Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2021 May 4;17:184. doi: 10.1186/s12917-021-02885-y

The construction of recombinant Lactobacillus casei vaccine of PEDV and its immune responses in mice

Xiaowen Li 1,2,3,#, Bingzhou Zhang 1,2,#, Dasheng Zhang 4, Sidang Liu 3,✉, Jing Ren 2,5,✉
PMCID: PMC8097780  PMID: 33947419

Abstract

Background

Porcine epidemic diarrhea (PED) is a contagious intestinal disease caused by porcine epidemic diarrhea virus (PEDV) characterized by vomiting, diarrhea, anorexia, and dehydration, which have caused huge economic losses around the world. At present, vaccine immunity is still the most effective method to control the spread of PED. In this study, we have constructed a novel recombinant L. casei-OMP16-PEDVS strain expressing PEDVS protein of PEDV and OMP16 protein of Brucella abortus strain. To know the immunogenicity of the recombinant L. casei-OMP16-PEDVS candidate vaccine, it was compared with BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS recombinant protein.

Results

The results showed that we could detect higher levels of IgG, neutralizing antibody, IL-4, IL-10, and INF-γ in serum and IgA in feces of L. casei-OMP16-PEDVS immunized mice, which indicated that L. casei-OMP16-PEDVS candidate vaccine could induce higher levels of humoral immunity, cellular immunity, and mucosal immunity.

Conclusion

Therefore, L. casei-OMP16-PEDVS is a promising candidate vaccine for prophylaxis of PEDV infection.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-021-02885-y.

Keywords: PEDV, Lactobacillus casei vaccine, PEDV S protein, OMP16, Immune responses

Introduction

Porcine epidemic diarrhea (PED) is caused by porcine epidemic diarrhea virus (PEDV) with symptoms including diarrhea, vomiting, anorexia, dehydration, and weight loss in piglets [1, 2]. Pigs of all ages can be infected with different symptoms and the mortality rate in piglets is up to 100% [3], which have led to huge economic losses all around the world. To control the spread of PEDV, most kinds of vaccines are constructed, such as aluminum-hydroxide-adjuvanted inactivated vaccine, bivalent inactivated Transmissible Gastroenteritis Virus (TGEV) and PEDV vaccine, and attenuated PEDV vaccine [4]. Although these vaccines play an important role in controlling PED, they all have their defects. Inactivated vaccines cannot activate cellular immune responses, attenuated vaccine is not very safe, and they all cannot induce sufficient production of virus-specific IgA antibodies of mucosal immune responses. Therefore, it is necessary and urgent to develop a new vaccine to control PED.

Lactobacillus casei is often considered to be a kind of safe vector system for targeted delivery of antigens in oral immunization, with beneficial effects on the health of humans and animals [5]. Meanwhile, it can be used as a delivery system to regulate the T-helper cell response and stimulate the secretion of specific IgAs for mucosal immunity [6]. On the other hand, Lactobacillus casei recombinant vaccine is easier administration, lesser chance of hypersensitivity reaction, and more cost-effective compared with traditional vaccines. Based on the reports, Lactobacillus casei recombinant vaccines have been successfully used in the prevention and control of human papillomavirus, Streptococcus pneumonia, and Escherichia coli [7–9]. There are also some similar attempts in designing of PED vaccines. The researches find that a recombinant Lactococcus lactis strain expressing a variant porcine epidemic diarrhea virus S1 gene could induce high levels of IL-4 and IFN-γ in immunized mice [10]. Lactobacillus casei-based anti-PEDV vaccine expressing microfold cell-targeting peptide Co1 fused with the COE antigen of PEDV could also induce effective immune response [11]. To improve the effectiveness of PEDV vaccine. In this study, we construct a new Lactobacillus casei recombinant vaccine of PED, which can stimulate stronger mucosal, humoural and cellular immune responses against PEDV infection via oral administration.

PEDV, a member of the coronaviridae family, consisted by four structural proteins which contain the 150–220 kDa glycosylated spike (S) protein, the 20–30 kDa membrane (M) protein, the 7 kDa envelope (E) protein, and 58 kDa nucleocapsid (N) protein [12]. Thereinto, the S protein can be divided into S1 (1–735 amino acid) and S2 (736-last amino acid) domains [13], and S1 protein includes the receptor-binding region and the main neutralizing epitopes [14]. Vaccine adjuvant acts as an immunomodulator can induce and enhance immune responses against co-delivered antigens. OMP16 protein of Brucella abortus strain was verified that could activate dendritic cells in vivo, induces a th1 immune response, and was a promising self-adjuvanting vaccine [15–17]. Therefore, OMP16 protein was inserted into the Lactobacillus casei recombinant vaccine in our study.

So far, few studies about the Lactobacillus casei recombinant vaccine of PEDV are reported. Therefore, this study is aimed to construct a novel Lactobacillus casei candidate oral vaccine, which can supply better humoral immunity, cellular immunity, and mucosal immunity to prevent the spread of PED.

Materials and methods

Bacterial strains, viruses, culture conditions, plasmids, and primers

The bacterial strains, plasmids, and primers used in this study are listed in Table 1. The standard reference strain of Lactobacillus casei ATCC 393 was cultured in de Man Rogosa and Sharpe (MRS) broth at 37 °C [18]. The BL21 (DE3) and DH5α were cultured in Luria-Bertani (LB) medium at 37 °C [19]. The recombinant Lactobacillus casei, BL21 (DE3), and DH5α strains were cultured in the corresponding medium with proper antibiotics, respectively. Brucella abortus was grown in Tryptic Soy Broth (TSB) or Tryptic Soy Agar (TSA) medium (Difco Laboratories, Detroit, MI, USA) at 37 °C. The Vero cells infected with PEDV strains were cultured in DMEM (Gibco, Langley, VA, USA) supplemented with 10 μg/mL trypsin (Gibco, Langley, VA, USA) [20]. The pVE5523 and pET28a (+) plasmids were expression vectors of Lactobacillus casei and Escherichia coli, respectively.

Table 1.

Characteristics of bacterial strains, plasmids, and primers used in this study

Strain/plasmid/primer Characteristics and/or sequences Source/reference
Strain
 DH5α Genotype: supE44 ΔlacU169 (φ80lacZ△M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 TaKaRa (Otsu, Japan)
 BL21 Genotype: F-ompT hsdS (rB-mB) gal dcm (DE3) TaKaRa (Otsu, Japan)
 Lactobacillus casei ATCC393, used as a vector system for targeted delivery of antigens in oral immunization. Preserved in our lab
 Brucella abortus Brucella abortus S19, supply gene sequence of omp16 gene Preserved in our lab
 PEDV AJ1102, variant strain, isolated in China. Preserved in our lab
Plasmids
 pET28a (+) The expression vector of Escherichia coli, Kanr Preserved in our lab
 pVE5523 The expression vector of Lactobacillus casei, Ampr BioVector NTCC
 pET28a-PEDVS The recombinant vector of pET28a and S protein of PEDV, Kanr This study
 pET28a-OMP16-PEDVS The recombinant vector of pET28a and fusion protein (S protein of PEDV and OMP16 protein of Brucella abortus), Kanr This study
 pVE5523-OMP16-PEDVS The recombinant vector of pVE5523 and fusion protein (S protein of PEDV and OMP16 protein of Brucella abortus), Ampr This study
Primers
 PEDVS-F1/R1

F1: CCGGAATTCATGCTGAGTCATGAACAGCC

R1: TGCTCTAGATTAATATGCAGCCTGCTCTG

This study
 PEDVS-F2/R2

F2:GGTGGTGGCGGTAGCGGCGGTGGTGGCTCTGGTGGCGGCGGTTCTTTCTTTTGTTACTTTGCCAT

R2: CGCGATATCTTAATATGCAGCCTGCTCTG

This study
 OMP16-F/R

F: CGCGTCGACATGGCGTCAAAGAAGAACCTTCCG

R:AGAACCGCCGCCACCAGAGCCACCACCGCCGCTACCGCCACCACCGGTACCCCGTCCGGCCCCGT

This study

The construction of recombinant Lactobacillus casei and BL21 strains

The recombinant expression plasmids were constructed based on the plasmids and primers in Table 1. At first, the partial sequence of PEDV S gene (493–708 amino acid), the partial sequence of PEDV S’ gene (493–708 amino acid), and the partial sequence of Brucella abortus OMP16 gene (26–168 amino acid) were amplified using primer pairs PEDVS-F1/R1, PEDVS-F2/R2, and OMP16-F/R, respectively. Subsequently, the overlap extension method was used in OMP16 and PEDVS’ fragments to construct a new fragment OMP16-PEDVS with linker polypeptide (GGGGSGGGGSGGGGS) stuck in the middle. Then, the fragments PEDVS was inserted into pET28a plasmid with EcoRI/XbaI restriction enzymes to generate recombinant plasmid pET28a-PEDVS, and the new fragments OMP16-PEDVS was inserted into pET28a and pVE5523 plasmids with EcoRI/XbaI and SalI/EcoRV restriction enzymes to generate recombinant plasmid pET28a-OMP16-PEDVS and pVE5523-OMP16-PEDVS, respectively. The recombinant plasmids (pET28a-PEDVS, pET28a-OMP16-PEDVS, and pVE5523-OMP16-PEDVS) were transformed into BL21 (DE3) or Lactobacillus casei ATCC393 by transformation or electroporation based on the reported paper [21].

Analysis of protein expression by western blot

The protein expression of BL21-pET28a-PEDVS, BL21-pET28a-OMP16-PEDVS, and L. casei-pVE5523-OMP16-PEDVS strains were detected based on the reported method with some modification [21–23]. The recombinant strains BL21-pET28a-PEDVS and BL21-pET28a-OMP16-PEDVS were cultured in LB broth and IPTG was used to harvest to pET28a-PEDVS and pET28a-OMP16-PEDVS proteins. The blank vector was used as a negative control. After cell lysis and centrifugation, the supernatant and sediment were collected. Then, the target proteins were purified using the Nickel affinity chromatography column based on the previous study [24]. Meanwhile, the cultural supernatant of the recombinant L. casei-pVE5523-OMP16-PEDVS strain was also harvested by centrifugation at 9000×g for 10 min at 4 °C. Whereafter, the samples with sodium dodecyl sulfate (SDS) loading buffer were boiled 10 mins. The proteins were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred into PVDF membranes (Millipore, Mississauga, ON, Canada). Membranes were blocked with 5% skimmed milk for 2 h at 37 °C and then incubated with murine monoclonal antibody of S protein overnight at 4 °C and HRP conjugated goat anti-mouse IgG (ABclonal, Wuhan, China) for 2 h at 37 °C. The protein bands were visualized using the Clarity™ Western ECL Blotting Substrate (Bio-Rad, Hercules, CA, USA).

Immunization and sample collection

The immunogenicity of recombinant Lactobacillus casei vaccine was evaluated using six-week-old female specific pathogen-free (SPF) BALB/c mice [10, 18], which were purchased from Shandong Agricultural University animal center. A total of 50 mice were randomly divided into 5 groups with 10 mice in each group. The mice were immuned with recombinant Lactobacillus casei vaccine and purified protein (pET28a-PEDVS, pET28a-OMP16-PEDVS, pET28a-OMP16-PEDVS+Freund’s complete adjuvant), respectively. The immunization protocol was performed based on Table 2 and a booster immunization was given after 13 days.

Table 2.

The immune protocol of BALB/c mice

Grouping Characteristics Immune methods Immunizing dose
L. casei-OMP16-PEDVS Recombinant strain L. casei contains pVE5523-OMP16-PEDVS vector PO 200 μL
BL21-PEDVS pET28a-PEDVS protein IM 200 μg
BL21-OMP16-PEDVS pET28a-OMP16-PEDVS protein IM 200 μg
BL21-OMP16-PEDVS-F pET28a-OMP16-PEDVS protein with Freund’s complete adjuvant IM 200 μg
PBS Negative control IM 200 μL

For the serological study, serum was collected on 0, 14, and 28 days post-immunization (dpi) via tail vein punching and stored at − 20 °C until use. Feces were collected 1 day before vaccination and every boosting time. For IgA detection, feces were diluted (w/v) with 0.05 M sodium EDTA at 1:4 ratios just after collection and incubated for 14 h at 4 °C following proper mixing. The supernatant was collected by 12,000×g centrifugation and preserved at − 20 °C until use. At 28th dpi; three mice from each group were sacrificed and the intestine was processed for IgA detection according to the author described previously [10, 18, 23].

Determination analysis of antibody levels

The levels of IgG in the sera and IgA in the feces were measured by the ELISA methods with some modification [18, 23]. The methods were as follows: Polystyrene microliter plates were coated overnight at 4 °C with 100 μL 10 μg/mL PEDVS protein, OMP16-PEDVS protein, or 100 μL recombinant L. casei-OMP16-PEDVS strain. After blocking with 5% skimmed milk, the collected samples were serially diluted in PBS, added in triplicate, and incubated at 37 °C for 1 h. Then, an HRP conjugated goat anti-mouse IgG or IgA antibody (Invitrogen, USA) was added to each well (1:5000) and incubated for 1 h at 37 °C. The polystyrene microtiter plates were washed 5 times during each step. At last, 100 μL of TMB substrate (tetramethylbenzidine and H2O2) was added to each well and 50 μL of stop solution was added after 10 mins. The OD values at 630 nm were measured using a multimode plate reader (EnVision).

Virus neutralization assays

The neutralizing antibody titers of PEDV in sera were examined according to the methods with some modifications [25, 26]. Briefly, the murine serum was heat-inactivated (56 °C for 30 min) and then serially two-fold diluted in 96 well plates (Corning, USA) with triplicates of each sample. Then, an equal volume of 200 TCID50 / 50 μL PEDV strains were added to 96 well plates and incubated for 1 h at 37 °C. The mixture was added to new 96 well plates coated with Vero cell monolayers and incubated for 1 h at 37 °C. Cells were then washed and incubated in the maintenance medium at 37 °C in 5% CO2. After 2 days, the cytopathic effect (CPE) was observed using an inverted microscope and the neutralizing concentration was defined as the lowest concentration of antibodies in the serum.

Cytokine detection

To detect the secretion of cytokines, supernatants were obtained from the laboratory mice (0, 14, and 28 days). Levels of secreted IL-4, IL-10, and IFN-γ were determined using commercial ELISA kits (Elabscience Biotechnology Co., Ltd., Wuhan) according to the manufacturer’s recommendations, respectively. Cytokine was quantified from the different standard curves prepared from standard reagents provided by the kits respectively and optical density (OD) value was detected at 450 nm from each plate using a multimode plate reader (EnVision) [23, 27].

Statistical analysis

All data were obtained from at least three independent experiments, and results were presented as the means ± standard deviation (SD). The statistical analysis was performed using two-tailed t-tests and one-way analysis in Graph Pad Prism 7.0 (GraphPad Software Inc., USA). The significant difference was defined as ∗ p < 0.05, and the various degrees of significant difference were designated as ∗∗ p < 0.01, ∗∗∗ p < 0.001, respectively.

Results

The verification of recombinant Lactobacillus casei and BL21 strains

To verify the constructed recombinant plasmids, the recombinant expression plasmids pET28a-PEDVS, pET28a-OMP16-PEDVS, and pVE5523-OMP16-PEDVS were digested using NcoI/XhoI restriction enzymes, and the enzyme digestion results were shown in Fig. 1. The sizes of target bands in electrophoretograms were the same as the expected results and sequencing results indicated that the recombinant expression plasmids exhibited no mutation. These results indicated the successful construction of pET28a-PEDVS, pET28a-OMP16-PEDVS, and pVE5523-OMP16-PEDVS recombinant plasmids.

Fig. 1.

Fig. 1

The enzyme digestion results of recombinant plasmids. A: The enzyme digestion results of the pVE5523-OMP16-PEDVS plasmid. M: D8000 DNA Ladder Marker; 1: pVE5523-OMP16-PEDVS plasmid. B: The enzyme digestion results of pet28a-OMP16-PEDVS and pET28a-PEDVS plasmid. M: D8000 DNA Ladder Marker; 1: pet28a-OMP16-PEDVS plasmid; 2: pET28a-PEDVS plasmid

The results of western blot showed that the recombinant proteins pET28a-OMP16-PEDVS and pET28a-PEDVS were expressed in the supernatant of BL21-pET28a-OMP16-PEDVS and BL21-pET28a-PEDVS strains, respectively. The pVE5523-OMP16-PEDVS protein was also verified in the cultural supernatant of L. casei-pVE5523-OMP16-PEDVS strain. The specific bands from Fig. 2 showed that the recombinant proteins pET28a-OMP16-PEDVS, pVE5523-OMP16-PEDVS, and pET28a-PEDVS were all harvested successfully (Fig. 2).

Fig. 2.

Fig. 2

The verification of recombinant expression proteins. M: protein marker; 1: the secretory protein form recombinant L. casei-pVE5523-OMP16-PEDVS strain; 2: the purified protein from BL21-pET28a-OMP16-PEDVS strain; 3: the purified protein from BL21-pET28a-PEDVS strain

The IgG antibody levels in serum of mice immunized with candidate vaccines

To evaluate the specific immunogenicity of generated vaccine candidates, BALB/c mice were selected and divided into 5 groups. Then, the levels of IgG in the serum and IgA in the feces were measured with commercial ELISA kits. The results revealed that there were no substantial differences for IgG levels among the vaccinated groups and almost no IgG antibody was found in all mice before immunization. However, substantial differences were subsequently found after the first vaccination and IgG antibody levels in serum of 28 days were obviously higher than that of in 14 days. Among 5 group mice, the mice immunized with L. casei-OMP16-PEDVS and BL21-OMP16-PEDVS-F showed similar and highest immunogenicity. Therefore, L. casei-OMP16-PEDVS and BL21-OMP16-PEDVS-F could produce highest immunogenicity, followed by BL21-OMP16-PEDVS and BL21-PEDVS (Fig. 3).

Fig. 3.

Fig. 3

The IgG antibody levels of candidate vaccines in the serum of immunized mice. Serum was collected on days 0, 14, and 28 days before or after immunization and examined via commercial ELISA kits and measured at an absorbance of 450 nm. Bars represent the mean ± standard deviation of three independent experiments. * p < 0.05, ** p < 0.01, and **** p < 0.0001 represent increasing degrees of significant differences, respectively, and ns means no significant difference

The IgA antibody levels in feces of mice immunized with candidate vaccines

To evaluate the specific immunogenicity of generated vaccine candidates, the levels of IgA antibody in feces of mice were also evaluated. The results showed that there was no special anti-PEDVS IgA antibody existed before immunization. However, large amounts of IgA antibody in feces of L. casei-OMP16-PEDVS immunized mice were detected and it was obviously higher than that of in BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS group mice at 14 days after immunization. At 28 days after immunization, the IgA antibody levels of L. casei-OMP16-PEDVS immunized mice reached its highest maximum. Meanwhile, the IgA antibody levels in the other three groups did not present an obvious increase. Therefore, the candidate vaccine L. casei-OMP16-PEDVS could stimulate higher levels of antibody in immunized mice compared with BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS immunized mice (Fig. 4).

Fig. 4.

Fig. 4

The IgA antibody levels of candidate vaccines in feces of immunized mice. Feces were collected on day 0, 14, and 28 days before or after immunization and examined via commercial ELISA kits and measured at an absorbance of 450 nm. Bars represent the mean ± standard deviation of three independent experiments. * p < 0.05, ** p < 0.01, and **** p < 0.0001 represent increasing degrees of significant differences, respectively, and ns means no significant difference

The neutralizing antibody levels of serum in immunized mice

To evaluate the protective effect of candidate vaccines of L. casei-OMP16-PEDVS, BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS in mice, the neutralizing antibody levels were measured. Results showed that no neutralizing antibody was detected before immunization. Neutralizing antibody was detected at 14 days after immunization and it increased at 14 days after booster immunization. The antibody response in mice that received L. casei-OMP16-PEDVS possessed a stronger anti-PEDV neutralizing activity than that in mice orally administered with BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS. Therefore, the candidate vaccine L. casei-OMP16-PEDVS could stimulate highest neutralizing antibody level, followed by BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS (Fig. 5).

Fig. 5.

