fire AZ, Kepler TB, Shapiro L, Ward AB, Mascola JR, Liao HX, Kwong PD, NISC Comparative Sequencing Program, et al. 2016. Maturation pathway from germline to broad HIV-1 neutralizer of a CD4-mimic antibody. Cell 165:449–463. doi: 10.1016/j.cell.2016.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.LaBranche CC, McGuire AT, Gray MD, Behrens S, Kwong PDK, Chen X, Zhou T, Sattentau QJ, Peacock J, Eaton A, Greene K, Gao H, Tang H, Perez LG, Chen X, Saunders KO, Kwong PD, Mascola JR, Haynes BF, Stamatatos L, Montefiori DC. 2018. HIV-1 envelope glycan modifications that permit neutralization by germline-reverted VRC01-class broadly neutralizing antibodies. PLoS Pathog 14:e1007431. doi: 10.1371/journal.ppat.1007431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Bonsignori M, Liao HX, Gao F, Williams WB, Alam SM, Montefiori DC, Haynes BF. 2017. Antibody-virus co-evolution in HIV infection: paths for HIV vaccine development. Immunol Rev 275:145–160. doi: 10.1111/imr.12509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Bonsignori M, Scott E, Wiehe K, Easterhoff D, Alam SM, Hwang KK, Cooper M, Xia SM, Zhang R, Montefiori DC, Henderson R, Nie X, Kelsoe G, Moody MA, Chen X, Joyce MG, Kwong PD, Connors M, Mascola JR, McGuire AT, Stamatatos L, Medina-Ramírez M, Sanders RW, Saunders KO, Kepler TB, Haynes BF. 2018. Inference of the HIV-1 VRC01 antibody lineage unmutated common ancestor reveals alternative pathways to overcome a key glycan barrier. Immunity 49:1162–1174. doi: 10.1016/j.immuni.2018.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kuwata T, Byrum R, Whitted S, Goeken R, Buckler-White A, Plishka R, Iyengar R, Hirsch VM. 2007. A rapid progressor-specific variant clone of simian immunodeficiency virus replicates efficiently in vivo only in the absence of immune responses. J Virol 81:8891–8904. doi: 10.1128/JVI.00614-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Saito A, Kawamoto Y, Higashino A, Yoshida T, Ikoma T, Suzaki Y, Ami Y, Shioda T, Nakayama EE, Akari H. 2012. Allele frequency of antiretroviral host factor TRIMCyp in wild-caught cynomolgus macaques (Macaca fascicularis). Front Microbiol 3:314. doi: 10.3389/fmicb.2012.00314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hirsch V, Adger-Johnson D, Campbell B, Goldstein S, Brown C, Elkins WR, Montefiori DC. 1997. A molecularly cloned, pathogenic, neutralization-resistant simian immunodeficiency virus, SIVsmE543-3. J Virol 71:1608–1620. doi: 10.1128/JVI.71.2.1608-1620.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Mori K, Ringler DJ, Kodama T, Desrosiers RC. 1992. Complex determinants of macrophage tropism in env of simian immunodeficiency virus. J Virol 66:2067–2075. doi: 10.1128/JVI.66.4.2067-2075.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Regier DA, Desrosiers RC. 1990. The complete nucleotide sequence of a pathogenic molecular clone of simian immunodeficiency virus. AIDS Res Hum Retroviruses 6:1221–1231. doi: 10.1089/aid.1990.6.1221. [DOI] [PubMed] [Google Scholar]
  • 43.Wu F, Ourmanov I, Kuwata T, Goeken R, Brown CR, Buckler-White A, Iyengar R, Plishka R, Aoki ST, Hirsch VM. 2012. Sequential evolution and escape from neutralization of simian immunodeficiency virus SIVsmE660 clones in rhesus macaques. J Virol 86:8835–8847. doi: 10.1128/JVI.00923-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Barbas CF, Scott JM, Silverman G, Burton DR. 2001. Phage display: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 45.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, Walters WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. 2010. QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336. doi: 10.1038/nmeth.f.303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rognes T, Flouri T, Nichols B, Quince C, Mahé F. 2016. VSEARCH: a versatile open source tool for metagenomics. Peer J 4:e2584. doi: 10.7717/peerj.2584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Rice P, Longden I, Bleasby A. 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16:276–277. doi: 10.1016/S0168-9525(00)02024-2. [DOI] [PubMed] [Google Scholar]
  • 48.Katoh K, Kuma K, Toh H, Miyata T. 2005. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33:511–518. doi: 10.1093/nar/gki198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Suyama M, Torrents D, Bork P. 2006. PAL2NAL: robust conversion of protein sequence alignments into the corresponding codon alignments. Nucleic Acids Res 34:W609–W612. doi: 10.1093/nar/gkl315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Price MN, Dehal PS, Arkin AP. 2010. FastTree 2—approximately maximum-likelihood trees for large alignments. PLoS One 5:e9490. doi: 10.1371/journal.pone.0009490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Letunic I, Bork P. 2019. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res 47:W256–W259. doi: 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ye J, Ma N, Madden TL, Ostell JM. 2013. IgBLAST: an immunoglobulin variable domain sequence analysis tool. Nucleic Acids Res 41:W34–W40. doi: 10.1093/nar/gkt382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lefranc MP, Giudicelli V, Ginestoux C, Jabado-Michaloud J, Folch G, Bellahcene F, Wu Y, Gemrot E, Brochet X, Lane J, Regnier L, Ehrenmann F, Lefranc G, Duroux P. 2009. IMGT, the international ImMunoGeneTics information system. Nucleic Acids Res 37:D1006–D1012. doi: 10.1093/nar/gkn838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Moriya C, Igarashi H, Takeda A, Tsukamoto T, Kawada M, Yamamoto H, Inoue M, Iida A, Shu T, Hasegawa M, Nagai Y, Matano T. 2008. Abrogation of AIDS vaccine-induced cytotoxic T-lymphocyte efficacy in vivo due to a change in viral epitope flanking sequences. Microbes Infect 10:285–292. doi: 10.1016/j.micinf.2007.12.002. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The short-read sequences obtained by NGS were deposited in the DNA Data Bank of Japan (BioProject accession no. PRJDB8484, BioSample accession no. SAMD00176318 to SAMD00176353, and DDBJ Sequence Read Archive [DRA] accession no. DRA008635). Sequence data from Ig clones are available under GenBank accession no. MN109605 to MN109944. Sequence data for VH3.33 alleles are available under GenBank accession no. MN109945 to MN109950.

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES