Evidence of viral genome linked protein of banana bract mosaic virus interaction with translational eukaryotic initiation factor 4E of plantain cv. Nendran based on yeast two hybrid system study

Abstract

Banana bract mosaic virus (BBrMV), belongs to the genus Potyvirus and it is an important viral pathogen of bananas and plantains. The eukaryotic translation initiation factor, eIF4E, and its isoform play key roles during the virus infection in plants, particularly Potyvirus. The present study was undertaken to determine the role of BBrMV-viral protein genome-linked (VPg) in virus infectivity by analyzing the interaction with the eukaryotic translation initiation factor eIF4E through yeast two-hybrid system. The results suggest that plantain cv. Nendran eIF4E plays an essential role in the initiation of the translation of capped mRNAs and its association with VPg would point to a role of the viral protein in the translation of the virus and may potentially contribute to BBrMV resistance.

Electronic supplementary material

The online version of this article (10.1007/s13337-021-00672-9) contains supplementary material, which is available to authorized users.

Introduction

Potyvirus is the second largest genus of plant viruses, causes severe economic losses in agriculture [1]. Banana bract mosaic caused by Banana bract mosaic virus (BBrMV) is a member of Potyvirus (family Potyviridae), one of the most important viral diseases, which causes serious yield losses in banana and plantain in India and the Philippines [2, 3]. Banana bract mosaic disease (BBrMD) has been recorded in Kerala, Tamil Nadu, Karnataka and Andhra Pradesh and recognized as a disease of national importance in India. Yield loss in Kerala and Tamil Nadu states of India due to BBrMD was estimated to range from 30 to 70% in cultivars Nendran and Robusta, respectively [2].

The genome of BBrMV is 9711 bp in size and has a single open reading frame (ORF) that is flanked by two untranslated regions (UTRs). The 5′ UTR includes an internal ribosome entry site. The ORF is translated as a large polyprotein that is subsequently cleaved into 10 smaller functional peptides (P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa, NIb, and CP) by viral-encoded proteases [2]. Most of the potyviral proteins are shown to have multiple functions, and the VPg is one of the most versatile of them. Potyviral VPg plays a crucial role in virus replication (translation and RNA synthesis), as well as in cell-to-cell and long-distance movement. It also interacts with host proteins as well as various recessive potyvirus resistance genes in different host species [4, 5].

Generally, potyviruses are able to encode a limited number of proteins, and therefore they recruit many different host components to perform their infectious cycle. One of the most extensively described host–potyvirus interactions involves the eukaryotic translation initiation factor 4E (eIF4E) or its isoform and the potyviral VPg. For several potyviruses, this interaction has been shown to be absolutely required for virus infection, so that alleles of eIF4E which is unable to interact with the VPg of an infecting virus behave as recessive resistance gene [6, 7]. So far, eIF4E and/or its isoform eIF4E-Iso recessive resistance genes are identified in many crop species, including pepper, tomato, pea, lettuce, melon and barley [8]. This suggests that these translation initiation factors are required for virus infection and resistance function, opening the ways for studying and creation of new durable resistances [9]. Furthermore, it was shown that mutations in the VPg of eIF4E-mediated resistance-breaking potyviruses restore binding with the product of resistance alleles, suggesting that eIF4E and VPg are involved in a co-evolutionary arms race between host plant and virus [10]. The eIF4E–VPg interaction has been characterized in detail through in vivo and in vitro experiments, even if its exact biological function still remains unclear.

Hence, in this present study, the possible binding of BBrMV-VPg to its host eIF4E/eIF4E-Iso cellular partner was investigated by Yeast two hybrid assay, as most comprehensively studied recessive genes used to breed resistance to potyviruses in crop plants encode variants of eukaryotic translation initiation factor 4E (eIF4E) or eIF4E-Iso [1, 8, 11, 12]. This is the first report on interaction between eIF4E and BBrMV-VPg and this study may provide a foundation for the screening and cloning of eIF4E resistance loci, as well as systematic research into the resistance mechanisms of eIF4E to BBrMV in banana.

Materials and methods

Plant material and virus isolates

BBrMV was maintained in susceptible Nendran cultivar in the glass house of ICAR-National Research Centre for Banana (ICAR-NRCB), Tiruchirappalli, Tamil Nadu. Banana leaves or bracts showing symptoms of bract mosaic disease were collected and processed immediately or stored at − 80 °C freezer.

Bacterial and yeast strains and growth conditions

Escherichia coli DH5α [SupE 44 liiacU169(<P80iacZtiM15) hsdR17 recAl endAl gyrA96 thi-l reiAl] was the transformation recipient for all the plasmids. Yeast strain EGY48 (MATa trpl his3 ura3 ieu2::6LexAop-LEU2) was used for all yeast transformation and was grown at 30 °C in either Yeast Extract–Peptone–Dextrose (YPD) or Synthetic Dropout (SD) medium.

Cloning and sequencing of BBrMV-VPg, eIF4E and its isoform eIF(iso)4E

Total RNA was extracted from 100 mg of leaf using the RNeasy Plant Mini Kit according to the manufacturer’s instructions (QIAGEN, USA), and the RNA was reverse transcribed with RevertAid™ H Minus first strand cDNA synthesis kit (MBI Fermentas, USA) by using oligo (dT) primer by following the manufacturer’s protocol. VPg primers were commercially synthesized: primers were designed based on the sequence of BBrMV-Try isolate (accession no. HM131454) (Table 1). Complementary DNA was subjected to PCR amplification using gene specific primers to amplify 570 bp of VPg gene. The thermo-cycling conditions were as follows: 5 min at 95 °C (1 cycle), 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min (35 cycles), and a final extension at 72 °C for 10 min.

Table 1.

List of primers used for the amplification of eIF4E, eIF4E-Iso from plantain cv. Nendran and BBrMV-VPg

S. nos.	Name	Sequence	Amplicon size (bp)
1.	eIF4E-1-F	5′GGAATTCATGGCAGAGGAAGCGGGGATG3’	690
	eIF4E-1-R	5′CCCTCGAGTCACACTGTATACCGATTCTTAG3’
2.	eIF4E-2-F	5′GGAATTCATGGAGTCCGCCGAGGAAGCG3’	681
	eIF4E-2-R	5′CCCTCGAGCTATCCTCTTAACCAAGTG3’
3.	eIF4E-3-F	5′GGAATTCATGGCGGTCGAGAACGGCG3’	741
	eIF4E-3-R	5′CCCTCGAGTCATACTTGATATGTACTCTTGGC3’
4.	eIF4E-4-F	5′GGAATTCATGCGACCGACTCCGAACC3’	630
	eIF4E-4-R	5′CCCTCGAGTCAAACACTGTATCGACCAC3’
5.	eIF4E-5-F	5′GGAATTCATGGAGGCCGCGGAGGAAGC3’	681
	eIF4E-5-R	5′CCCTCGAGCTATCCTCTCAACCAAGTG3’
6.	eIF4E-Iso-F	5′GGAATTCATGGCGGAAACGGCAGCTAG3’	579
	eIF4E-Iso-R	5′CCCTCGAGCTATATCGAGTATCGACCACCTCTG3’
7.	VPg-F	5′GGAAAGCGAAAAT TTCAA AAAC3’	570
	VPg-R	5′CTCAAACTCAACTGGCGTC3’

Sequences representing the complete eIF4E and eIF4E-Iso genes from banana were acquired from the banana genome hub (https://banana-genome-hub.southgreen.fr/). Primers were designed using the sequence information from the reference sequence from banana genome for the amplification of all the eIF4E alleles and its isoform from cv. Nendran (Table 1). PCR amplification was carried out using respective gene specific primers to amplify eIF4E and eIF4E-Iso genes. The thermo-cycling conditions were as follows: 5 min at 95 °C (1 cycle), 94 °C for 1 min, 58 °C (eIF4E)/55 °C (eIF4E-Iso) for 1 min, and 72 °C for 1 min (35 cycles), and a final extension at 72 °C for 10 min.