Fig. 5

The neutralizing antibody levels of candidate vaccines in the serum of immunized mice. Serum was collected on days 0, 14, and 28 days before or after immunization and examined via neutralization test. Bars represent the mean ± standard deviation of three independent experiments. * p < 0.05, ** p < 0.01, and **** p < 0.0001 represent increasing degrees of significant differences, respectively, and ns means no significant difference

Cytokine levels

To compare the cellular immune response level of L. casei-OMP16-PEDVS, BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS immunized mice, IL-4, IL-10, and IFN-γ were determined, respectively. The results showed that the levels of cytokines IL-4, IL-10, and IFN-γ in the sera of mice were all very low and have no significant difference before immunization. Whereas, similar changes were observed in the results of IL-4, IL-10, and IFN-γ. At 14 days after immunization, the level of IL-4, IL-10, and IFN-γ in L. casei-OMP16-PEDVS immunized mice were higher than BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS immunized mice. At 14 days after the booster immunization, a higher IL-4, IL-10, and IFN-γ level in L. casei-OMP16-PEDVS immunized mice were detected compared with that of in other three groups. Therefore, the candidate vaccine L. casei-OMP16-PEDVS could stimulate highest IL-4, IL-10, and IFN-γ level, followed by BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS (Fig. 6).

Fig. 6.

Fig. 6

Detection of cytokine levels from the serum of immunized mice. Serum was collected on days 0, 14, and 28 days before or after immunization and examined via commercial ELISA kits. The absorbance value was measured at an absorbance of 450 nm for IL-4 (a), IL-10 (b), and IFN-γ (c), respectively. Bars represent the mean ± standard deviation of three independent experiments. * p < 0.05, ** p < 0.01, and **** p < 0.0001 represent increasing degrees of significant differences, respectively

Discussion

Since a large-scale outbreak of PED that caused by PEDV variants occurred in October 2010, which has resulted in tremendous economic losses in China and all around the world [1]. However, traditional vaccines are all designed based on CV777 classical strain which cannot supply sufficient protection to PEDV variant [4]. To control the spread of PEDV and reduce the economic losses, novel vaccines of PEDV variant strains are also designed. At present, PEDV inactivated vaccine and attenuated vaccine of PEDV variant strains are all approved by Chinese government and there are all exhibiting promising prospects in controlling PED. But defects are also existed in the two kinds of novel vaccines. PEDV infects swine through the digestive tract and has intestinal tissue tropism. Therefore, Mucosal immunity is more effective than systemic immunity in preventing PEDV entry into intestinal epithelial cells, and vaccines must provide mucosal protection effectively in the intestinal tract. So, In this study, we construct a new kind of vaccine which can stimulate stronger anti-PEDV-specific IgG and sIgA antibodies.

Lactobacillus casei has potential immune-modulatory properties as a vaccine delivery vehicle and the expression of bioactive compounds on the cell wall of this bacterium can stimulate appropriate immune responses [28, 29]. It is widely used for expressing several heterologous antigens of human papillomavirus, Streptococcus pneumonia, and Escherichia coli as vaccines in animal models, which all showed excellent immunogenicity [7–9]. Compared with the inactivated vaccine and attenuated vaccine, the Lactobacillus casei vector vaccine can also stimulate higher IgA level and cellular immune response. Studies have shown that IgA’s first line of defense in the intestine would be better than IgG in protecting piglets from PEDV infection [10, 30]. Therefore, it is promising to develop a kind of Lactobacillus casei vector vaccine of PED.

Based on the reports, the S protein of PEDV can be divided into S1 (1–735 amino acid) and S2 (736-last amino acid) domains [13], and S1 protein includes the receptor-binding region and the main neutralizing epitopes [14]. The core neutralizing epitope (COE) can induce strong neutralizing antibodies against PEDV [31, 32]. Combining with the antigenicity analysis, a partial sequence of the S1 gene (1477–2124 bp) was selected to construct the recombinant plasmid. The selected small fragment was proved that not only had good immunogenicity but also contributed to the secreted expression of Lactobacillus casei. On the other hand, Pasquevich found that Brucella abortus outer membrane protein 16 could activate dendritic cells in vivo, induces a th1 immune response, and was a promising self-adjuvanting vaccine against systemic and oral acquired brucellosis [15]. Similar research that unlipidated outer membrane protein omp16 from Brucella spp. as nasal adjuvant could induce a th1 immune response and modulates the th2 allergic response to cow’s milk proteins was also proved [16]. Therefore, a partial sequence of the omp16 gene was chosen to construct recombinant plasmid to enhance to immune function in our study.

To know whether the novel Lactobacillus casei recombinant vaccine could induce humoral immune responses, the IgG, IgA, and neutralizing antibody levels were measured. The IgG antibody level of L. casei-OMP16-PEDVS recombinant vaccine immunized mice had no significant difference with BL21-OMP16-PEDVS-F recombinant vaccine immunized mice. But the IgA and neutralizing antibody levels were obviously higher than that of in BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS recombinant vaccine immunized mice. The results showed that L. casei-OMP16-PEDVS could induce stronger humoral immune responses, especially IgA antibody level. Studies have shown that IgA was the first line of defense in the intestine and would be better than IgG in protecting piglets from PEDV infection [30]. The research also verified the result that L. casei-OMP16-PEDVS recombinant vaccine could supply better immunological protection to PEDV.

To explore the type of immune response induced by recombinant L. casei-OMP16-PEDVS, the levels of IL-4, IL-10, and IFN-γ were detected to evaluate the activity of T lymphocytes. Based on the report, IFN-γ plays an important role in cellular immune response caused when pathogens invade the body, IL-4 plays an important role in the humoral immune response and promoting immune tolerance and mucosal immunity [33], IL-10 plays essential roles in fighting against mucosal microbial infection and maintaining mucosal barrier integrity within the intestine [34]. Meanwhile, results of cytokine detection showed that the mice immunized with L. casei-OMP16-PEDVS recombinant vaccine could induce stronger expression of IL-4, IL-10, and IFN-γ, which supported the results that L. casei-OMP16-PEDVS recombinant vaccine could induce stronger humoral immune response, IgA antibody level, and cellular immune response, respectively.

Conclusion

In summary, L. casei-OMP16-PEDVS, BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS candidate vaccines were constructed in this study. Meanwhile, the humoral immune response and cellular immune response levels of these candidate vaccines in mice were evaluated. The results showed that the mice immunized with L. casei-OMP16-PEDVS could produce higher levels of IgG, IgA, neutralizing antibody, IL-4, IL-10, and INF-γ compared with the mice immunized with BL21-OMP16-PEDVS-F, BL21-OMP16-PEDVS, and BL21-PEDVS. Therefore, the recombinant L. casei-OMP16-PEDVS candidate vaccine may establish the ground for the development of a safe, effective, and convenient recombinant mucosal vaccine for prophylaxis of PEDV infection.

Supplementary Information

Additional file 1. (31.8KB, docx)

Statement

The study was carried out in compliance with the arrive guidelines.

Authors’ contributions

Conceptualization, Xiaowen Li and Jing Ren; Data curation, Xiaowen Li and Bingzhou Zhang; Formal analysis, Bingzhou Zhang and Dasheng Zhang; Funding acquisition, Sidang Liu and Jing Ren; Investigation, Xiaowen Li and Dasheng Zhang; Methodology, Xiaowen Li, Bingzhou Zhang and Dasheng Zhang; Project administration, Sidang Liu; Resources, Dasheng Zhang, Sidang Liu and Jing Ren; Software, Bingzhou Zhang; Supervision, Sidang Liu and Jing Ren; Validation, Xiaowen Li and Jing Ren; Visualization, Xiaowen Li; Writing – original draft, Bingzhou Zhang; Writing – review & editing, Bingzhou Zhang. The authors read and approved the final manuscript.

Funding

This research was supported by New Hope Group Science and Technology Leading 100-person Program Fund (No. NH201806), National Natural Science Foundation Of China (NSFC) (No. 31701424), and Shandong Provincial Key Laboratory Open Fund (No. SD2019BP002).

Declarations

Ethics approval and consent to participate

In the present study, all the experimental methodology on animals were performed in strict accordance with the guideline for experimental animals approved by the Ethics Committee of the Faculty of Veterinary Medicine, Shandong Agricultural University, China. All procedures followed the instruction of the care and use of laboratory animals provided by Shandong provincial public service facilities. The authors state their agreement to publication ethics. This study does not include any experiment performed on human participants.

Consent for publication

The authors have agreed to publish all the identifiable images and identifiers in the paper.

Availability of data and materials: All data generated or analysed during this study are included in this published article and its supplementary information files.

Competing interests

The authors have declared that no competing financial interests exist.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xiaowen Li and Bingzhou Zhang are co-first author and contributed equally to this article

Contributor Information

Sidang Liu, Email: liusid@sdau.edu.cn.

Jing Ren, Email: renjing879@163.com.

