Receptor recognition and binding by bacteriophage are the first step for its infection of bacterial cells. In this study, we found the Vibrio cholerae subtyping phage VP1 uses a polyQ protein named VcpQ (V. cholerae polyQ protein) as the receptor for VP1 infection.
KEYWORDS: Vibrio cholerae, bacteriophage, receptor, polyQ protein, phage typing
ABSTRACT
Bacteriophage VP1 is a typing phage used for the phage subtyping of Vibrio cholerae O1 biotype El Tor, but the molecular mechanisms of its receptor recognition and the resistance of its host to infection are mostly unknown. In this study, we aimed to identify the host receptor and its role in resistance in natural VP1-resistant strains. Generating spontaneous resistance mutations and genome sequencing mutant strains found the polyQ protein VcpQ, which carries 46 glutamine residues in its Q-rich region, to be responsible for infection by VP1. VcpQ is a membrane protein and possibly forms homotrimers. VP1 adsorbed to V. cholerae through VcpQ. Sequence comparisons showed that 72% of natural VP1-resistant strains have fewer glutamines in the VcpQ Q-rich stretch than VP1-sensitive strains. This difference did not affect the membrane location and oligomer of VcpQ but abrogated VP1 adsorption. These mutant VcpQs did not recover VP1 infection sensitivity in a V. cholerae strain with vcpQ deleted. Our study revealed that the polyQ protein VcpQ is responsible for the binding of VP1 during its infection of V. cholerae and that glutamine residue reduction in VcpQ affects VP1 adsorption to likely be the main cause of VP1 resistance in natural resistant strains. The physiological functions of this polyQ protein in bacteria need further clarification; however, mutations in the polyQ stretch may endow V. cholerae with phage resistance and enhance survival against VP1 or related phages.
IMPORTANCE Receptor recognition and binding by bacteriophage are the first step for its infection of bacterial cells. In this study, we found the Vibrio cholerae subtyping phage VP1 uses a polyQ protein named VcpQ (V. cholerae polyQ protein) as the receptor for VP1 infection. Our study reveals the receptor’s recognition of phage VP1 during its adsorption and the VP1 resistance mechanism of the wild resistant V. cholerae strains bearing the mutagenesis in the receptor VcpQ. These mutations may confer the survival advantage on these resistant strains in the environment containing VP1 or its similar phages.
INTRODUCTION
Toxigenic Vibrio cholerae is the cause of fatal cholera, a diarrheal disease, in humans who ingest contaminated food or water. In the last decade, millions of cholera cases and almost 100,000 deaths per year have been reported from outbreaks in Haiti, Yemen, and other locales without adequate water sanitation and infrastructure (1, 2). Phage-bacterium interactions affect the diversity of the microbiome in the environment/host (3, 4), epidemic clone alteration, and even epidemics caused by pathogens, such as phage predation of V. cholerae, which may act as a factor that influences seasonal epidemics of cholera and emergence of new clones (5). Susceptibility to phages is also used in the subtyping of bacteria. Before the advent of molecular typing techniques, phage typing was used for decades to determine the microbiological and pathogenic characteristics of V. cholerae and to trace epidemiological relations among the isolates (6, 7).
During the evolutionary arms race between bacteria and phage, bacteria have produced defense mechanisms to inhibit every stage of the phage life cycle (8). Some host bacteria have evolved an impressive arsenal of antiphage systems involved in different steps of phage infection, including adsorption resistance (9), phage DNA injection prevention (10, 11), CRISPR-Cas (12), restriction modification (13, 14), abortive infection (15), and toxin-antitoxin systems (16). Preventing adsorption is a common antiphage mechanism, and bacteria can prevent adsorption by making mature biofilm structures (17), secreting outer membrane vesicles (OMVs) (18), hiding or masking surfaces (19, 20), and introducing mutations within receptor gene receptors (21). Surface components, such as lipopolysaccharides (LPS) (22, 23), outer membrane proteins (OMPs) (9, 24, 25), and flagella (26), are receptors for phages. Some phages also use two components on the host envelope as receptors (9, 27, 28).
A phage biotyping scheme was developed, and it has been efficiently used to characterize the El Tor biotype of V. cholerae O1 in epidemiological investigations in China since the 1970s (29, 30). Five lytic phages (VP1 to VP5) are used in the phage typing in this scheme. Identifying phage receptors and surveying the mutations of receptor genes may elucidate phage infection and the emergence of new phage-resistant clones. In this study, we identified a polyQ protein as the receptor for VP1 infection. We named this polyQ protein VcpQ (V. cholerae polyQ protein). The polyQ tracts in these proteins are a normal feature of many human proteins (31) and are encoded by genes encoding a stretch of consecutive glutamine (Q) residues. These proteins may have normal functions in the activation of gene transcription and nuclear localization (32–34), while abnormal expansion of the polyQ tract in some proteins exceeding a certain threshold leads to neurodegenerative disease (35). PolyQ proteins are rarely found from prokaryotic organisms, and their function remains poorly understood (36). Our data showed that VcpQ is located on the membrane and that the depletion of glutamine residues in the polyQ region contributes to resistance in natural VP1-resistant strains of V. cholerae, which exhibit receptor mutations to escape phage capture.
RESULTS
A polyQ protein of V. cholerae was required for phage VP1 infection.
We performed genome sequencing of spontaneous phage-resistant strains to identify the mutant genes responsible for phage resistance. To isolate the spontaneous VP1-resistant mutants, the VP1-sensitive El Tor strain ICDC-VC5724 and VP1 phage were mixed and cultured with double-layer agar. Four resistant strains, designed R-Vc1, R-Vc3, R-Vc5, and R-Vc8, were selected from four independent experiments. Their resistance was further confirmed by double-layer plaque assays (Fig. 1A). The genomes of these four mutants and the wild-type (WT) strain ICDC-VC5724 were sequenced, compared, and confirmed by PCR to detect the mutation sites. Four amino acid alterations, one encoded in each of four genes (VC0723A155S, VCA0095D120G, VCA0171S258R, and VCA1056Q523H), were found distributed among strains R-Vc3, R-Vc5, and R-Vc8. In addition, one common mutation, a deletion of 14 glutamine (Q) residues in the hypothetical protein encoded by VCA0171, was found in all four mutants (Table 1 and Fig. 1B). The 14Q deletion in VCA0171 was the only mutation of these found in the spontaneous mutant strain R-Vc1 (Table 1), suggesting that the polyQ deletion in VCA0171 may result in VP1 resistance. A sequence comparison showed that the predicted protein encoded by VCA0171 belongs to the polyglutamine (polyQ) protein family, which is known to be involved in Huntington’s disease in humans (35) and is rare in prokaryotes (36). No polyQ protein has been reported previously in V. cholerae. We designated the protein encoded by VCA0171 VcpQ (V. cholerae polyQ protein). The gene VCA0171 was named vcpQ, and the spontaneous mutant strain R-Vc1, with only the 14Q deletion in VcpQ, was named Vc(VcpQΔ14Q).
FIG 1.
The polyQ region sequence of VcpQ (VCA0171) and the VP1 sensitivity of VcpQ mutant strains. (A) Detection of VP1 infection in V. cholerae mutants by double-layer plaque assay. The wild-type strain ICDC-VC5724 (WT, sensitive to VP1) was used as the sensitive control (plaque formation). (B) The polyQ region of VcpQ from a VP1-sensitive strain (WT). The amino acids with the black horizontal line above them are the Q-rich region present in all sensitive strains. (C) Detection of VP1 infection in V. cholerae VcpQ mutants by double-layer plaque assay. The wild-type strain ICDC-VC5724 (WT, sensitive to VP1) was used as the sensitive control (plaque formation). VcpQΔ14Q, 14Q deletion mutant strain Vc(VcpQΔ14Q), showing VP3 resistance; ΔVcpQ, full vcpQ deletion strain Vc(ΔVcpQ); ΔVcpQ-C, Vc(ΔVcpQ)-C, carrying vcpQ expression plasmid.
TABLE 1.
Amino acid residue alterations of four VP1-resistant mutants compared to the wild-type strain ICDC-VC5724
| Gene | Function | VP1-resistant strains |
|||
|---|---|---|---|---|---|
| R-Vc1 | R-Vc3 | R-Vc5 | R-Vc8 | ||
| VCA1056 | Methyl-accepting chemotaxis protein | —a | — | — | Q523H |
| VCA0095 | Hypothetical protein | — | — | D120G | — |
| VC0723 | Polyphosphate kinase | — | A155S | — | — |
| VCA0171 | Hypothetical protein encoded by VCA0171 | Δ14Qb | Δ14Q | Δ14Q/S258R | Δ14Q |
—, the protein sequence in the resistant strain has 100% identity with that of the wild-type strain.
Δ14Q, 14-glutamine deletion in predicted protein encoded by VCA0171.
To confirm the possible correlations of these spontaneously mutated genes with VP1 resistance, a single-amino-acid-substitution variant of each gene, designed according to the observed spontaneous substitution mutation in these four genes (Table 1), was constructed (see Table 3) using gene recombination and tested for sensitivity to VP1. No resistant phenotype was observed for these amino acid substitution mutants (Table 2). Furthermore, four in-frame deletion mutants of each gene (VCA1056, VCA0095, VC0723, and vcpQ, Table 3) were constructed using the method of suicide plasmid-mediated gene recombination and examined for VP1 sensitivity using double-layer plaque assays. Only the vcpQ deletion mutant [Vc(ΔVcpQ)] and the vcpQ strain with the 14Q residue deletion, Vc(VcpQΔ14Q), showed resistance to VP1 infection (Table 2). When the plasmid pSRKtc-VcpQ, carrying the intact vcpQ gene, was added into Vc(ΔVcpQ), the resulting complementary strain, Vc(ΔVcpQ)-C, reacquired VP1 sensitivity (Fig. 1C). All the above experiments showed that only deletion of the 14Q residues in vcpQ or full gene deletion resulted in VP1 resistance.
TABLE 2.
Sensitivity of strains to VP1 as detected by double-layer plaque assay
| Strain | Plaque formationa |
|---|---|
| ΔVCA1056 | S |
| ΔVCA0095 | S |
| ΔVCA0723 | S |
| ΔVcpQ | R |
| Wild type | S |
| VCA1056Q523H | S |
| VCA0095D120G | S |
| VC0723A155S | S |
| VcpQS258R | S |
| VcpQΔ14Q | R |
R, strain with no plaque formation, confirmed as VP1-resistant phenotype; S, strain with plaque formation, confirmed as VP1-sensitive phenotype.
TABLE 3.
Strains used in this study
| Strain | Relevant genotype | Reference/resource |
|---|---|---|
| E. coli | ||
| DH5α λpir | supE44 ΔlacU169 (ΦlacZΔM15) recA1 endA1 hsdR17 thi-1 gyrA96 relA1 λpir | Lab collection |
| SM10 λpir | Kmr thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu λpir | Lab collection |
| V. cholerae | ||
| ICDC-VC5724 | Wild-type El Tor VC5724, Smr, VP1 sensitive, abbreviated as Vc | Lab collection |
| ICDC-VC2572 | El Tor VC2572, VP1 resistant | Lab collection |
| ICDC-VC2950 | El Tor VC2950, VP1 resistant | Lab collection |
| ICDC-VC2874 | El Tor VC2874, VP1 resistant | Lab collection |
| ICDC-VC25 | El Tor VC25, VP1 resistant | Lab collection |
| Vc(ΔVcpQ) | vcpQ/VCA0171 deletion of VC5724 (Smr) | This study |
| Vc(ΔVCA1056) | VC5724 (Smr) strain with VCA1056 deletion | This study |
| Vc(ΔVCA0095) | VC5724 (Smr) strain with VCA0095 deletion | This study |
| Vc(ΔVC0723) | VC5724 (Smr) strain with VCA0723 deletion | This study |
| Vc(VCA0095D120G) | VC5724 (Smr) strain with the single amino acid change D120G in VCA0095 | This study |
| Vc(VC0723A155S) | VC5724 (Smr) strain with the single amino acid change A155S in VC0723 | This study |
| Vc(VcpQS258R) | VC5724 (Smr) strain with the single amino acid change S258R in VcpQ | This study |
| Vc(VCA1056Q523H) | VC5724 (Smr) strains with the single amino acid change Q523H in VCA1056 | This study |
| Vc(ΔVcpQ)-C | Vc(ΔVcpQ) (Smr) strain complemented with pSRKtc-vcpQ | This study |
| Vc(VcpQΔ14Q) | R-Vc1, VC5724 (Smr) strain with 14 consecutive glutamines (Gln, Q) deleted from VcpQ | This study |
| Vc(44Q) | Vc(ΔVcpQ) (Smr) strain complemented with pSRKtc-VcpQ (44Q) | This study |
| Vc(42Q) | Vc(ΔVcpQ) (Smr) strain complemented with pSRKtc-VcpQ (42Q) | This study |
| Vc(28Q) | Vc(ΔVcpQ) (Smr) strain complemented with pSRKtc-VcpQ (28Q) | This study |
| Vc(14Q) | Vc(ΔVcpQ) (Smr) strain complemented with pSRKtc-VcpQ (14Q) | This study |
| VC2950-Δ | El Tor VC2950 with polyQ region deletion | This study |
| VC25-Δ | El Tor VC25 with polyQ region deletion | This study |
| VC2874-Δ | El Tor VC2874 with polyQ region deletion | This study |
| VC2572-Δ | El Tor VC2572 with polyQ region deletion | This study |
| VC2950-46 | El Tor VC2950 with 46Q polyQ region | This study |
| VC25-46 | El Tor VC25 with 46Q polyQ region | This study |
| VC2874-46 | El Tor VC2874 with 46Q polyQ region | This study |
| VC2572-46 | El Tor VC2572 with 46Q polyQ region | This study |
The polyQ protein VcpQ is a membrane-locating and polymeric protein in V. cholerae.
VcpQ is 646 amino acids (aa) in length and contains four predicted regions (Fig. 2A): (i) YfbK (22 to 336 aa), which is predicted to be a secreted protein containing a bacterial Ig-like domain and a vWFA domain; (ii) BamD (356 to 433 aa), a component of the beta-barrel assembly machinery BAM (BamABCDE), which is essential for the folding and insertion of outer membrane proteins in Gram-negative bacteria; (iii) four tetratricopeptide repeat (TPR) domains (340 to 367, 356 to 382, 397 to 426, and 401 to 430 aa) overlapping BamD, which may participate in interactions with substrates and may be involved in binding with other BAM components; and (iv) atrophin-1 (497 to 645 aa), which is expressed by the dentatorubral-pallidoluysian atrophy (DRPLA) gene in eukaryotic cells; the polyQ region is often observed in atrophin-1, and it is thought to confer toxicity to the protein (37), possibly by altering its interactions with other proteins. The region from 408 to 592 aa is also predicted to be a membrane protein involved in colicin uptake in bacteria. VcpQ was predicted to be a membrane protein with two transmembrane regions at 5 to 27 aa and 300 to 322 aa by the website http://www.cbs.dtu.dk/services/TMHMM-2.0/; the 28 to 299 aa region is located in the cytoplasm, and the 1 to 4 aa and 323 to 646 aa regions are exposed to the cell surface (Fig. 2B). In prokaryotes, the function of proteins with polyQ has not been studied.
FIG 2.
Motif illustration, transmembrane domain prediction, and membrane location analysis for VcpQ. (A) Four structural domains of VcpQ are as described above and illustrated with square frames, and the first and last amino acid positions are marked. The two-way arrows indicate the locations of TPR domains. (B) Prediction of VcpQ transmembrane regions. The VcpQ protein sequence is shown in blue; the 14Q peptide region is shown in fluorescent green (the figure is not drawn to scale). OM, outer membrane; IM, inner membrane. (C) Western blot analysis of VcpQ membrane location, showing immunoreactivity with anti-His, anti-TolC, and anti-CRP antibodies. Western blotting was carried out as described in Materials and Methods. (D) Immunoblot analysis of VcpQ in cell fractions of Vc(ΔVcpQ)-C. Samples were subjected to SDS-PAGE and immunoblot analysis using monoclonal antibody His to visualize VcpQ. Lane 1, whole-cell extract; lane 2, cytoplasmic-periplasmic fraction; lanes 3 and 4, total membrane fraction. Except for lane 3, an equivalent amount of each fraction was loaded in each lane. A three-times-larger amount than in other lanes was loaded in lane 3. (E) Analysis of the VcpQ-VcpQ interaction by the BACTH technique. PC, positive control (GCN4 leucine zipper); NC, negative control (vector plasmid only), with VcpQ/TolC as another control. (F) Total membrane samples from strain Vc(ΔVcpQ)-C were separated by native PAGE (4 to 15%; Solarbio, Beijing, China), and Western blot analysis was performed to detect the VcpQ form. Lane M shows a molecular weight marker.
To determine the membrane location of VcpQ, cells of strain Vc(ΔVcpQ)-C with N-terminally histidine (His6)-tagged VcpQ were fractionated into the soluble fraction containing the cytoplasmic and periplasmic compartments and the total membrane fraction. The total membrane samples were separated by SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes, followed by Western blot hybridization with an anti-His6 antibody. As shown in Fig. 2C, VcpQ was detected in the membrane fraction from Vc(ΔVcpQ)-C, and the protein band was located at approximately 75 kDa. TolC is a membrane protein in V. cholerae and was used as the membrane protein control. Western blot analysis showed that it was detected in the membrane fractions extracted from Vc(ΔVcpQ) and Vc(ΔVcpQ)-C. The cyclic AMP (cAMP) receptor protein (CRP) is a key regulator of V. cholerae and expressed only in the cytoplasm; here, CRP was not detected in the membrane fractions from Vc(ΔVcpQ) and Vc(ΔVcpQ)-C (Fig. 2C). Further detection was performed to test whether VcpQ is found in the cytoplasmic fraction; our result showed that VcpQ was found almost exclusively in the membranes (Fig. 2D), and a very minute amount detected in the soluble fraction (38) may be a commonly observed degradation product (39) or those immature proteins expressed in the cytoplasm (40).
The data showed that polyQ proteins are related to polymerization and aggregation, and proteins with longer polyQ tracts tend to have more interaction partners than proteins lacking a polyQ tract (36, 41). We then analyzed whether VcpQ is present as a monomer or polymer in V. cholerae. The bacterial adenylate cyclase-based two-hybrid (BACTH) technique was utilized to detect the possible interactions between VcpQ and itself. Both the plasmids pT25-VcpQ and pT18C-VcpQ (Table 4), carrying vcpQ fused with T25 and T18, fragments of the catalytic domain of CyaA from Bordetella pertussis, respectively, were cotransformed into the Escherichia coli Δcya mutant strain BTH101. A positive interaction between proteins will bring the two Cya fragments together, generate cAMP, and increase β-galactosidase activity. High β-galactosidase activities were observed in VcpQ/VcpQ compared with a GCN4 leucine zipper-positive control (Fig. 2E), suggesting an interaction between the two VcpQs. Furthermore, the membrane proteins of strain Vc(ΔVcpQ)-C were extracted and separated by blue native PAGE. Western blotting with anti-His monoclonal antibodies showed that the molecular weight was approximately 230 kDa in the native PAGE membrane (Fig. 2F), suggesting that VcpQ may form homotrimers on the membrane of V. cholerae.
TABLE 4.
Oligonucleotide primers and plasmids used in this study
| Oligonucleotide | Sequence (5′–3′)a | Use in plasmid(s) |
|---|---|---|
| VcpQ-UP-SpeI-5′ | GGACTAGTAGTCGAGCGTTTGTTGCCC | pWM91-ΔVcpQ |
| VcpQ-UP-3′ | GATCCCAATCTTGACCCTATG | |
| VcpQ-DOWN-5′ | GGGTCAAGATTGGGATCCAACGATGACATGTTATCT | |
| VcpQ-DOWN-XhoI-3′ | CCGCTCGAGGAGTTTATTTGGTGGTGGATGCTGAGTTTATTTGGTGGTGGATGCTG | |
| VCA1056-UP-SpeI-5′ | GGACTAGTCGCAAAAATGATGTACATTG | pWM91-ΔVCA1056 |
| VCA1056-UP-3′ | GACAGTTCCGCTATTAATCC | |
| VCA1056-DOWN-5′ | CTCAGGGGAAAAGCATGAAAGACAGTTCCGCTATT | |
| VCA1056-DOWN-SmaI-3′ | CCGCCCGGGTTTAGAGGCACTGAACCTG | |
| VCA0095-UP-SpeI-5′ | GGACTAGTGGTCAACCCAATCACATGG | pWM91-ΔVCA0095 |
| VCA0095-UP-3′ | ATACGTGATGAATAAGTGTTGC | |
| VCA0095-DOWN-5′ | GCAACACTTATTCATCACGTATACATTCCATCATGG | |
| VCA0095-DOWN-XhoI-3′ | CCGCTCGAGATAGACTTGCGCAATATGTGG | |
| VC0723-UP-SpeI-5′ | GGACTAGTCAATTAACTTGCTCAGGCGC | pWM91-ΔVC0723 |
| VC0723-UP-3′ | CATCGGCAGACTGGATGGAGC | |
| VC0723-DOWN-5′ | GCTCCATCCAGTCTGCCGATGACAGCTTATCCGCAC | |
| VC0723-DOWN-XhoI-3′ | CCGCTCGAGACTGAGATCGACGATTTCGC | |
| VcpQ-NdeI(His)-R | GCTCATATGATGTCATCGTTGATTTTTCTC | pSRKtc-VcpQ(42Q); pSRKtc-VcpQ; pSRKtc-VcpQ(44Q) |
| VcpQ-SpeII(His)-F | CCGCTCGAGTTACATCATCATCATCATCATCATCCATGGCTGATCGGGTTC | pSRKtc-VcpQ(28Q); pSRKtc-VcpQ(14Q) |
| VcpQ-KpnI-R | CGGGGTACCTTACCATGGCTGATCGGGTTC | pT18C-VcpQ(44Q); pT18C-VcpQ; pT18C-VcpQ(42Q) pT18C-VcpQ |
| VcpQ-XbaI-F | CGCTCTAGAGATGTCATCGTTGATTTTTC | pT18C-VcpQ(28Q); pT18C-VcpQ(14Q) |
| VCA1056-UP-SpeI-F | GGACTAGTTGGTGGCACGCCGTGTGGAGC | pWM91-VCA1056(Q523H)-C pT18C-VcpQ |
| VCA1056-UP-Q523H-R | CCACCGAATCCGTACGCTCATGATGCTCAGATACCGAATTACG | |
| VCA1056-Down-Q523H-F | CGTAATTCGGTATCTGAGCATCATGAGCGTACGGATTCGGTGG | |
| VCA1056-Down-SmaI-R | CCGCCCGGGCGCATCGCGAGCGATAAATGC | |
| VCA0095-UP-SpeI-F | GGACTAGTGGTCAACCCAATCACATGG | pWM91-VCA0095(D120G)-C |
| VCA0095-UP-D120G-R | CAAACTCAATCGCTTGAATACCAGTGACGGCTTGGCTCTTC | |
| VCA0095-Down-D120G-F | GAAGAGCCAAGCCGTCACTGGTATTCAAGCGATTGAGTTTG | |
| VCA0095-Down-XhoI-R | CCGCTCGAGGCACTTACTACGATCGGCAAAGTC | |
| VC0723-Up-SpeI-F | GGACTAGTCTCAGATCGGGTACGCAAATAC | pWM91-VC0723(A155S)-C |
| VC0723-Up-A155S-R | GCGCATTTCGACCGCAATGTAACTGTATTCGTCTTTTAAAAACTGCATG | |
| VC0723-Down-A155S-F | CATGCAGTTTTTAAAAGACGAATACAGTTACATTGCGGTCGAAATGCGC | |
| VC0723-Down-XhoI-R | CCGCTCGAGTACGGTATTTGCTGGCAATGG | |
| VcpQ-Up-SpeI-F | GGACTAGTTAGAAAGCGCCTTGCCGCCG | pWM91-VcpQ(S258R)-C |
| VcpQ-Up-S258R-F | CAATTACAGCAGCTCTCACAAAGGGTTCAAGGCGTGCTGACTGCG | |
| VcpQ-Down-S258R-R | CGCAGTCAGCACGCCTTGAACCCTTTGTGAGAGCTGCTGTAATTG | |
| VcpQ-Down-XhoI-R | CCGCTCGAGTCTTGAGTCAGGCTCAGCTTG | |
| VcpQ-XbaI-F | CGCTCTAGAGATGTCATCGTTGATTTTTC | pT25-VcpQ(42Q); pT25-VcpQ(28Q) |
| VcpQ-BamHI-R | CCGGGATCCTTACCATGGCTGATCGGGTTC | pT25-VcpQ(44Q); pT25-VcpQ; pT25-VcpQ(14Q) |
| polyQ-Up-SpeI-F | GGACTAGTCAGGCTCACTTAAGGTAAAC | |
| polyQ-Up-R | CCCAAAGCGAATGCAAAACC | pWM91-Δpoly |
| polyQ-Down-F | GCATTCGCTTTGGGTTTGCGAATAGGCGTCAATG | |
| polyQ-Down-XhoI-R | CCGCTCGAGCTCAGTTGGATCGTCGCTAC | |
| 46Q-Up-SpeI-F | GGACTAGTCAGGCTCACTTAAGGTAAAC | pWM91-46Q |
| 46Q-Down-XhoI-R | CCGCTCGAGCTCAGTTGGATCGTCGCTAC |
Restriction sites are underlined. Boldface letters indicate the mutated nuclear acid sites.
VcpQ of V. cholerae is the adsorption target of the phage VP1.
Considering the membrane location of VcpQ, we analyzed the possibility of VcpQ being a receptor of VP1. First, proteinase K (for degrading surface proteins) was used to treat the WT strain ICDC-VC5724. Then, the treated cells and untreated cells (as the control) were mixed with phage VP1 respectively, and centrifuged, and the remaining phage titers in the supernatants were measured. The VP1 infection titers in the supernatants of the WT cell group decreased obviously, whereas the proteinase K-treated group had much higher VP1 titers in the supernatants than the untreated group (Fig. 3A), suggesting that the VP1 receptor might be a membrane protein.
FIG 3.
Analysis of VP1 adsorption to the host cell through VcpQ. (A) Effects of proteinase K treatments of V. cholerae on VP1 adsorption. (B) Analysis of VP1 adsorption to VcpQ deletion mutants. (C) Binding of SYBR gold-labeled VP1 on the surfaces of different strains as observed by CLSM. V. cholerae strains were mixed with the phage VP1, and the adsorption ability was determined by residual PFU percentages in the supernatant of each sample. WT, wild-type strain not treated with proteinase K; WT+pro K, proteinase K-treated wild-type strain. VcpQΔ14Q, Vc(VcpQΔ14Q); ΔVcpQ, Vc(ΔVcpQ); ΔVcpQ-C, Vc(ΔVcpQ)-C. LB+VP1, LB culture medium containing only phage VP1 was used as a control, and the phage titer in the control supernatant was set to 100%. Error bars indicate statistical variations. Significance was determined by t test for comparisons between the treated group and the WT group. *, P < 0.05. (D) Total membrane protein with VcpQ can partially neutralize VP1 phage. Membrane protein from V. cholerae ICDC-VC5724 or from Vc(ΔVcpQ) or the natural VP1-resistant strain ICDC-VC25 on a fixed concentration of prey (N53) and phage VP1 (10,000 PFU). n = 3 for all. The horizontal solid lines indicate means ± standard deviations. ***, P < 0.001; **, P < 0.01; *, P < 0.05.
Then, phage adsorption experiments were performed with the vcpQ mutants, the complementary strain, and the WT strain (Fig. 3B). When VP1 particles were incubated with the spontaneous vcpQ mutation strain Vc(VcpQΔ14Q) and the constructed strain Vc(ΔVcpQ), the VP1 titers in their supernatants were similar to those in LB containing only VP1 phage, but the VP1 titers decreased substantially when incubated with the WT strain and the vcpQ-complemented strain VC(ΔVcpQ)-C (Fig. 3B).
We further observed VP1 particle adsorption to V. cholerae cells by confocal laser scanning microscopy (CLSM). SYBR gold-stained VP1 could bind to the WT strain ICDC-VC5724 and vcpQ complementary strain VC(ΔVcpQ)-C, but no fluorescence was observed from the vcpQ mutation strains Vc(VcpQΔ14Q) and Vc(ΔVcpQ) (Fig. 3C). These experiments showed that deletion of only full VcpQ or the 14Q peptide results in the strains being deficient for VP1 adsorption, showing that VP1 adheres to the sensitive strains by binding to the membrane protein VcpQ and using it as a receptor.
To evaluate whether VcpQ inhibits VP1 phage predation, the total membrane proteins from the WT strain, the VcpQ deletion mutant Vc(ΔVcpQ), and the natural VP1-resistant strain ICDC-VC25 carrying the gene of VcpQ possessing 42 Q residues, named VcpQ(42Q), were incubated with the phage VP1, respectively. VP1 sensitivity was measured using plaque formation with V. cholerae strain N53. We observed a significant and dose-dependent inhibition of plaque formation by the membrane protein with VcpQ from the WT strain, while no inhibition function was found for the membrane protein from Vc(ΔVcpQ) or ICDC-VC25 with VcpQ(42Q) (Fig. 3D). Our result indicates that the presence of VcpQ in total membrane protein is required to neutralize this phage.
The natural VP1-resistant strains have different glutamine residue deletions in the polyQ stretch of VcpQ.
Bacteria may obtain phage resistance by receptor mutation. Phage typing found some VP1-resistant strains in our V. cholerae collection; therefore, we analyzed the possible receptor mutations among the natural VP1-resistant strains. A total of 109 El Tor biotype strains were selected, including 26 VP1-sensitive and 83 VP1-resistant strains. Their vcpQ genes were amplified and sequenced, and an alignment showed that all the VP1-sensitive strains had vcpQ nucleic acid sequences identical to those of the sensitive WT strain ICDC-VC5724, but 72% (65/83) of the resistant strains had different numbers of glutamine residues deleted in the Q-rich region of VcpQ. A total of 12 deletion mutation sequence types (ST1 to ST12) were found (Fig. 4). The Q-rich region of VcpQ in the VP1-sensitive strains had 46 glutamines (46Q) for ST0, as shown in Fig. 4, while in the resistant strains, 14Q to 44Q were found in the Q-rich region. Detailed information on the glutamine content of each VcpQ sequence type and the number of the strains used in our study can be seen on the right of Fig. 4. Interestingly, the 14Q deletion was the most common deletion mutation among these resistant strains.
FIG 4.
Alignment of the VcpQ sequences of VP1-sensitive and VP1-resistant strains. MEGA was used for the alignment. One representative VcpQ sequence from each sequence type group was used for the sequence alignment. The ST0 group has the sequence from the VP1-sensitive WT strains, and the other groups (ST1 to ST12) show the VcpQ Q-rich region sequences of the VP1-resistant strains used in our study. The Q-rich region is labeled with a black horizontal line. Following each VcpQ sequence type, detailed information on the number of glutamines and the number of strains used in this study is provided (table on the right).
Changes of glutamine residue amounts in the polyQ region of VcpQ possibly affect its structure. To determine whether VP1 can bind to these strains with mutant VcpQ, strains ICDC-VC2950, ICDC-VC25, ICDC-VC2874, and ICDC-VC2572, possessing 44, 42, 28, and 14 glutamine residues in VcpQ, respectively, were selected for the phage adsorption assays. Strains VC2950-46, VC25-46, VC2874-46, and VC2572-46 (Table 3), which can express VcpQs with 46Q regions, were also constructed. Phage adsorption assays showed that all these wild-type VP1-resistant strains did not adsorb VP1, while their corresponding engineered strains with 46Q restored the phage binding (Fig. 5A). The fluorescence microscope technique CLSM was performed for the incubation of SYBR gold-stained VP1 phage with these strains, and no fluorescence was observed around the cells of these natural VP1-resistant strains, while positive fluorescence could be achieved on these reconstituted strains (Fig. 5B). To verify the ability of these VcpQ mutants to bind VP1, their open reading frames were amplified from the strains and cloned into the expression plasmid pSRKtc to generate the recombinant plasmids pSRKtc-VcpQ(44Q), pSRKtc-VcpQ(42Q), pSRKtc-VcpQ(28Q), and pSRKtc-VcpQ(14Q), which were transformed into strain Vc(ΔVcpQ). The WT vcpQ gene was treated and transformed similarly. VP1 infection by the double-layer plaque assays of the resulting strains Vc(44Q), Vc(42Q), Vc(28Q), and Vc(14Q) showed that their sensitivities to VP1 were not recovered (Fig. 5C). We used qRT-PCR to survey the transcript levels of the vcpQ mutant genes cloned in the recombination plasmids in strain Vc(ΔVcpQ). The results showed that the transcription levels of these mutant vcpQ genes were comparable to that of vcpQ in the WT strain (Fig. 5D). Therefore, it can be deduced that the glutamine residue deletion resulted in resistance to VP1 infection in these strains.
FIG 5.
Analysis of the interaction between the phage VP1 and the resistant strains. (A) VP1 adsorption assays of the VcpQ glutamine residue deletion mutants and their corresponding engineered strains with 46Q regions. LB, LB+VP1. (B and C) CLSM observation of SYBR gold-labeled VP1 on the surfaces of the WT strain ICDC-VC5724, the natural VcpQ mutant strains, and their engineered strains. (C) VP1 phage sensitivity analysis for the wild-type and VcpQ mutant complementary strains. (D) qRT-PCR assays of vcpQ transcription in the wild-type and VcpQ mutant complementary strains. Three independent cultures were performed as repeats. Error bars, standard deviations.