The amplified VPg, eIF4E and eIF4E-Iso genes were resolved in 1.5% agarose gel electrophoresis, and the fragments were eluted using GenElute Gel Extraction Kit (Sigma, USA), ligated into pTZ57R/T vector (MBI Fermentas, USA), and transformed into competent E. coli DH5α cells as per manufacturer’s instructions. Plasmid DNA was purified using GenElute Plasmid Miniprep Kit (Sigma-Aldrich, USA) following manufacturer’s instructions and the presence of VPg, eIF4E and eIF4E-Iso genes were confirmed by digestion with restriction enzymes EcoRI and Hind III. Two independent clones per gene were sequenced in both directions in an automatic sequencer (Eurofins Genomic India Pvt Ltd., Bangalore). The complete VPg, eIF4E (1–5) and eIF4E-iso gene sequences generated in this study were deposited in NCBI GenBank (Accession No. VPg—HM131454, eIF4E (1–5)—MK270535, MK270534, KY753429, MK270533, MK270532, eIF4E-iso—KT852551).

Yeast two hybrid assay

eIF4E, eIF4E-Iso from cv Nendran and BBrMV-VPg genes cloned in pTZ57T/Z was further sub-cloned at EcoRI and Xhol sites of the bait plasmid pEG202 and prey plasmid pJG4-5. After cloning the insert in both bait and prey plasmids, the constructs were sequenced to ensure the absence of PCR-induced mutations and to confirm the cloned genes are in frame to LexA and B42 domain, respectively. The yeast two hybrid procedures were conducted as described earlier [13]. Both the plasmids were subjected to the recommended control tests before proceeding further. These include: (I) the auto-activation test, which was done by using EGY48 containing pPrey and pSH174; and (2) the repression assay, which was carried out by using EGY48 containing pPrey and pRFHM1. The Y2H screening was performed by co-transforming with pEG202:eIF4E and pJG4-5:VPg into the yeast strain EGY48 containing pSH18-34.

Transformants were selected on Synthetic Dropout (SD) + Leu-His-Ura-Trp plates. The colonies thus obtained were again patched on SD + Leu-His-Ura-Trp plates. The positive transformants were confirmed by colony PCR for the presence of both the genes. These positive transformants were further subjected to reporter gene activation for both LEU2 and lacZ. For leucine prototrophy assay, dilutions of induced colonies were spotted on SD/Gal/Raff induction medium—Leu-His-Ura-Trp to identify the bait prey interaction. Reporter assay for lacZ was performed with SD/Gal/Raff + LEU + X-Gal-His-Ura-Trp containing plates [13].

Bioinformatics analysis

eIF4E sequences were aligned using the CLUSTALW program in BioEdit sequence alignment editor version 7.0.3.1 [14]. The pairwise nucleotide (nt) and aminoacid (aa) sequence identity scores were represented as color-coded blocks using SDT v.1 software [15]. The domains and motif identification for these genes were detected using CDD (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and MEME (http://meme-suite.org/tools/meme). The Swiss Model Workspace, an automated protein-modeling server (http://swissmodel.expasy.org/), was used to generate predicted three dimensional protein structures. The three-dimensional structure of wheat eIF4E (Protein Data Bank accession no. 2IDR, Chain A) was used as a template. Models were evaluated by means of the Model Assessment package provided by SWISS-MODEL [16–18]. The functional protein association networks were predicted with STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) https://string-db.org/.

Results and discussion

Virus being an obligatory parasite, encode relatively few proteins and recruit many different host components to perform their infectious cycle, even a single host factor absence or insufficiency may affect the completion of life cycle [19, 20] and further the resistance genes would correspond to mutation or loss of host components required for a step of the virus life cycle [21]. The cap-binding protein eIF4E/eIF4E-Iso confers resistance to some RNA viruses in specific plant species [22–25]. This eIF4E gene has been widely studied owing to the pivotal role in regulation of translation initiation in several eukaryotes including humans, Drosophila, yeast and plants [26, 27] and a high degree of aa sequence conservation has been shown [27].

Sequence and motif analysis of eIF4E

VPg gene of BBrMV-TRY isolate was amplified, cloned and sequenced. It was found to be 570nt coding for 190 amino acids (aa) and having a deduced MW of 21.54 kDa, and pI of 9.03 [28]. All five eif4e genes (eif4e1- eif4e5) from different loci of plantain cv. Nendran were amplified, cloned, sequenced and the sequence length was found to be 690, 681, 741, 630, 681nt coding for 229, 226, 246, 209, 226 amino acids, respectively. Comparative sequence analysis of the eif4e genes of cv. Nendran and other crops revealed that 41-92% and 25-91% identity at nt and aa level, respectively. All the five eif4e genes from cv. Nendran were compared with eif4e gene from potyvirus-resistant genotypes of pepper (pvr2-Capsicum spp.) [29], tomato (pot1-Lycopersicon spp.) [30], lettuce (mo1-Lactuca spp.) [31] and pea (sbm1-Pisum sativum) [32]. Sequence analysis revealed that eif4e-1 from cv. Nendran to have high similarity of 60, 62, 62, 60% at nucleotide and 61, 64, 62, 60% at amino acid level, respectively followed by eif4e-3 with 52, 53, 55, 53% at nucleotide and 53, 54, 54, 53% at amino acid level, respectively with that of the resistant genes ie., pvr2, pot1, mo1, sbm1 (Fig. S1a and S1b). In case of plantain cv. Nendran, maximum similarity of 92 and 91 per cent was observed between eif4e-2 and eif4e-5 both at nt and aa level, respectively. However, eif4e-1 had maximum similarity with other R genes reported. Among the R genes, pepper eif4e shares the highest percent of identity at nt level (90%) with tomato eif4e, since both belongs to Solanaceae family. eIF4E and eIF4E-Iso are member of same IEF subfamily, share a higher level of sequence identity. In banana, eif4e-4 and eif4e-iso which are localized on chromosome 5 showed 94% identity at nt level, respectively, suggesting that they could have resulted from a recent duplication event [33]. Further, motif analysis also revealed that eIF4E-1 harbors all the ten motifs similar to the reported resistant genes (Fig. 1a, b). Based on this analysis eif4e-1 from cv. Nendran was selected for studying the protein-protein interaction with BBrMV-VPg in yeast two hybrid system. Similarly, eif4e-iso gene was amplified, cloned and sequenced. It was found to be 579nt coding for 193 amino acids (aa) and having a deduced MW of 21.93 kDa and pI of 6.12. Comparative sequence analysis of the eif4-iso with eif4e genes showed 36–75 and 25–100% similarity at nt and aa level, respectively.

Fig. 1.

Conserved motifs identified from the amino acid sequences of eIF4E from plantain cv. Nendran and other potyvirus resistant genotypes. a Distribution of conserved motifs in eIF4E proteins. The name of each protein and combined 'P' value are shown on the left side of the figure. Different motifs are indicated with different color boxes. b Amino acid sequence of conserved motifs and their logos where size of residue is proportional to the conservation of the residue

Interaction of eIF4E and BBrMV-VPg

Yeast two-hybrid analysis was used to determine the interaction between viral and banana proteins. eif4e and eif4e-iso cloned in the bait plasmid and VPg gene in prey plasmid did not auto-activate the LEU2 and LacZ reporter genes and therefore used for analysis of the potential protein–protein interactions. Yeast strain EGY48, containing plasmids pSH18–34, was co-transformed with the pEG202:eif4e, pJG4-5:VPg and pEG202:eif4e-iso, pJG4-5:VPg, approximately 65 and 80 transformed colonies were obtained on selection medium lacking histidine, uracil and tryptophan, respectively. The transformants were subsequently patched on SD+Leu-His-Ura-Trp for screening (Fig. 2a, b). 10 μl of induced colonies were spotted on SD induction medium+Leu-His-Ura-Trp+X-Gal to examine the lacZ expression (Fig. 2c). Transformants that displayed a blue color after 48 hr growth on X-Gal plate proved the interaction of bait and prey. Blue color was observed only in colonies harbouring eif4e and VPg gene and no blue colonies were observed in eif4e-iso and VPg. Similarly, various dilutions of induced colonies were spotted on SD induction medium –Leu-His-Ura-Trp to examine the LEU2 expression (Fig. 2d). Colony growth upto the dilution 10^-3 confirmed the bait prey interaction via LEU2 expression. Leucine prototrophy assay showed interactions between BBrMV-VPg and eIF4E (Fig. 2d) but not with eIF4E-Iso. The interaction between translation initiation factors and viral proteins is essential for viral replication and infection [8, 34, 35]. Yeast two hybrid analysis revealed the interaction between eIF4E and VPg protein, and this interaction may be necessary for BBrMV to initiate infection and replicate in banana. Similar results have been reported in various studies in yeast two-hybrid and in vitro binding assays [1, 8, 12]. These findings strongly suggest that eIF4E of cv. Nendran play an important role to facilitate virus infection and the virus selectively recruit one of the initiation factors 4E [22, 36, 37]. Further, this eIF4E is not functionally interchangeable with eIF4E-Iso as there is no interaction between VPg with both eIF(iso)4E, eIF4E or eIF4E-Iso alone [37].

Fig. 2.

Yeast two hybrid assay of plantain cv. Nendran eIF4E with BBrMV-VPg

Conserved domain analysis revealed the presence of IF4E domain. Based on conserved domain and motif studies, the central region of eIF4E was found to be highly conserved which is directly involved in cap binding process, whereas the N terminus varies in length, shows little or no conservation and is not required for cap-dependent translation in-vitro. The amino acids W⁶⁶, W⁶⁹, W⁸², W⁹⁹, W¹²⁸, R¹⁷⁸, W¹⁸⁷ are involved in cap recognition and any change in these amino acids may affect the recognition of cap structure. F⁶⁸, R⁸⁷, Y/H¹¹⁸ and A¹⁷³ are mapped on the outer surface of eIF4E and these residues are involved in interaction with VPg (Fig. 3) [38]. Further, conserved motif analysis revealed that the amino acid W⁹⁹ is involved in interaction with eIF4G and any change in this will prevent the interaction which may lead to dramatic reduction in the binding of eIF4E to the mRNA 5′-cap structure [39, 40]. The conservation of the central part of the protein strengthens the fact that the core domain of the eIF4E protein is under strong conservative pressure as well as some of the aa are involved in key functions [33]. These interactions were further proved in our protein-protein network analysis as well. The protein–protein interaction networks are important for system-level understanding and such predicted networks can provide novel targets for efficient interaction mapping. Therefore, the protein-protein interactions for eIF4E protein were predicted with STRING, which showed strong interactions with nuclear cap-binding protein subunit 1, eIFiso-4F subunit and eIF4G with 11 nodes and 19 edges (Fig. S2).

Fig. 3.

Multiple sequence alignment of eIF4E from plantain cv. Nendran and other potyvirus resistant genotypes. Conserved aa involved in cap recognition are marked by blue asterisks and amino acids mapped on the outer surface of eIF4E are marked by pink asterisks (Color figure online)

Homology modeling and structural analysis of eIF4E

A computational approach following homology modeling protocol has been used to predict the 3D structure of plantain cv. Nendran eIF4E protein using wheat eIF4E protein (2IDV.1) as template [26] (Fig. S3a). The structure had a QMEAN value of -0.89 which indicated good agreement between the model and experimental structure, and this will help in relating the structure with biological functions. To verify further the predicted structure, a Ramachandran plot was computed which showed that 97.69% residues are in the most favored regions, 0.0% in the Ramachandran outliers (Fig. S3b). 3D structure of cv. Nendran eIF4E was super imposed upon the structure of potyvirus-resistant genotype of tomato (pot1) which had maximum sequence similarity. The yellow circle indicates the region of the eIF4E protein where clustering of non-conservative amino acid substitutions between susceptible (Nendran) and resistant (tomato) is observed (Fig. S3c) and these substitutions are clustered near the cap binding pocket at the surface of the protein [8, 30–32].

The present study concludes that plantain cv. Nendran eIF4E is interacting with the BBrMV–VPg and further knock out studies has to be carried out to confirm and validate the resistance mechanism in banana. Till date, resistant source has not been identified in banana against BBrMV, so this study will also help in identification of natural eIF4E resistant alleles that may be present in Musa spp. which can be introgressed into susceptible banana cultivars. Owing to parthenocarpy and female sterility, introgression of these alleles into commercial cultivars of banana is limited which can be overcome by generating virus resistant plants by novel mutation at the eIF4E locus in banana using CRISPR/Cas9 based gene editing technology.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Declarations

Conflict of interest

The authors declare that there are no conflicts of interest.

Ethical statement

This work does not contain any studies with human participants or animals performed by any of the authors.