References

  • 1.Wang D, Fang L, S X. Porcine epidemic diarrhea in China. Virus Res. 2016;226:7–13. doi: 10.1016/j.virusres.2016.05.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sueyoshi M, Tsuda T, Yamazaki K, Yoshida K, Nakazawa M, Sato K, Minami T, Iwashita K, Watanabe M, Suzuki Y. An immunohistochemical investigation of porcine epidemic diarrhoea. J Comp Pathol. 1995;113(1):59–67. doi: 10.1016/S0021-9975(05)80069-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sun RQ, Cai RJ, Chen YQ, Liang PS, Song CXJEID. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis. 2012;18(1):161–163. doi: 10.3201/eid1801.111259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tong YE, Feng L, Li W. Development of bi-combined attenuated vaccine against transmissible gastroenteritis virus and porcine epidemic diarrhea virus. Chin J Prev Vet Med. 1999;21(6):35–39. [Google Scholar]
  • 5.Pouwels PH, Leer RJ, Boersma WJ. The potential of Lactobacillus as a carrier for oral immunization: development and preliminary characterization of vector systems for targeted delivery of antigens. J Biotechnol. 1996;44(1–3):183. doi: 10.1016/0168-1656(95)00140-9. [DOI] [PubMed] [Google Scholar]
  • 6.Tsai YT, Cheng PC, Pan TM. Biotechnology: The immunomodulatory effects of lactic acid bacteria for improving immune functions and benefits. Appl Microbiol Biotechnol. 2012;96(4):853–862. doi: 10.1007/s00253-012-4407-3. [DOI] [PubMed] [Google Scholar]
  • 7.Adachi K, Kawana K, Yokoyama T, Fujii T, Tomio A, Miura S, Tomio K, Kojima S, Oda K, Sewaki TJV. Oral immunization with a Lactobacillus casei vaccine expressing human papillomavirus (HPV) type 16 E7 is an effective strategy to induce mucosal cytotoxic lymphocytes against HPV16 E7. Vaccine. 2010;28(16):2810–2817. doi: 10.1016/j.vaccine.2010.02.005. [DOI] [PubMed] [Google Scholar]
  • 8.Campos IB, Darrieux M, Ferreira DM, Miyaji EN, Silva DA, Arêas APM, Aires KA, LCC L, Ho PL, MLSJM O, et al. Nasal immunization of mice with Lactobacillus casei expressing the Pneumococcal Surface Protein A: induction of antibodies, complement deposition and partial protection against Streptococcus pneumoniae challenge. Microbes Infect. 2008;10(5):481–488. doi: 10.1016/j.micinf.2008.01.007. [DOI] [PubMed] [Google Scholar]
  • 9.Wen LJ, Hou XL, Wang GH, Yu LY, Wei XM, Liu JK, Liu Q, Wei CHJV. Immunization with recombinant Lactobacillus casei strains producing K99, K88 fimbrial protein protects mice against enterotoxigenic Escherichia coli. Vaccine. 2012;30(22):3339–3349. doi: 10.1016/j.vaccine.2011.08.036. [DOI] [PubMed] [Google Scholar]
  • 10.Guo M, Yi S, Guo Y, Zhang S, Niu J, Wang K, G H. Construction of a recombinant lactococcus lactis strain expressing a variant porcine epidemic diarrhea virus S1 gene and its immunogenicity analysis in mice. Viral Immunol. 2019;32(3):144–150. doi: 10.1089/vim.2018.0108. [DOI] [PubMed] [Google Scholar]
  • 11.Wang X, Wang L, Zheng D. Oral immunization with a Lactobacillus casei-based anti-porcine epidemic diarrhea virus (PEDV) vaccine expressing microfold cell-targeting peptide Co1 fused with the COE antigen of PEDV. J Appl Microbiol. 2017;124(2):368–378. doi: 10.1111/jam.13652. [DOI] [PubMed] [Google Scholar]
  • 12.Duarte M, Tobler K, Bridgen A, Rasschaert D, Ackermann M, H L. Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology. 1994;198(2):466. doi: 10.1006/viro.1994.1058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lee DK, Park CK, Kim SH, Lee C. Heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in Korea. Virus Res. 2010;149(2):175–182. doi: 10.1016/j.virusres.2010.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sun DB, Feng L, Shi HY, Chen JF, Liu SW, Chen HY, Wang YF. Spike protein region (aa 636789) of porcine epidemic diarrhea virus is essential for induction of neutralizing antibodies. Acta Virol. 2007;51(3):149–156. [PubMed] [Google Scholar]
  • 15.Pasquevich KA, Garcia Samartino C, Coria LM, Estein SM, Zwerdling A, Ibanez AE, Barrionuevo P, Oliveira FSD, Carvalho NB, Borkowski J. The protein moiety of Brucella abortus outer membrane protein 16 is a new bacterial pathogen-associated molecular pattern that activates dendritic cells in vivo, induces a Th1 immune response, and is a promising self-adjuvanting vaccine against systemic and oral acquired brucellosis. J Immunol. 2010;184(9):5200. doi: 10.4049/jimmunol.0902209. [DOI] [PubMed] [Google Scholar]
