Association of MALAT1 expression in gastric carcinoma and the significance of its clinicopathologic features in an Iranian patient

Abstract

Aim:

The aim of this study was to evaluate the expression of MALAT1 and the relationship between its expression with clinical characteristics in an Iranian gastric cancer patient.

Background:

Long non-coding RNAs (LncRNAs) play critical roles in the initiation and development of gastric cancer. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA and plays key roles in various types of human cancer. However, our understanding of the role of lncRNAs in the occurrence and development of gastric cancer is not fully clear.

Methods:

This cross-sectional study was performed on 41 gastric tumor tissue samples with matched normal adjacent tumor tissues. The RNA level of lncRNA MALAT1 gene was assessed using quantitative Real-time polymerase chain reaction. B2M was used as an internal control. The 2 ^-ΔΔCq method was adopted to determine expression fold changes.

Results

A significant association was observed between the levels of MALAT1 in gastric tumor tissues compared with normal adjacent tissues (mean= 1.558, p= 0.014). In addition, clinicopathologic data on MALAT1 RNA expression levels in gastric cancer tissues was evaluated. No significant association was observed between the relative expression of MALAT1 and the stage, grade, H. pylori infection, and tumor size groups among gastric cancer patients (p= 0.82, p= 0.904, p= 0.407, and p= 0.701, respectively).

Conclusion:

The current results showed that MALAT1 has a significant association in gastric cancer. The expression of MALAT1 may be used as a diagnostic biomarker for monitoring gastric cancer patients.

Introduction

Gastric cancer (GC) is the second common malignant tumor leading to mortality among cancers worldwide. Whereas the occurrence trend of GC has fallen in most parts of the world, the impact of GC on public health and burden of disease still remains (1). GC is a heterogeneous disease with complicated mechanisms and geographical differences in prevalence and with which patient outcome is difficult to predict (2, 3). Helicobacter pylori (H. pylori) is known as an environmental risk factor for GC; genetic, epigenetic modifications, and various signaling pathways have been reported to contribute to the progress and development of GC (4, 5). To better recognize the pathogenesis of GC and detect more actual biomarkers in predicting prognosis and response to treatment, further investigation is required into all aspects of the disease. Long noncoding RNAs (lncRNAs) represent a class of noncoding RNAs (longer than 200 nucleotides) involved in gene regulation by molecular mechanisms, cell homeostasis, and cell fate (6). Long non-coding RNAs (lncRNAs) have received much attention as tumor biomarkers for early detection, prognosis, and responses to drug treatment in the past several years (7). To date, many studies on lncRNAs have focused on the underlying results and mechanisms of them and their potential as prognostic and diagnostic markers (4, 7-12). However, our understanding about the role of lncRNAs in the occurrence and development of GC is rather incomplete. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA and plays important roles in various types of human cancer, such as regulating pre-messenger RNA splicing, histone modification enzymes, and transcription factors (13). According to a previous functional study, the knock-down of MALAT1 in animal experiments led to the inhibition of migration, cell proliferation, and MALAT1 downregulation entailing a lower expression of genes such as β-catenin, EMT, EZH2, Lin28, and OCT4 (14). Increasingly, studies have showed that MALAT1 genes are overexpressed and associated with the occurrence and development of GC (15). Chemotherapy-resistant gastric cancer cells show silencing of MALAT1 inhibited chemo-induced autophagy by acting as a ceRNA for miR-23b-3p (16). According to our two previous studies, the methylation frequency of MALAT1 promoter methylation was significantly higher in colon lesions than in rectum lesions, and a significant association was observed between the expression of MALAT1 and different polyp types and numbers of polyps. A correlation was also observed between the levels of MALAT1 and p53 in neoplasm tissues (17, 18). The aim of this study was to evaluate the expression of MALAT1 and the relationship between its expression and clinical characteristics in an Iranian GC patient to gain further knowledge of the diagnostic and prognostic value of MALAT1.

Methods

Patients

In this case-control study, 41 gastric tumor tissue samples with matched normal tissues adjacent to the tumor were obtained from patients who underwent surgical resection at Imam Reza Hospital, Tehran, Iran, between January 2016 and April 2018. Histopathological surgical specimens were confirmed following evaluation by a pathologist. The participants had Iranian ethnicity and provided written informed consent for participation in the present study prior to the sampling procedure. Detailed information is provided on the clinicopathological parameters, including age, sex, tumor grade, tumor stage, tumor size, and H. pylori infection. The tumor stage was determined using the American Joint Committee on Cancer Staging Manual (7th edition) (19). This study was approved by the Ethics Committee of the Research Center for Cancer Screening and Epidemiology, AJA University of Medical Sciences, Tehran, Iran (IR.AJAUMS.REC.1398.128). The tissue samples were frozen in liquid nitrogen immediately following removal, and were stored at 80 ˚C.

RNA extraction and cDNA synthesis

Total RNA was extracted from the tumor samples of the patients using the Total RNA extraction mini kit (Favorgen, Cat No. FABRK001, Iran). RNA concentration was quantified by a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies), and its quality was measured by the A260/A280 and A260/A230 ratio. The concentrations of the samples were normalized, and 1 μg of total RNA was reverse-transcribed to cDNA using the RevertAid RT kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

Quantitative real-time PCR analysis

qPCR was performed using a PCR cycler (Rotor-Gene Q MDx; Qiagen GmbH). cDNA fragments were used as templates to amplify the MALAT1 and B2M genes through SYBR® Premix Ex Taq™ (Takara Bio, Inc.), according to the manufacturer's protocols. The experimental protocol was performed as follows: i) Thermocycling conditions consisted of an initial activation step for 30 sec at 94 ˚C, 35 cycles at 94 ˚C for 5 sec, and 60 ˚C for 35 sec; and ii) melting curve analysis. The primer sequences of the qPCR are listed in Table 1. The 2^{- ΔΔCq} method was adopted to determine expression fold changes (patient vs. normal).

Table 1.

Primer sequences used for Real-time PCR

Primer name		Sequence (5’–>3’)	GC%	Tm	Reference
MALAT1	Forward	GGTAACGATGGTGTCGAGGTC	57.14	60	(18)
	Reverse	CCAGCATTACAGTTCTTGAACATG	41.67
β2M	Forward	TGCTGTCTCCATGTTTGATGTATCT	40	60	(18)
	Reverse	CTCTGCTCCCCACCTCTAAGT	57.1

Statistical analysis

Statistical analysis was carried out using SPSS 21 (IBM Corp., USA), and data was plotted via GraphPad Prism (v.5.04; GraphPad Software, Inc.). Significance was set at p<0.05 using the paired t-test.

Results

General statistical information

The study population comprised 41 patients with the diagnosis of gastric cancer. Thirty-four patients (82.9%) were male, 7 (17.1%) were smokers, and the mean age of the study group was 60.32 ± 14.185 years. All patients tested negative for an alcohol habit. Among the patients, 23 (56.1%) were positive for H. pylori infection. In addition, 4 (9.8%) patients were positive for lymphatic invasion, and 34 patients (82.9%) were negative. The tumor grade of 3, 16, and 22 patients was determined to be I, II, and III, respectively, and 4 (9.8%) patients presented with tumor stage I, 22 (53.7%) with tumor stage III, and 15 (36.6%) with the higher stage IV. In 16 (39.0%) gastric tumors, the size of the tumor was ≤ 5 cm and 20 (48.8 %) had a tumor size of >5. No treatment had been initiated for gastric cancer patients recruited in the current study. Demographic characteristics of the patients are detailed in Table 2.

Table 2.

Demographic variables of the study population

Variable	Patients
	Frequency	Percentage
Gender
Male	34	82.9%
Female	7	17.1%
Smoking
No	34	82.9%
Yes	7	17.1%
H. pylori infection
No	18	43.9%
Yes	23	56.1%
Lymphatic invasion
Negative	34	82.9%
Positive	4	9.8%
Stage
I	4	9.8%
III	22	53.7%
IV	15	36.6%
Grade
I	3	7.3%
II	16	39%
III	22	53.7%
Tumor size
›5 cm	20	48.8%
‹5 cm	16	39%

Lack of associations between the expression of MALAT1 and clinical characteristics

Expression of lncRNAs MALAT1 in the tumor tissue samples

To explore the role of lncRNAs MALAT1 in GC tissue, expression levels were quantified in tumor tissues compared with healthy adjacent tissues. The qRT-PCR results showed that MALAT1 expression was significantly upregulated in GC tissues compared with adjacent normal tissues (mean= 1.558, p= 0.014) (Fig 1).

Figure 1.

Real-time quantitative PCR analysis of MALAT1 expression in gastric tissue; GC, gastric cancer; (*p< 0.05) (**p< 0.01) (***p< 0.001)

The role of lncRNA MALAT1 in gastric cancer was further evaluated through investigation into the associations between the RNA levels of the gene and several clinicopathological features, including tumor stage, grade, size, and H. pylori infection.

The relative expression of MALAT1 demonstrated no statistically significant difference between stage I & III and IV, grade I & II and III, H. pylori infection positive & negative, and size <5 & >5 cm groups among GC patients (p= 0.82, p= 0.904, p= 0.407, and p= 0.701, respectively) (Fig. 2A-D).

Figure 2.

Relative RNA expression between the MALAT1 gene and different clinicopathologic variables, including I&III and IV, grades I&II and III, H. pylori infection positive & negative, and tumor size <5 & >5 cm (p > 0.05)

Characteristics MALAT1 as predictive GC-related biomarkers

To investigate the characteristics of MALAT1 as potential biomarkers for GC, the receiver operating characteristics (ROC) curves and the area under the ROC curves (AUC) were performed on 41 UC patients and adjacent healthy controls. The ROC curve showed an area under the curve of 0.7297 (95% CI: 0.6128-0.8467; p= 0.0007) (Fig. 3) (Table 3).

Figure 3.

Receiver-operating characteristic (ROC) curves of normalized MALAT1 to distinguish GC patient tissue from normal tissue. The area under the curve (AUC) was determined for MALAT1

Table 3.

Diagnosis values of MALAT1 of GC patient and healthy control tissues

Variable	MALAT1
Cut-off	1.283
Specificity	62.16%
Sensitivity	72.97%
Area	0.7297
%95 CI	0.6128-0.8467

Discussion

Despite advances in medicine and life science, GC remains a worldwide public health concern (20). Thus, it is essential to explore novel effective molecular mechanisms of GC progression for tumorigenesis prevention or improvement of survival rates. Accumulating evidence demonstrates that aberrantly expressed lncRNAs are implicated in GC tumorigenesis and progression; these lncRNAs are involved in numerous cell signal pathways and act as either tumor suppressors or oncogenes (7, 11, 12).

MALAT1, also called nuclear transcript 2, is a long intergenic non-coding RNA (lincRNA)> ~7 kb long, located on chromosome 11q13, and the MALAT1 sequence is strongly conserved during evolution among

species, which predicts the potentially important biological function of MALAT1 (21).

MALAT1 was first identified in 2003 as significantly associated with early-stage lung cancer metastasis (NSCLC), and hence was suggested as a prognostic marker for NSCLC stage I (22). Aberrant expression and multiple biological functions of MALAT1 have been reported in various cancer types (23-28). In addition, increased MALAT1 expression contributes to brain metastasis by promoting epithelial mesenchymal transition (29). In HepG2 cells, the relationship between MALAT1 and Oct4 has shown that MALAT1 suppression significantly decreases the expression levels of transcription factor Oct4, indicating that MALAT1 could promote the stem-like properties of liver cancer cells (28). Undoubtedly, the activity of MALAT1 in the gastrointestinal cancer system requires extensive attention.

In the current study, a significant association was found between MALAT1 RNA levels in GC tissues. However, clinicopathologic data compared with MALAT1 expression levels in GC tissues showed no significant association.

In recent years, interest in the MALAT1 gene has been increasing. MALAT1 is a chief lncRNA which is upregulated in various types of prostate, lung, ovarian, gastric, and colorectal cancer (15, 18, 30-32). Similar to previous studies, the current research found that MALAT1 expression was significantly upregulated in GC tissues when compared with adjacent normal tissues, but no significant association was found between MALAT1 and clinicopathologic features. The findings of the current study, however, are inconsistent with those of Li et al. (2017), who reported that MALAT1 overexpression is positively correlated with TNM stage (33). Li et al. Also found that MALAT1 level was significantly increased in GC tissues at the Ⅲ+Ⅳ stage when compared with the Ⅰ+Ⅱ stage (30). A recent clinical study showed that MALAT1 was associated with colorectal cancer and its high expression may lead to a poor prognosis in patients with stage II/III CRC (34). In gastric cancer, high MALAT1 expression levels have been reported to promote development and metastasis (35). MALAT1 is also shown to have been upregulated in hepatocellular carcinoma, where the overexpression of MALAT1 increases the risk of tumor recurrence after liver transplantation (36). In a clinical study on pancreatic cancer, abnormal overexpression of MALAT1 was identified as an unfavorable prognosis for clinical progression and prognosis (37). According to previous research, in vitro experiments on seven cell lines of pancreatic cancer identified MALAT1 as promoting growth, migration, and invasion of cells (38). A study on bladder cancer showed that MALAT1 promotes EMT-related cell migration which may be activated through Wnt signaling (39). The upregulation of MALAT1 was associated with the ability to increase proliferation, apoptosis, and motility in bladder cancer cells (40). In addition, in cervical cancer, the upregulation of MALAT1 has been associated with human papillomavirus (HPV) infection (41). MALAT1 has also been found in the promotion and invasion of cervical cancer cells (42).

In conclusion, the current study found that MALAT1 expression is correlated with gastric cancer tissues compared with adjacent healthy tissues. However, further studies are needed on MALAT1 molecular mechanisms such as transcriptional factors that are affected by the MALAT1 levels in gastric cancer tissues and cell lines.

Conflict of interests

The authors declare that they have no conflict of interest.