Deletion of glutamine residues does not affect the membrane localization and polymerization of VcpQ.
One possible reason for VP1 resistance is a VcpQ membrane localization failure caused by the polyQ deletion from VcpQ, which would indirectly cause the strain to lose its phage binding ability but not abrogate VcpQ binding to VP1. To detect the membrane position of the mutant VcpQs, the mutant vcpQ genes with different polyQ deletions were cloned into an expression plasmid to generate plasmids pSRKtc-VcpQ(44Q), pSRKtc-VcpQ(42Q), pSRKtc-VcpQ(28Q), and pSRKtc-VcpQ(14Q). In parallel with pSRKtc-VcpQ, carrying the intact vcpQ with a His tag, these plasmids were individually transformed into strain Vc(ΔVcpQ). Total membrane proteins were extracted from each strain and separated by SDS-PAGE and blue native PAGE. Western blotting with anti-His monoclonal antibodies showed that the mutant VcpQs had similar molecular weights as VcpQ in SDS-PAGE (approximately 75 kDa) and native PAGE (approximately 230 kDa) (Fig. 6A). These results suggested that the VcpQ mutants were still located on the membrane and could form homotrimers similarly to the intact VcpQ.
FIG 6.
Analysis of membrane forms of VcpQ and its mutants. (A) The expressed intact VcpQ and mutant VcpQ proteins with fewer Q residues were separated by SDS-PAGE and native PAGE, respectively. Lanes 1 to 5 indicate wild-type VcpQ(46Q), VcpQ(44Q), VcpQ(42Q), VcpQ(28Q), and VcpQ(14Q) proteins, respectively. (B) Analysis of the VcpQ-VcpQ interaction by the BACTH method. Results are shown for the wild-type VcpQ possessing 46Q, named WT(46Q), and the different Q deletion mutants, including VcpQ proteins possessing 44, 42, 28, and 14 Q residues. PC, positive control (GCN4 leucine zipper); NC, negative control (vector plasmid only).
To detect whether the polyQ deletion mutation possibly affects VcpQ polymerization, the mutant vcpQ genes containing 44Q, 42Q, 28Q, and 14Q were cloned into pT18C and pT25 (Table 4). The plasmid pairs pT18C-VcpQ(44Q)/pT25-VcpQ(44Q), pT18C-VcpQ(42Q)/pT25-VcpQ(42Q), pT18C-VcpQ(28Q)/pT25-VcpQ(28Q), and pT18C-VcpQ(14Q)/pT25-VcpQ(14Q) were cotransformed into BTH101, and their β-galactosidase activities were all as high as those of the WT VcpQ/VcpQ and the system positive control (Fig. 6B), suggesting that the decrease in the length of polyQ had no effect on the formation of VcpQ homologous polymers.
DISCUSSION
In this study, a membrane protein possessing the polyQ tract, VcpQ, was identified in V. cholerae and suggested to serve as a receptor of Vibrio phage VP1. Different numbers of Q residues are absent from VcpQ in the natural VP1-resistant strains, and these deletions may endow V. cholerae with resistance to VP1 infection.
PolyQ proteins are rarely reported in prokaryotes (36), and studies on the function of polyQ proteins are exclusive to eukaryotes. Glutamines in protein are encoded by the codons CAG and CAA. Different trinucleotides encoding glutamine are observed between the VcpQ protein in V. cholerae and those polyQ proteins in human neurodegenerative disease (polyQ disease). Tandemly arranged CAGCAA trinucleotide repeats encoding 46 glutamine stretches exist in the vcpQ genes from VP1-sensitive strains, whereas the lengths of the polyQ stretches in VcpQ in most VP1-resistant strains are shorter than those of sensitive strains, and the trinucleotide codons are deleted in “modules” of “CAGCAA” pair form in these VP1-resistant strains (data not shown). Therefore, the glutamine deletion numbers in 12 deletion sequence types (ST) are multiples of 2 Q residues (Fig. 4). However, the polyQ stretches that are lengthened in human disease proteins are encoded almost exclusively by pure CAG trinucleotide codons, while CAA repeats have not been observed (42). Although it seems that the polyQ regions encoded by pure CAG, CAA, or the two mixed repeats are the same on the protein level (thus having no influence on protein function regarding the VP1 phage receptor), it is possible that these different code repeats have a function at the transcript level.
Proteins containing polyQ in humans may lead to neurodegenerative disease, but they also have some functions related to transcriptional regulation and nuclear localization (32–34); in particular, a more general role in mediating protein-protein interactions has been suggested (43). PolyQ protein functions in bacteria are rarely reported, and our study in V. cholerae found that VcpQ plays an important role on the host cell surface during VP1 phage targeting. In all VP1-sensitive V. cholerae strains, VcpQ polyQ regions are 46Q in length, whereas in the natural VP1-resistant strains, two- to 32-glutamine-residue deletions are found in most strains, suggesting that the 46Q tract is essential for the binding and infection onset of VP1. It is similar to a human neurodegenerative disease whose prevalence correlates with the length of the polyQ protein (44). Proteins with longer polyQ stretches tend to have more interaction partners and stronger interactions (36, 41). Therefore, it is reasonable to some degree that the shorter polyQ stretch mutations in VcpQ of V. cholerae may enable these strains to stop or reduce the phage’s adsorption and endow V. cholerae strains with VP1 resistance. Deletions in glutamine residues may not affect the membrane localization and polymerization of VcpQ but may affect the binding with phage VP1. Therefore, it seems that polyQ stretches of fewer than 46 glutamines will change the outer membrane structure of VcpQ, resulting in the loss of specific structural features enabling VP1 phage recognition. Until now, we have not found a V. cholerae strain that has more than 46Q in VcpQ, so it is unclear whether V. cholerae strains containing VcpQ with more than 46Q can be infected by VP1.
Receptors located on the host cell determine the host range and specificity of phages. A broad range of host-associated receptors has been reported, such as OMPs (9, 28, 45), LPS (22, 23, 46), and other cell surface structures (46, 47). Identifying host receptors is conducive to understanding the genetic basis of phage typing and host variation (48, 49), since receptor mutations may be discovered and verified in phage-resistant strains. In our study, all four spontaneous mutant strains with VP1 resistance, identified in four independent experiments, had glutamine residue deletions in their polyQ stretches of VcpQ, and such deletions were also observed in most of the natural VP1-resistant strains, suggesting a propensity for polyQ stretch mutations in the selection of VP1-resistant V. cholerae strains under VP1 infection pressure. Q-rich regions in VcpQ proteins are encoded by tandemly arranged CAGCAA trinucleotide repeats, and short DNA sequences 1 to 6 nucleotides in length tandemly repeated 10 to 60 times are genetically unstable due to a high mutation rate as a result of abnormal DNA mismatch repair (in bacteria as well as humans) (50). In addition, receptor mutation is a common strategy for the survival of bacteria in environments containing phages and is favorable to the expansion of resistant clones.
In summary, we identified a rare polyQ protein in V. cholerae that serves as the receptor of the typing phage VP1. V. cholerae may decrease the number of glutamine residues within the polyQ stretch to generate resistance to VP1 infection. It is interesting to find a polyQ protein in V. cholerae that may belong to the polyQ protein family, which may have an important role in human neurodegenerative disease. The interaction between VcpQ and the VP1 receptor binding protein and the function of this polyQ protein in V. cholerae need to be explored further. We also found some VP1-resistant strains possessing intact VcpQ identical to those of the sensitive strains, which may suggest unrevealed resistance mechanisms in other phage infection processes in these strains, such as phage DNA injection (10), restriction modification (11), and phage assembly (51). Further studies on these aspects may elucidate the new resistance strategies of the strains.
MATERIALS AND METHODS
Bacterial strains, the phage, plasmids, and culture conditions.
The bacterial strains and plasmids used in this study are summarized in Table 3 and Table 4, respectively. VP1 phage was propagated on strain N53 as described in a previous study (9). Phage titers were determined by double-layer plaque assay. WT ICDC-VC5724, which is resistant to streptomycin (Sm) and sensitive to VP1, was used in conjugation tests and distinguished from E. coli SM10 λpir by its resistance to Sm. Unless otherwise stated, all strains were grown at 37°C in LB medium, on LB medium plates with 15 g/liter agar, or on soft-agar medium including an additional 0.4% (wt/vol) agar. Antibiotics were used at the following concentrations: ampicillin (Amp), 100 μg/ml; streptomycin (Sm), 100 μg/ml; and kanamycin (Kan), 50 μg/ml. For E. coli, we used the following: chloramphenicol (Cm), 30 μg/ml, and tetracycline (Tet), 10 μg/ml. For V. cholerae, we used the following: chloramphenicol, 2 μg/ml, and tetracycline, 2 μg/ml.
Genome sequencing and comparative analysis.
Genomic DNA was extracted from our strains using the Wizard genomic DNA extraction kit (Promega, Madison, WI, USA). Then, it was subjected to 250-bp paired-end whole-genome sequencing using an Illumina HiSeq2000. The potential coding sequences of draft genomes were identified by using Prodigal (version 2.60). BLASTp was used to explore the variation in our strains, which was conducted by aligning the protein sequences of our strains to the protein sequences of the reference genome.
Construction and complementation of mutants.
The in-frame mutants of the genes targeted in this study were constructed by homologous recombination using the suicide plasmid pWM91. The 1-kb flanking regions upstream and downstream of the corresponding gene were amplified by PCR from ICDC-VC5724 chromosomal DNA using the “UP” and “DOWN” primer pairs, respectively, for example, VcpQ-UP-SpeI-5′/VcpQ-UP-3′ and VcpQ-DOWN-5′/VcpQ-DOWN-XhoI-3′ (Table 4). The two amplicons overlapped and were used as templates to generate a full fragment using the primer pairs with restriction enzyme sites, for example, VcpQ-UP-SpeI-5′/VcpQ-DOWN-XhoI-3′. The resulting fragment was digested with SpeI/XhoI and cloned into pWM91, generating the plasmid pWM91-ΔVcpQ, which was conjugally transferred into ICDC-VC5724 from the donor strain E. coli SM10 λpir. Transconjugants were selected on LB agar (Amp, 100 μg/ml, and Sm, 100 μg/ml) and restreaked onto LB agar with 10% sucrose and without NaCl at 22°C. The inability of some colonies from the sucrose selection medium to grow on LB agar plates with Amp (100 μg/ml) indicated that the suicide plasmid was absent and that double crossover had occurred. Clones were amplified with primers with restriction enzyme sites, such as VcpQ-UP-SpeI-5′/VcpQ-DOWN-XhoI-3′ (Table 4), producing shorter amplicons than the WT strain. The resulting mutants were confirmed by sequencing. The other mutants were constructed in a similar fashion.
The plasmid pSRKtc was used to construct complementary plasmids with inserted WT genes or genes with mutation sites. When the complementary plasmids were constructed and transformed into different mutants, 0.1 μM IPTG (isopropyl-β-d-thiogalactopyranoside) was used for induction. The empty plasmid pSRKtc was transformed into mutants as a control. All the primers used for plasmid construction are listed in Table 4.
Four mutants with single-amino-acid alterations in four separate genes (VC0723A155S, VCA0095D120G, VCA0171S258R, and VCA1056Q523H) were constructed by homologous recombination using the suicide plasmid pWM91. The gene region and 1-kb flanking regions upstream and downstream of the corresponding gene were amplified by PCR using the “Up” and “Down” primer pairs, respectively, for example, VC0723-Up-SpeI-F/VC0723-Up-A155S-R and VC0723-Down-A155S-F/VC0723-Down-XhoI-R (Table 4). The two amplicons overlapped and were used as the templates to generate a full fragment using primer pairs with restriction enzyme sites, such as VC0723-Up-SpeI-F/VC0723-Down-XhoI-R. This fragment was digested with SpeI/XhoI and cloned into pWM91, generating the plasmid pWM91-VC0723(A155S)-C, which was conjugally transferred into the corresponding in-frame mutant Vc(ΔVC0723) from the donor strain E. coli SM10 λpir. The following transconjugants and the colonies from the sucrose selection medium were selected the same as the in-frame mutant construct was. The clones were amplified with primers with restriction enzyme sites, such as VC0723-Up-SpeI-F/VC0723-Down-XhoI-R (Table 4), producing longer amplicons than the in-frame mutant strain. The resulting mutant Vc(VC0723A155S) was confirmed by sequencing. The other mutants with single-amino-acid alterations were constructed in a similar fashion.
Proteinase K treatment.
The proteinase K treatment assay was performed as described previously (52). Briefly, V. cholerae cultures (2 ml) were treated with proteinase K (0.2 mg/ml; Promega) at 37°C for 1 h and then washed with 2 ml of LB. The phage adsorption assay was then performed.
Double-layer plaque assay.
The double-layer plaque assay was performed as described previously (53). Briefly, 100 μl of cell cultures (optical density at 600 nm [OD600] = 0.3) was mixed with 4 ml of 50°C-melted 0.7% LB agar and poured onto an LB agar plate, and then 10 μl of VP1 (108 PFU/ml) was dropped onto the plate when the upper layer solidified and incubated overnight at 37°C. Plaque formation indicates that the strain is sensitive to VP1.
Isolation of phage-resistant mutants.
A previously described method (54) was used with minor modifications. V. cholerae cultures (100 ml) were grown to an absorbance at 600 nm of 0.1 and mixed with the bacteriophage VP1 at a multiplicity of infection (MOI) of 10. After shaking incubation for 24 h at 37°C and centrifugation at 5,000 rpm for 15 min, 5 ml of supernatant with VP1 phage was mixed with the pellet, and 100 μl of the mixture was dropped into 4 ml of top agar (1% tryptone, 0.5% yeast extract, 0.5% NaCl, and 0.7% agar), which was poured onto an LB agar plate (1% tryptone, 0.5% yeast extract, 0.5% NaCl, and 1.5% agar) (55, 56). After 24 h of incubation at 37°C, lysis was observed, almost all the bacterial population was killed, and some resistant mutant colonies appeared on the plate. Mutant colonies were picked and transferred to a fresh LB agar plate. They were restreaked to check the stability of the phenotype. The experiments were repeated four times, and one VP1-resistant colony was selected from each experiment.
Phage adsorption assay.
VcpQ mutant strains, the corresponding complemented mutants, and the natural resistant strains were utilized in phage adsorption experiments. Approximately 5 × 108 PFU of phage VP1 in 500 μl was mixed with a 500-μl sample of bacteria (OD600 = 0.2). The suspension was incubated at room temperature for 5 min and centrifuged at 5,000 rpm for 5 min, and the phage titer remaining in the supernatant, i.e., the residual PFU percentage, was determined. LB was used as a nonadsorbing control in each assay, and the phage titer in the control supernatant was set to 100%. Each assay was performed in duplicate and repeated at least three times. The percentage of the residual phage unbound to the cells was calculated as (titer of unbound phage)/(titer of added phage).
Isolation of the cell membrane fraction.
The total membrane proteins were extracted as previously described (57). Cell pellets of strains grown to mid-exponential phase (OD600 = 0.8) from a 100-ml culture were harvested by centrifugation at 4°C and 9,000 rpm for 10 min. Cell pellets were washed and suspended in 3 ml of Tris buffer (25 mM Tris HCl, pH 8.0, 150 mM NaCl) supplemented with a protease inhibitor cocktail (Complete EDTA-free; Roche), and cells were lysed on ice by sonication. Unbroken cells were removed by centrifugation at 4°C and 5,000 rpm for 10 min, and the supernatant was loaded onto a two-step gradient composed of 0.3 ml 65% (wt/vol) and 1 ml 25% (wt/vol) sucrose in Tris-EDTA (TE) and centrifuged at 4°C and 50,000 rpm for 2.5 h. The top 3 ml of the soluble fraction, containing both cytoplasm and periplasm, was collected, the next 500 μl was discarded as cellular debris, and the next 500 μl was preserved as the total cellular membrane fraction.
Western blot analysis.
SDS loading buffer was added to the two cellular membrane samples from Vc(ΔVcpQ) and Vc(ΔVcpQ)-C, and the samples were boiled at 100°C for 5 min. Then 10 μl of each sample was loaded onto 12% polyacrylamide gels, the sample loading was repeated in the same order, and the samples were run at 180 V for 45 min. After electrophoresis, proteins were transferred onto PVDF membranes (Immobilon-P; Millipore). The PVDF membranes were cut along the middle of the two repetitions to give two parts: one part was used to detect His-tagged VcpQ with anti-His monoclonal antibodies from mouse (Tiangen Biotech, Beijing, China), and the other was used to detect the membrane marker protein TolC using anti-TolC polyclonal antibodies (laboratory preparation) or CRP polyclonal antibodies (Tiangen Biotech, Beijing, China). Anti-mouse and anti-rabbit peroxidase-conjugated AffiniPure IgG (H+L) secondary antibodies (Zhong Shan Jin Qiao, Beijing, China) were used for protein detection.
Adsorption of SYBR gold-stained phage VP1 to strains.
VP1 phage lysate with a titer of at least 108 PFU/ml was mixed at 100,000:1 (vol/vol) with a SYBR gold nucleic acid gel stain stock solution (S11494; Invitrogen) and incubated for 30 min in the dark at room temperature. The mixture was filtered through 0.02-μm-pore filters (6809-5002; Waterman, Germany) and washed two times using an equal volume of phosphate-buffered saline (PBS). Two milliliters of PBS was used to gather labeled phage on the filters. Next, 500 μl of bacterial culture (OD600 = 0.2) was mixed with phage (1010 PFU/ml) at 1:1 (vol/vol), incubated for 10 min, and centrifuged at 5,000 rpm for 5 min. The sample was mixed with an equal volume of 0.5% agarose and dropped on a slide in 1-μl aliquots for observation by CLSM (FV500; Olympus, Japan).
Data availability.
All the sequence data were deposited in GenBank under accession numbers SAMN16807138 to SAMN16807142 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA678573).
ACKNOWLEDGMENTS
This work was supported by National Science Foundation of China Youth Fund 81501724.
We declare no conflicts of interest in regard to this work.
REFERENCES
- 1.Ali M, Nelson AR, Lopez AL, Sack DA. 2015. Updated global burden of cholera in endemic countries. PLoS Negl Trop Dis 9:e0003832. doi: 10.1371/journal.pntd.0003832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Legros D, Partners of the Global Task Force on Cholera Control. 2018. Global cholera epidemiology: opportunities to reduce the burden of cholera by 2030. J Infect Dis 218:S137–S140. doi: 10.1093/infdis/jiy486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hsu BB, Gibson TE, Yeliseyev V, Liu Q, Lyon L, Bry L, Silver PA, Gerber GK. 2019. Dynamic modulation of the gut microbiota and metabolome by bacteriophages in a mouse model. Cell Host Microbe 25:803–814.e5. doi: 10.1016/j.chom.2019.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lin DM, Lin HC. 2019. A theoretical model of temperate phages as mediators of gut microbiome dysbiosis. F1000Res 8:997. doi: 10.12688/f1000research.18480.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Faruque SM, Naser IB, Islam MJ, Faruque AS, Ghosh AN, Nair GB, Sack DA, Mekalanos JJ. 2005. Seasonal epidemics of cholera inversely correlate with the prevalence of environmental cholera phages. Proc Natl Acad Sci U S A 102:1702–1707. doi: 10.1073/pnas.0408992102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Chattopadhyay DJ, Sarkar BL, Ansari MQ, Chakrabarti BK, Roy MK, Ghosh AN, Pal SC. 1993. New phage typing scheme for Vibrio cholerae O1 biotype El Tor strains. J Clin Microbiol 31:1579–1585. doi: 10.1128/JCM.31.6.1579-1585.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chakrabarti AK, Ghosh AN, Nair GB, Niyogi SK, Bhattacharya SK, Sarkar BL. 2000. Development and evaluation of a phage typing scheme for Vibrio cholerae O139. J Clin Microbiol 38:44–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Rostol JT, Marraffini L. 2019. (Ph)ighting phages: how bacteria resist their parasites. Cell Host Microbe 25:184–194. doi: 10.1016/j.chom.2019.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fan F, Li X, Pang B, Zhang C, Li Z, Zhang L, Li J, Zhang J, Yan M, Liang W, Kan B. 2018. The outer-membrane protein TolC of Vibrio cholerae serves as a second cell-surface receptor for the VP3 phage. J Biol Chem 293:4000–4013. doi: 10.1074/jbc.M117.805689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cumby N, Reimer K, Mengin-Lecreulx D, Davidson AR, Maxwell KL. 2015. The phage tail tape measure protein, an inner membrane protein and a periplasmic chaperone play connected roles in the genome injection process of E. coli phage HK97. Mol Microbiol 96:437–447. doi: 10.1111/mmi.12918. [DOI] [PubMed] [Google Scholar]
- 11.Ko CC, Hatfull GF. 2018. Mycobacteriophage Fruitloop gp52 inactivates Wag31 (DivIVA) to prevent heterotypic superinfection. Mol Microbiol 108:443–460. doi: 10.1111/mmi.13946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. 2007. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709–1712. doi: 10.1126/science.1138140. [DOI] [PubMed] [Google Scholar]
- 13.Sumby P, Smith MC. 2002. Genetics of the phage growth limitation (Pgl) system of Streptomyces coelicolor A3(2). Mol Microbiol 44:489–500. doi: 10.1046/j.1365-2958.2002.02896.x. [DOI] [PubMed] [Google Scholar]
- 14.Xiong X, Wu G, Wei Y, Liu L, Zhang Y, Su R, Jiang X, Li M, Gao H, Tian X, Zhang Y, Hu L, Chen S, Tang Y, Jiang S, Huang R, Li Z, Wang Y, Deng Z, Wang J, Dedon PC, Chen S, Wang L. 2020. SspABCD-SspE is a phosphorothioation-sensing bacterial defence system with broad anti-phage activities. Nat Microbiol 5:917–928. doi: 10.1038/s41564-020-0700-6. [DOI] [PubMed] [Google Scholar]
- 15.Depardieu F, Didier JP, Bernheim A, Sherlock A, Molina H, Duclos B, Bikard D. 2016. A eukaryotic-like serine/threonine kinase protects staphylococci against phages. Cell Host Microbe 20:471–481. doi: 10.1016/j.chom.2016.08.010. [DOI] [PubMed] [Google Scholar]
- 16.Blower TR, Pei XY, Short FL, Fineran PC, Humphreys DP, Luisi BF, Salmond GP. 2011. A processed noncoding RNA regulates an altruistic bacterial antiviral system. Nat Struct Mol Biol 18:185–190. doi: 10.1038/nsmb.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Vidakovic L, Singh PK, Hartmann R, Nadell CD, Drescher K. 2018. Dynamic biofilm architecture confers individual and collective mechanisms of viral protection. Nat Microbiol 3:26–31. doi: 10.1038/s41564-017-0050-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Reyes-Robles T, Dillard RS, Cairns LS, Silva-Valenzuela CA, Housman M, Ali A, Wright ER, Camilli A. 2018. Vibrio cholerae outer membrane vesicles inhibit bacteriophage infection. J Bacteriol 200:e00792-17. doi: 10.1128/JB.00792-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Harvey H, Bondy-Denomy J, Marquis H, Sztanko KM, Davidson AR, Burrows LL. 2018. Pseudomonas aeruginosa defends against phages through type IV pilus glycosylation. Nat Microbiol 3:47–52. doi: 10.1038/s41564-017-0061-y. [DOI] [PubMed] [Google Scholar]
- 20.Fernandes S, Sao-Jose C. 2018. Enzymes and mechanisms employed by tailed bacteriophages to breach the bacterial cell barriers. Viruses 10:396. doi: 10.3390/v10080396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Clement JM, Lepouce E, Marchal C, Hofnung M. 1983. Genetic study of a membrane protein: DNA sequence alterations due to 17 lamB point mutations affecting adsorption of phage lambda. EMBO J 2:77–80. doi: 10.1002/j.1460-2075.1983.tb01384.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zhang J, Li W, Zhang Q, Wang H, Xu X, Diao B, Zhang L, Kan B. 2009. The core oligosaccharide and thioredoxin of Vibrio cholerae are necessary for binding and propagation of its typing phage VP3. J Bacteriol 191:2622–2629. doi: 10.1128/JB.01370-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xu J, Zhang J, Lu X, Liang W, Zhang L, Kan B. 2013. O antigen is the receptor of Vibrio cholerae serogroup O1 El Tor typing phage VP4. J Bacteriol 195:798–806. doi: 10.1128/JB.01770-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Cole ST, Chen-Schmeisser U, Hindennach I, Henning U. 1983. Apparent bacteriophage-binding region of an Escherichia coli K-12 outer membrane protein. J Bacteriol 153:581–587. doi: 10.1128/JB.153.2.581-587.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Rabsch W, Ma L, Wiley G, Najar FZ, Kaserer W, Schuerch DW, Klebba JE, Roe BA, Laverde Gomez JA, Schallmey M, Newton SM, Klebba PE. 2007. FepA- and TonB-dependent bacteriophage H8: receptor binding and genomic sequence. J Bacteriol 189:5658–5674. doi: 10.1128/JB.00437-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Merino S, Camprubi S, Tomas JM. 1990. Isolation and characterization of bacteriophage PM3 from Aeromonas hydrophila the bacterial receptor for which is the monopolar flagellum. FEMS Microbiol Lett 57:277–282. doi: 10.1016/0378-1097(90)90080-a. [DOI] [PubMed] [Google Scholar]
- 27.Silverman JA, Benson SA. 1987. Bacteriophage K20 requires both the OmpF porin and lipopolysaccharide for receptor function. J Bacteriol 169:4830–4833. doi: 10.1128/jb.169.10.4830-4833.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Parent KN, Erb ML, Cardone G, Nguyen K, Gilcrease EB, Porcek NB, Pogliano J, Baker TS, Casjens SR. 2014. OmpA and OmpC are critical host factors for bacteriophage Sf6 entry in Shigella. Mol Microbiol 92:47–60. doi: 10.1111/mmi.12536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gao S, Liu B. 1984. Characteristics of typing phages of Vibrio cholerae biotype El Tor. Fu Huo Luan Zi Liao Hui Bian 4:9. [Google Scholar]
- 30.Disease Control Bureau of the Ministry of Health of China. 2013. Manual of cholera prevention (6th ed). People’s Medical Publishing House, Beijing, China. [Google Scholar]
- 31.Butland SL, Devon RS, Huang Y, Mead CL, Meynert AM, Neal SJ, Lee SS, Wilkinson A, Yang GS, Yuen MM, Hayden MR, Holt RA, Leavitt BR, Ouellette BF. 2007. CAG-encoded polyglutamine length polymorphism in the human genome. BMC Genomics 8:126. doi: 10.1186/1471-2164-8-126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Karlin S, Burge C. 1996. Trinucleotide repeats and long homopeptides in genes and proteins associated with nervous system disease and development. Proc Natl Acad Sci U S A 93:1560–1565. doi: 10.1073/pnas.93.4.1560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Alba MM, Guigo R. 2004. Comparative analysis of amino acid repeats in rodents and humans. Genome Res 14:549–554. doi: 10.1101/gr.1925704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Harrison PM. 2006. Exhaustive assignment of compositional bias reveals universally prevalent biased regions: analysis of functional associations in human and Drosophila. BMC Bioinformatics 7:441. doi: 10.1186/1471-2105-7-441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Orr HT, Zoghbi HY. 2007. Trinucleotide repeat disorders. Annu Rev Neurosci 30:575–621. doi: 10.1146/annurev.neuro.29.051605.113042. [DOI] [PubMed] [Google Scholar]
- 36.Schaefer MH, Wanker EE, Andrade-Navarro MA. 2012. Evolution and function of CAG/polyglutamine repeats in protein-protein interaction networks. Nucleic Acids Res 40:4273–4287. doi: 10.1093/nar/gks011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Nucifora FC, Jr, Ellerby LM, Wellington CL, Wood JD, Herring WJ, Sawa A, Hayden MR, Dawson VL, Dawson TM, Ross CA. 2003. Nuclear localization of a non-caspase truncation product of atrophin-1, with an expanded polyglutamine repeat, increases cellular toxicity. J Biol Chem 278:13047–13055. doi: 10.1074/jbc.M211224200. [DOI] [PubMed] [Google Scholar]
- 38.Farizo KM, Fiddner S, Cheung AM, Burns DL. 2002. Membrane localization of the S1 subunit of pertussis toxin in Bordetella pertussis and implications for pertussis toxin secretion. Infect Immun 70:1193–1201. doi: 10.1128/iai.70.3.1193-1201.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Burns DL, Hausman SZ, Lindner W, Robey FA, Manclark CR. 1987. Structural characterization of pertussis toxin A subunit. J Biol Chem 262:17677–17682. doi: 10.1016/S0021-9258(18)45432-4. [DOI] [PubMed] [Google Scholar]
- 40.Randall LL, Hardy SJ, Thom JR. 1987. Export of protein: a biochemical view. Annu Rev Microbiol 41:507–541. doi: 10.1146/annurev.mi.41.100187.002451. [DOI] [PubMed] [Google Scholar]
- 41.Yushchenko T, Deuerling E, Hauser K. 2018. Insights into the aggregation mechanism of PolyQ proteins with different glutamine repeat lengths. Biophys J 114:1847–1857. doi: 10.1016/j.bpj.2018.02.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Gatchel JR, Zoghbi HY. 2005. Diseases of unstable repeat expansion: mechanisms and common principles. Nat Rev Genet 6:743–755. doi: 10.1038/nrg1691. [DOI] [PubMed] [Google Scholar]
- 43.Hands S, Sinadinos C, Wyttenbach A. 2008. Polyglutamine gene function and dysfunction in the ageing brain. Biochim Biophys Acta 1779:507–521. doi: 10.1016/j.bbagrm.2008.05.008. [DOI] [PubMed] [Google Scholar]
- 44.Bates GP, Dorsey R, Gusella JF, Hayden MR, Kay C, Leavitt BR, Nance M, Ross CA, Scahill RI, Wetzel R, Wild EJ, Tabrizi SJ. 2015. Huntington disease. Nat Rev Dis Primers 1:15005. doi: 10.1038/nrdp.2015.5. [DOI] [PubMed] [Google Scholar]
- 45.Morona R, Klose M, Henning U. 1984. Escherichia coli K-12 outer membrane protein (OmpA) as a bacteriophage receptor: analysis of mutant genes expressing altered proteins. J Bacteriol 159:570–578. doi: 10.1128/JB.159.2.570-578.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Knirel YA, Prokhorov NS, Shashkov AS, Ovchinnikova OG, Zdorovenko EL, Liu B, Kostryukova ES, Larin AK, Golomidova AK, Letarov AV. 2015. Variations in O-antigen biosynthesis and O-acetylation associated with altered phage sensitivity in Escherichia coli 4s. J Bacteriol 197:905–912. doi: 10.1128/JB.02398-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Schwechheimer C, Kuehn MJ. 2015. Outer-membrane vesicles from Gram-negative bacteria: biogenesis and functions. Nat Rev Microbiol 13:605–619. doi: 10.1038/nrmicro3525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Picken RN, Beacham IR. 1977. Bacteriophage-resistant mutants of Escherichia coli K12. Location of receptors within the lipopolysaccharide. J Gen Microbiol 102:305–318. doi: 10.1099/00221287-102-2-305. [DOI] [PubMed] [Google Scholar]
- 49.Lebek G, Teysseire P, Baumgartner A. 1993. A method for typing Listeria monocytogenes strains by classification of listeriocins and phage receptors. Zentralbl Bakteriol 278:58–68. doi: 10.1016/s0934-8840(11)80279-3. [DOI] [PubMed] [Google Scholar]
- 50.Lothe RA. 2001. Microsatellite instability, p 571–574. In Schwab M (ed), Encyclopedic reference of cancer. Springer, Berlin, Germany. [Google Scholar]
- 51.Seed KD, Lazinski DW, Calderwood SB, Camilli A. 2013. A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity. Nature 494:489–491. doi: 10.1038/nature11927. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Kiljunen S, Datta N, Dentovskaya SV, Anisimov AP, Knirel YA, Bengoechea JA, Holst O, Skurnik M. 2011. Identification of the lipopolysaccharide core of Yersinia pestis and Yersinia pseudotuberculosis as the receptor for bacteriophage phiA1122. J Bacteriol 193:4963–4972. doi: 10.1128/JB.00339-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Frost JA, Kramer JM, Gillanders SA. 1999. Phage typing of Campylobacter jejuni and Campylobacter coli and its use as an adjunct to serotyping. Epidemiol Infect 123:47–55. doi: 10.1017/s095026889900254x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Kim MS, Kim YD, Hong SS, Park K, Ko KS, Myung H. 2015. Phage-encoded colanic acid-degrading enzyme permits lytic phage infection of a capsule-forming resistant mutant Escherichia coli strain. Appl Environ Microbiol 81:900–909. doi: 10.1128/AEM.02606-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Adams MH. 1959. Bacteriophages, p 592. Interscience Publishers, New York, NY. [Google Scholar]
- 56.Kropinski AM, Mazzocco A, Waddell TE, Lingohr E, Johnson RP. 2009. Enumeration of bacteriophages by double agar overlay plaque assay. Methods Mol Biol 501:69–76. doi: 10.1007/978-1-60327-164-6_7. [DOI] [PubMed] [Google Scholar]
- 57.Ryan KR, Taylor JA, Bowers LM. 2010. The BAM complex subunit BamE (SmpA) is required for membrane integrity, stalk growth and normal levels of outer membrane {beta}-barrel proteins in Caulobacter crescentus. Microbiology (Reading) 156:742–756. doi: 10.1099/mic.0.035055-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the sequence data were deposited in GenBank under accession numbers SAMN16807138 to SAMN16807142 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA678573).