  • 16.Ibanez AE, Smaldini P, Coria LM, Delpino MV, Pacífico LGG, Oliveira SC, Risso GS, Pasquevich KA, Fossati CA, Giambartolomei GH. Unlipidated outer membrane protein Omp16 (U-Omp16) from Brucella spp. as nasal adjuvant induces a Th1 immune response and modulates the Th2 allergic response to cow’s milk proteins. PLoS One. 2013;8(7):e69438. doi: 10.1371/journal.pone.0069438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pasquevich KA, Estein SM, Samartino CG, Zwerdling A, Coria LM, Barrionuevo P, Fossati CA, Giambartolomei GH, Cassataro J. Immunity: immunization with recombinant Brucella species outer membrane protein Omp16 or Omp19 in adjuvant induces specific CD4+ and CD8+ T cells as well as systemic and oral protection against Brucella abortus infection. Infect Immun. 2009;77(1):436–445. doi: 10.1128/IAI.01151-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ma S, Wang L, Huang X, Wang X, Chen S, Shi W, Qiao X, Jiang Y, Tang L, Xu Y. Oral recombinant Lactobacillus vaccine targeting the intestinal microfold cells and dendritic cells for delivering the core neutralizing epitope of porcine epidemic diarrhea virus. Microb Cell Factories. 2018;17(1):20. doi: 10.1186/s12934-018-0861-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chu S, Zhang D, Wang D, Zhi Y, Zhou P. Heterologous expression and biochemical characterization of assimilatory nitrate and nitrite reductase reveals adaption and potential of Bacillus megaterium NCT-2 in secondary salinization soil. Int J Biol Macromol. 2017;101:1019. doi: 10.1016/j.ijbiomac.2017.04.009. [DOI] [PubMed] [Google Scholar]
  • 20.Guo N, Zhang B, Hu H, Ye S, Chen F, Li Z, Chen P, Wang C, He Q. Caerin1.1 suppresses the growth of porcine epidemic diarrhea virus in vitro via direct binding to the virus. Viruses. 2018;10:9. doi: 10.3390/v10090507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen Z, Lin J, Ma C, Zhao S, She Q, Liang Y. Biotechnology: characterization of pMC11, a plasmid with dual origins of replication isolated from Lactobacillus casei MCJ and construction of shuttle vectors with each replicon. Appl Microbiol Biotechnol. 2014;98(13):5977. doi: 10.1007/s00253-014-5649-z. [DOI] [PubMed] [Google Scholar]
  • 22.Xiaona W, Li W, Xuewei H, Sunting M, Meiling Y, Wen S, Xinyuan Q, Lijie T, Yigang X, Yijing L. Oral Delivery of Probiotics Expressing Dendritic Cell-Targeting Peptide Fused with Porcine Epidemic Diarrhea Virus COE Antigen: A Promising Vaccine Strategy against PEDV. Viruses. 2017;9(11):312. doi: 10.3390/v9110312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bhuyan AA, Memon AM, Bhuiyan AA, Zhonghua L, Zhang B, Ye S, Mengying L, He QG. The construction of recombinant Lactobacillus casei expressing BVDV E2 protein and its immune response in mice. J Biotechnol. 2018;270:51–60. doi: 10.1016/j.jbiotec.2018.01.016. [DOI] [PubMed] [Google Scholar]
  • 24.Noi NV, Chung YCJB, Equipment B. Optimization of expression and purification of recombinant S1 domain of the porcine epidemic diarrhea virus spike (PEDV- S1) protein in Escherichia coli. Biotechnol Biotechnol Equip. 2017;31(2):1–11. [Google Scholar]
  • 25.Li C, Li W, Esesarte E, Guo H, Elzen P, Aarts E, Born E, Rottier P, Bosch BJ. Cell attachment domains of the porcine epidemic diarrhea virus spike protein are key targets of neutralizing antibodies. J Virol. 2017;91(12):1–16. doi: 10.1186/s12985-016-0669-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wen Z, Xu Z, Zhou Q, Li W, Wu Y, Du Y, Chen L, Zhang Y, Xue C, Cao Y. Oral administration of coated PEDV-loaded microspheres elicited PEDV-specific immunity in weaned piglets. Vaccine. 2019;09(014):161–166. doi: 10.1016/j.vaccine.2018.09.014. [DOI] [PubMed] [Google Scholar]
  • 27.Gao Q, Zhao S, Qin T, Yin Y, Yang Q. Effects of porcine epidemic diarrhea virus on porcine monocyte-derived dendritic cells and intestinal dendritic cells. Vet Microbiol. 2016;106:149–158. doi: 10.1016/j.rvsc.2016.03.023. [DOI] [PubMed] [Google Scholar]
  • 28.Bonet MEB, Chaves AS, Mesón O. Immunomodulatory and anti-inflammatory activity induced by oral administration of a probiotic strain of lactobacillus casei. Inflammation. 2006;4(1):31–41. [Google Scholar]
  • 29.Grangette C, Müller-Alouf H, Geoffroy MC, Goudercourt D, Turneer M, Mercenier A. Protection against tetanus toxin after intragastric administration of two recombinant lactic acid bacteria: impact of strain viability and in vivo persistence. Vaccine. 2002;20(27–28):3304–3309. doi: 10.1016/S0264-410X(02)00301-8. [DOI] [PubMed] [Google Scholar]
  • 30.Song DS, Oh JS, Kang BK, Yang JS, Moon HJ, Yoo HS, Jang YS, Park BK. Oral efficacy of Vero cell attenuated porcine epidemic diarrhea virus DR13 strain. Res Vet Sci. 2007;82(1):134–140. doi: 10.1016/j.rvsc.2006.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Makadiya N, Brownlie R, Jan V, Berube N, Allan B, Gerdts V, Zakhartchouk AJVJ. S1 domain of the porcine epidemic diarrhea virus spike protein as a vaccine antigen. Virol J. 2016;13:1. doi: 10.1186/s12985-016-0512-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chang SH, Bae JL, Kang TJ, Ju K, Chung GH, Lim CW, Laude H, Yang MS, Jang YS. Cells: Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol Cell. 2002;14(2):295–299. [PubMed] [Google Scholar]
  • 33.Sumi T, Fukushima A, Fukuda K, Kumagai N, Nishida T, Yagita H, Ueno HJIL. Differential contributions of B7–1 and B7–2 to the development of murine experimental allergic conjunctivitis. Immunol Lett. 2007;108(1):62–67. doi: 10.1016/j.imlet.2006.10.003. [DOI] [PubMed] [Google Scholar]
  • 34.Xue M, Zhao J, Ying L, Fu F, Li L, Ma Y, Shi H, Zhang J, Feng L, Liu PJAR. IL-22 suppresses the infection of porcine enteric coronaviruses and rotavirus by activating STAT3 signal pathway. Antivir Res. 2017;142:68–75. doi: 10.1016/j.antiviral.2017.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1. (31.8KB, docx)

Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES