Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2021 Mar 25;95(8):e02045-20. doi: 10.1128/JVI.02045-20

Peste des Petits Ruminants Virus-Induced Novel MicroRNA miR-3 Contributes To Inhibit Type I IFN Production by Targeting IRAK1

Huan Li a,#, Qinghong Xue b,#, Yangli Wan a, Yan Chen a, Wei Zeng a, Shaopeng Wei a, Yanming Zhang a, Jingyu Wang a,✉, Xuefeng Qi a,✉
Editor: Rebecca Ellis Dutchc
PMCID: PMC8103702  PMID: 33504605

Peste des petits ruminants virus (PPRV) induces in the host a transient but severe immunosuppression, which threatens both small livestock and endangered susceptible wildlife populations in many countries. Despite extensive research, the mechanism underlying PPRV immune system evasion remains elusive.

KEYWORDS: IFN-α, IRAK1, IRF3, peste des petits ruminants virus, miR-3

ABSTRACT

Peste des petits ruminants virus (PPRV) is an important pathogen that seriously influences the productivity of small ruminants worldwide. PPRV has evolved several mechanisms to evade type I interferon (IFN-I) responses. We report that a novel microRNA in goat peripheral blood mononuclear cells (PBMCs) called miR-3 is upregulated by PPRV to facilitate virus infection. Furthermore, PPRV V protein alone was sufficient to induce novel miR-3 expression, and NF-κB and p38 pathways may be involved in the induction of miR-3 during PPRV infection. Importantly, we demonstrated that miR-3 was a potent negative regulator of IFN-α production by targeting interleukin-1 receptor-associated kinase 1 (IRAK1), which resulted in the enhancement of PPRV infection. In addition, we found that PPRV infection can activate interferon-stimulated genes (ISGs) through IFN-independent and IRF3-dependent pathways. Moreover, our data revealed that miR-3-mediated regulation of IFN-α production may be involved in the differential susceptibility between goat and sheep to PPRV. Taken together, our findings identify a new strategy by PPRV to escape IFN-I-mediated antiviral immune responses by engaging cellular microRNA, and thus leads to improved understanding of PPRV pathogenesis.

IMPORTANCE Peste des petits ruminants virus (PPRV) induces in the host a transient but severe immunosuppression, which threatens both small livestock and endangered susceptible wildlife populations in many countries. Despite extensive research, the mechanism underlying PPRV immune system evasion remains elusive. Our data provide the first direct evidence that a novel microRNA-3 (miR-3) feedback-inhibits type I IFN signaling when goat PBMCs are infected with PPRV vaccine strain N75/1, thus promoting the infection. In this study, the target of miR-3 was identified as IRAK1, which is important for type I IFN production. Moreover, we identified NF-κB and p38 pathways as possibly involved in miR-3 induction in response to PPRV infection. Taken together, our research has provided new insight into understanding the effects of miRNA on host-virus interactions, and revealed a potential therapeutic target for antiviral intervention.

INTRODUCTION

Peste des petits ruminants (PPR) is an acute, highly contagious fatal disease in domestic and wild small ruminants. Peste des petits ruminants virus (PPRV), the causative agent of PPR, belongs to the Morbillivirus genus (1, 2). PPRV has six structural proteins, including the nucleocapsid (N), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin (H), and polymerase (L) proteins, and three nonstructural proteins C, W and V, which perform multiple roles in the pathogenicity of PPRV and counteract host antiviral responses (3). PPRV infection usually causes severe suppression of immune responses in the host, which favors secondary infections (4, 5). One of the most widely used PPRV vaccine strains, Nigeria 75/1, has been shown to protect against virus isolates of all four genetic lineages of PPRV in most countries (6, 7). Although the vaccine with attenuated PPRV has been found to be highly efficacious, safe, and potent in small ruminants, early and transient innate immune suppression in goats immunized with PPRV vaccine was found (8).

Type I interferon (IFN-α/β) is fundamental in antiviral innate immunity, as well as in the mounting of adaptive immunity. Upon recognition of the viral components, the pattern recognition receptors (PPRs), including Toll-like receptors (TLRs) and RIG-I, could utilize the Toll-like-interleukin-1 receptor domain-containing adaptor (TRIF), MyD88, or virus-induced signaling adaptor (VISA) to induce the production of IFN-α/β and proinflammatory cytokines via interleukin-1 receptor-associated kinase 1 (IRAK1), IRAK4, TBK1, IRF1, and IRF3. IFN-α/β then binds to interferon (alpha and beta) receptor 1 (IFNAR1)/IFNAR2 and induces the IFN-stimulated genes (ISGs) responsible for the antiviral response through the JAK-STAT pathway in both infected and uninfected cells (9, 10). Furthermore, ISGs can also directly be induced by IRF3 after pathogen-associated molecular pattern (PAMP) detection and PRR signaling (11). Type I IFN production requires tight control to achieve the appropriate immune response to invading pathogens without triggering an immune disorder (9, 10). Consequently, viruses have developed strategies to evade and antagonize the host immune response and resist the antiviral actions of IFN therapy (12).

PPRV has evolved multiple strategies to counteract IFN-mediated antiviral effects through different mechanisms mediated by different viral proteins. Previous studies have demonstrated the role of the V, N, and P proteins of PPRV in abrogating IFN-β production by blocking STAT1 and STAT2 nuclear translocation through interactions with STAT1 and STAT2 (13–15). Furthermore, it has been demonstrated that the V and C proteins of PPRV inhibit the induction of IFN-β (16). Recently studies indicated the N protein of PPRV inhibits IFN-β production and its signaling by interacting with IRF3 to block its activation (17). Importantly, although infection with pathogenic or vaccine strains of PPRV significantly suppressed type I IFN production and/or interferon signaling, various antiviral ISGs, such as ISG15, IFIT3 and IFIT5, can be induced in response to PPRV vaccine virus infection (18, 19). However, the mechanisms underlying such immune responses are not yet fully understood.

MicroRNAs (miRNAs) play a key role in regulation of gene expression posttranscriptionally (20–22). miRNAs of viral and cellular origin can help viruses evade host immune responses by targeting vital components in the host immune system. It has been extensively studied that viruses can take advantage of host miRNAs that act as suppressors of type I IFN to generate a suitable environment for their replication (23, 24). However, it remains elusive whether host miRNAs are used by PPRV in the evasion of innate immune responses. To date, the number of identified miRNAs in goat is only 420 in the Sanger miRbase v22.0 (March 2018). Our recent study has identified 103 known and 213 novel miRNAs in goat PBMCs infected with PPRV vaccine strain Nigeria 75/1 by using small RNA deep sequencing (25), and all data have been deposited in the GEO database-data set GSE156378. In particular, we found a novel capra hircus microRNA, miR-3, which possesses the typical stem-loop structures matching known miRNA hairpins (Fig. 1A), was one of the most upregulated microRNAs during PPRV infection. It has previously been reported that virulent PPRV infection caused a dysregulated miRNAome in infected goat PBMCs at 9 days postinfection (dpi), and the top 10 differentially expressed miRNAs were found to govern genes that modulate immune responses (26). Although no findings regarding PPRV inducing miR-3 were reported, it should be noted that these miRNAs were identified based on known cattle miRNAs, which may exclude the effects of unknown miRNAs in goat during PPRV infection. Furthermore, the contradictory results in relation to miRNA expression in response to PPRV infection may be due to different virus strains used and the time points detected. Here, we reveal a novel mechanism in which PPRV vaccine virus N75/1 strain regulates IFN-α production by activating novel miR-3. We demonstrate that PPRV infection upregulates miR-3, which in turn suppresses PPRV-triggered IFN-α production. Furthermore, we demonstrated that novel miR-3 targets one important immune regulator, interleukin-1 receptor-associated kinase 1 (IRAK1), which is involved in miR-3-mediated suppression of IFN-α production. Moreover, PPRV-induced activation of miR-3 expression requires viral V proteins, and the NF-κB and p38 pathways may also be involved in the upregulation of miR-3 expression. To the best of our knowledge, this study is the first to show that type I IFN regulation is involved in posttranscriptional regulation during PPRV infection.

FIG 1.

FIG 1

PPRV infection induces novel miR-3 expression in goat PBMCs. (A) The hairpin structure of miR-3, including the two stem-loop structures between 23 nucleotides (nt) and 36 nt, and the mature miRNA at a length of 21 nt is located at the 3′ tail end of hairpin. (B) The standard curve for absolute miRNA quantification was constructed using known concentrations of RNA oligonucleotides. (C to H) Goat PBMCs were infected with PPRV at different MOIs for 24 h (C, D, and E), or at an MOI of 1 for the indicated times (F, G, and H), and the protein levels PPRV V and N expression (C and F), novel miR-3 expression (D and G), as well as chi-miR-499-3p expression (E and H) were measured by Western blotting and stem-loop quantitative RT-PCR assay, respectively. (I and J) Goat PBMCs were transfected with plasmids expressing various HA- or Flag-tagged viral proteins for 48 h and then subjected to Western blotting with antibody against HA or Flag for the analysis of the expression of PPRV N, H, V, C, F, and M proteins in goat PBMCs (I), and novel miR-3 expression in transfected cells was subjected to qRT-PCR analysis (J). (K) Goat PBMCs were pretreated with DMSO, SB203580 (10 μM), SP600125 (10 μM), SCH772984 (10 μM), BAY11-7082 (10 μM), LY294002 (10 μM), or GF109203 (10 μM) as indicated for 30 min and then infected with PPRV at MOI 1 for 24 h. GAPDH was used as a loading control in Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

RESULTS

PPRV infection upregulates novel miR-3 expression.

We previously reported that a panel of miRNAs was markedly upregulated upon PPRV vaccine virus strain N75-1 infection in goat PBMCs (25), and all data have been deposited in the GEO database-data set GSE156378. Although miR-3 was one of the most upregulated, the mechanism involved in the regulation of miR-3 by PPRV infection is still unknown. To determine the relationship between PPRV infection and miR-3 activation, we determined the virus levels and miR-3 expression levels in goat PBMCs infected with PPRV. We performed stem-loop real-time quantitative PCR (qRT-PCR) to calculate the copy number of miRNAs examined, and the standard curve for absolute miRNA quantification was constructed using known concentrations of RNA oligonucleotides synthesized (Fig. 1B). The kinetic induction of mature novel miR-3 following PPRV infection indicated that miR-3 was a PPRV infection-responsive gene in goat PBMCs, and its induction was accompanied with increased virus levels either in a dose-dependent manner (Fig. 1C and D) or in an infection time-dependent manner (Fig. 1F and G). Chi-miR499-3p was not affected by PPRV infection (25) and was used as the miR-control in this study. The results showed there was no significant difference in chi-miR499-3p expression in response to PPRV infection (Fig. 1E and H). Collectively, these results indicated that PPRV infection activated novel miR-3 expression in goat PBMCs.

PPRV proteins have previously been demonstrated to play a key role in blocking type I interferon production and interferon signaling pathways (13–15). To determine the viral protein(s) involved in the upregulation of miR-3, goat PBMCs were transfected with plasmids expressing various hemagglutinin (HA)- or Flag-tagged viral proteins for 48 h and harvested and lysed, after which cell lysates were subjected to Western blotting with antibody against HA or Flag for the analysis of the expression of PPRV N, H, V, C, F, and M proteins in goat PBMCs (Fig. 1I). The presence of the HA or Flag tag at the C terminus of protein did not affected the protein’s function (data not shown). Our data demonstrated the V protein of PPRV significantly induced miR-3 expression (Fig. 1J). These experiments indicated that PPRV V protein alone was sufficient to cause the increased novel miR-3 expression in goat PBMCs.

We next investigated which transcription factor(s) might be responsible for the induction of miR-3. PBMCs were treated for 1 h with an inhibitor of the key signaling molecules, including JNK (SP600125), ERK (SCH772984), p38 (SB203580), NF-κB (BAY11-7082), PI3K (LY294002), and PKC (GF109203), and then were infected with PPRV at an MOI of 1.0. Our data showed that inhibition of NF-κB and p38 efficiently impaired PPRV-induced miR-3 expression (Fig. 1K). However, inhibition of JNK, ERK, PI3K, or PKC had little or no effect on the induction of miR-3 (Fig. 1K). These results suggest that NF-κB and p38 may be involved in the upregulation of miR-3 expression in goat PBMCs by PPRV infection. Alternatively, inhibition of NF-κB and p38 may have attenuated or inhibited PPRV infection and subsequently impaired PPRV-induced novel miR-3 expression.

Novel miR-3 enhances PPRV infection in goat PBMCs.

To test whether miR-3 can affect PPRV infection, PPRV infection assays were performed in goat PBMCs pretransfected with miR-3 mimics, miR-3 inhibitors, or the respective controls. PPRV infection was examined by Western blotting and 50% tissue culture infective dose (TCID50) assays. Our data showed that miR-3 mimics did enhance the levels of PPRV V and N proteins (Fig. 2A) and the virus titers (Fig. 2C) compared to mimic control (MC) in a dose-dependent manner, while an miR-3 inhibitor suppressed the levels of PPRV V and N protein (Fig. 2B) and the virus titers (Fig. 2C) compared to inhibitor control (IC) in a dose-dependent manner. These results clearly showed that cellular novel miR-3 facilitates PPRV infection.

FIG 2.

FIG 2

Novel miR-3 facilitates virus infection in PPRV-infected goat PBMCs. (A and B) Goat PBMCs were transfected with control mimic (MC), control inhibitor (IC), or different concentrations of miR-3 mimic or miR-3 inhibitor, and 48 h later the cells were infected with PPRV at an MOI of 1. Twenty-four hours later, PPRV V and N protein expression in miR-3 mimic-pretransfected cells (A) and miR-3 inhibitor-transfected cells (B) was measured by Western blotting. (C) Goat PBMCs were transfected with MC, different concentrations of novel miR-3 mimic, IC, or different concentrations of novel miR-3 inhibitor, and 48 h later the cells were infected with PPRV at an MOI of 1. Twenty-four hours later, the virus titers in the supernatants were measured by TCID50 assay. GAPDH was used as a loading control in Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

Novel miR-3 suppresses PPRV-triggered IFN-α production in PPRV-infected goat PBMCs.

It is known that miRNAs regulate a wide range of biological processes and participate in the innate and adaptive immune responses (27–29). Although our results demonstrated that miR-3 was activated by PPRV infection, the biological effects of miR-3 have not previously been studied. Here, we investigated the role of miR-3 in the regulation of innate and adaptive immune responses during PPRV infection. Goat PBMCs were first transfected with an miR-3 mimic, an miR-3 inhibitor, or the respective controls. After 48 h, the cells were mock infected or infected with PPRV at an MOI of 1, and 24 h later the production of various cytokines by PBMCs was determined by qRT-PCR and Western blotting. Our data showed that miR-3 mimic preinfection suppressed both mRNA and protein levels of IFN-α compared to MC in a dose-dependent manner, but had no significant effects on the expression of IFN-γ, tumor necrosis factor α (TNF-α), or interleukin 10 (IL-10) (Fig. 3A and B). Conversely, preinfection with an miR-3 inhibitor increased IFN-α expression in a dose-dependent manner compared to IC (Fig. 3C and D). Similarly, no obvious changes in IFN-γ, TNF-α, or IL-10 expression were detected among the cells transfected with different concentrations of miR-3 inhibitor (Fig. 3C and D). These results demonstrate that novel miR-3 suppresses the production of IFN-α during PPRV infection.

FIG 3.

FIG 3

Novel miR-3 inhibits IFN-α production during PPRV infection. (A to D) Goat PBMCs were transfected with control mimic (MC) and different concentrations of miR-3 mimic (A and B), or else control inhibitor (IC) and miR-3 inhibitor (C and D), and 48 h later the cells were infected with PPRV at an MOI of 1. Twenty-four hours later, the mRNA (A and C) and protein levels (B and D) of cytokines indicated were measured by qRT-PCR and Western blotting, respectively. (E and F) Goat PBMCs were transfected with control mimic (MC), miR-3 mimic, control inhibitor (IC), or miR-3 inhibitor for 48 h, and then the cells were stimulated with poly(I·C). Twenty-four hours later, IFN-α mRNA (E) and protein expression (F) were measured by qRT-PCR and Western blot assay, respectively. GAPDH was used as a loading control in qRT-PCR and Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

To further characterize the biological significance of the observed upregulated miR-3 expression and the subsequent impairment of PPRV-triggered IFN-α production, we further investigated the effects of miR-3 on IFN-α production in goat PBMCs stimulated with poly(I·C). Our data indicated that novel miR-3 mimics decreased the mRNA and protein levels of IFN-α, while miR-3 inhibitor stimulated IFN-α expression (Fig. 3E and F). Furthermore, miR-3 mimic or inhibitor preinfection had no significant effects on IFN-α expression either in mock-infected or poly(I·C) untreated control cells (data not shown).

Novel miR-3 targets the 3′UTRs of IRAK1.

Next, we investigated potential targets of miR-3 involved in regulating PPRV-triggered IFN-α production. According to the TargetScan algorithm, we identified one predicted miR-3 target and found putative miR-3-binding sites in the 3′ untranslated regions (UTRs) of goat and sheep IRAK1 (Fig. 4A). To verify the possibility that IRAKI was regulated posttranscriptionally by miR-3, we cloned fragments of goat IRAK1 3′UTR mRNA (XM_018044609.1) containing the putative miRNA-binding site into the psiCHEK-2 vector and transfected the constructed vectors into human HEK293 cells along with synthetic mature novel miR-3 double-stranded RNA or a control miRNA with a scrambled sequence. After normalization of the Renilla luciferase signal to the firefly luciferase signal, miR-3 significantly decreased luciferase activity of the vector containing the 3′UTR of IRAK1 in HEK293 cells (Fig. 4B). Furthermore, the inhibitory effect was abrogated in cells transfected with novel miR-3 and IRAK1 3′UTRs containing mutated binding sites (Fig. 4C). Moreover, transfection of the miR-3 mimic decreased IRAK1 mRNA (Fig. 4D) and protein expression (Fig. 4F) in goat PBMCs in a dose-dependent manner, whereas the miR-3 inhibitor increased IRAK1 expression (Fig. 4E and F), suggesting that IRAK1 expression could be inhibited by miR-3 via both translational inhibition and mRNA degradation.

FIG 4.

FIG 4

Novel miR-3 targets goat IRAK1. (A) Sequence alignment of novel miR-3 and its binding sites in the 3′ UTRs of IRAK1, as predicated by TargetScan algorithm software. (B) Dual-luciferase assay of HEK293T cells cotransfected with luciferase constructs of 3′ UTRs of IRAK1 containing the putative miR-3-binding site together with synthetic mature miR-3 or control miRNA. After 48 h, firefly luciferase activity was determined and normalized to Renilla luciferase activity. (C) Dual-luciferase assay of HEK293T cells cotransfected with luciferase constructs containing the wild-type 3′ UTRs (3′ WT UTR) or a mutated 3′ UTR (3′ mutant UTR) of IRAK1 containing the putative novel miR-3-binding site together with synthetic mature novel miR-3 or control miRNA. After 48 h, firefly luciferase activity was determined and normalized to Renilla luciferase activity. (D to F) Goat PBMCs were transfected with miR-3 mimic (D and F) or miR-3 inhibitor (E and F) at various concentrations for 48 h. IRAK1 mRNA (D and E) and protein levels (F) were determined by qRT-PCR and Western blot assay, respectively. (G) Goat PBMCs were transfected with miR-3 inhibitor, miR-3 mimic, or the respective control RNA. After 24 h, the cells were stimulated with poly(I·C) for 24 h, and indicated regulator expression were examined by Western blotting assay. GAPDH was used as a loading control in qRT-PCR and Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **; P < 0.01.

Given the important role of IRAK1 as regulated by miR-3 in regulating IFN-α production and IFN signaling, we further investigated whether these effects are via the IRAK1 pathway. After detection of viral single-stranded RNA (ssRNA), the endosomal single-stranded RNA receptor, Toll-like receptor, uses the MyD88 adaptor protein to inhibit IFN-α synthesis via IRAK1, NF-κB p65, TRAF6, and IRF7 transcription factor. As shown in Fig. 4G, transfection of miR-3 inhibitor increased IRAK1, NF-κB p6, and IFN-α expression in goat PBMCs stimulated with poly(I·C). Opposite effects were observed in cells treated with the miR-3 mimic (Fig. 4G). The protein levels of MyD88 were relatively unaffected. These results confirm that novel miR-3 suppresses IFN-α production primarily through the IRAK1-NF-κB pathway by targeting IRAK1.

Regulation of IFN-α signaling by novel miR-3 is mediated by IRAK1.

To further verify the roles of IRAK1 in miR-3-mediated regulation of IFN-α signaling, we silenced the IRAK1 gene and examined the effects on IFN-α production and signaling in miR3 inhibitor-pretransfected goat PBMCs stimulated with poly(I·C). Small interfering RNAs (siRNAs) effectively inhibited IRAK1 mRNA (Fig. 5A) and protein expression (Fig. 5B) in goat PBMCs. Knockdown of IRAK1 significantly decreased the levels of IFN-α mRNA (Fig. 5C) and protein (Fig. 5D), as well as IFN-α production (Fig. 5E) in cells transfected with inhibitor control. Increased IFN-α expression due to miR-3 inhibition was abrogated by siRNAs against IRAK1 (Fig. 5C to E). Then, we focused on the effect of IRAK1 regulated by miR-3 on activation of interferon-stimulated genes (ISGs). Our data showed that poly(I·C)-stimulated ISGs, including ISG15, IFIT3, and IREX1, were significantly decreased in IRAK1 knockdown cells (Fig. 5F). Similarly, although miR-3 inhibitor transfection significantly increased the ISGs examined, knockdown of IRAK1 markedly decreased the expression of these genes. These results suggest that IRAK1 regulated by novel miR-3 plays a key role in regulating IFN-α production and subsequently affects IFN-stimulated gene expression.

FIG 5.

FIG 5

Regulation of IFN-α production by novel miR-3 is mediated by IRAK1. (A and B) Goat PBMCs were transfected with nonspecific control siRNA and siRNA against IRAK1. After 24 h, IRAK1 mRNA (A) and protein levels (B) were determined by qRT-PCR and Western blotting, respectively, and normalized to GAPDH. (C to E) Goat PBMCs were cotransfected with novel miR-3 inhibitor or control RNA and siRNA against IRAK1. After 24 h, the cells were stimulated with poly(I·C) for 24 h, and IFN-α mRNA (C), protein expression (D), and secretion (E) were determined by qRT-PCR, Western blotting, and ELISA, respectively. (F) Goat PBMCs were cotransfected with novel miR-3 inhibitor or control RNA and siRNA against IRAK1. After 24 h, the cells were stimulated with poly(I·C) for 24 h, and interferon-stimulated genes (ISGs) as indicated were determined by qRT-PCR. GAPDH was used as a loading control in qRT-PCR and Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

Novel miR-3 enhances PPRV infection by suppression of IFN-α production.

It is known that PPRV has developed various strategies to evade and antagonize the host immune response and resist the antiviral actions of type I IFN therapy. Because miR-3 disrupts IFN-α signaling by targeting IRAK1, we speculated that PPRV might hijack cellular miR-3 to facilitate successful infection. To confirm this hypothesis, we first examined the effects of miR-3 inhibitor or inhibitor control (IC) transfection on PPRV infection in goat PBMCs at different transfection times. Our data showed that PPRV levels increased in IC-transfected cells in a time-dependent manner (Fig. 6A), while miR-3 inhibitor transfection significantly decreased virus levels compared to the IC group at indicated time points (Fig. 6A). Similar results were detected by TCID50 analysis (Fig. 6B). As expected, IFN-α protein levels hardly changed or even slightly decreased over a time course in the IC group, which was accompanied with decreased expression of IRAK1 and NF-κB p65 (Fig. 6A). However, a time course-increased levels of IFN-α protein expression were detected in the miR-3 inhibitor-transfected group (Fig. 6A). Further, an increased level of IRAK1 expression but no significant change in NF-κB p65 were detected in the miR-3 inhibitor-transfected group over a time course (Fig. 6A). We also examined the levels of ISGs after PPRV infection when inducible novel miR-3 was inhibited. As shown in Fig. 6C and D, although increased expression levels of ISG15 and IFIT3 mRNA over a time course was detected in the IC group, miR-3 inhibitor transfection further increased the expression of these genes compared to the IC group at the indicated time points.

FIG 6.

FIG 6

Novel miR-3 enhances the infection and progeny of PPRV by suppression of IFN-α production. (A) Goat PBMCs were transfected with miR-3 inhibitor or control RNA (IC) at a final concentration of 100 nM. Twenty-four hours after transfection, the cells were infected with PPRV (MOI = 1) for 2 h and then washed. Cells were harvested at the indicated hour postinfection (hpi), and the indicated protein levels in the IC and miR-3 inhibitor groups were determined by Western blotting. (B to D) Goat PBMCs were transfected with IC or miR-3 inhibitor at a final concentration of 100 nM and 48 h later the cells were infected with PPRV at an MOI of 1. The virus titers in the supernatants and the indicated ISG expression at the indicated time points postinfection were measured by TCID50 assay (B) and qRT-PCR (C and D), respectively. (E and F) Goat PBMCs were cotransfected with miR-3 inhibitor or control RNA and siRNA against IRAK1. After 24 h, the cells were infected with PPRV for 24 h, and protein levels as indicated and virus titers in the supernatants were determined by Western blotting (E) and TCID50 (F), respectively. (G to I) Goat PBMCs were transfected with miR-3 mimic or mimic control (MC) and further treated with or without IFN-α (100 U/ml). After 24 h, the cells were infected with PPRV (MOI = 1) for 24 h, and PPRV V and N protein levels (G) and virus titers (H) in the supernatants were determined by Western blotting and TCID50 assay, respectively. The ISGs indicated were also examined by qRT-PCR (I). (J and K) Goat PBMCs were transfected with novel miR-3 mimic or mimic control. After 24 h, the cells were infected with PPRV (MOI = 1) for 24 h, and IRF3 mRNA (J) and phosphorylation levels (K) were determined by qRT-PCR and Western blot assay, respectively. (L) Goat PBMCs were transfected with nonspecific control siRNA and siRNA against IRF3. After 24 h, IRF3 protein levels were determined by Western blotting and normalized to GAPDH. (M and N) Goat PBMCs were transfected with miR-3 mimic or mimic control and further transfected with siRNA against IRF3 or control siRNA. After 24 h, the cells were infected with PPRV (MOI = 1) for 24 h, and IRF3 phosphorylation (M) and indicated ISG mRNA expression (N) were determined by Western blotting and qRT-PCR assay, respectively. GAPDH was used as a loading control in qRT-PCR and Western blot analysis. Results are expressed as means ± standard error of mean (SEM). P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

As IRAK1 targeted by miR-3 plays a key role in regulating IFN-α production, we further detected the role of targeting IRAK1 via miR-3 during PPRV infection. Our results showed that miR-3 inhibition significantly decreased virus levels, while IRAK1 knockdown rescued the decreased virus levels (Fig. 6E). Also, an inverse correlation between the expression of IFN-α and virus levels following PPRV infection was confirmed (Fig. 6E). These results were consistent with those of measuring PPRV TCID50 in the cultural supernatants (Fig. 6F). Taken together, these results suggest that induction of miR-3 upon PPRV infection facilitates virus infection mainly through suppression of IFN-α production by targeting IRAK1. Then, we examined the antiviral effects of IFN-α treatment on virus levels in PPRV-infected cells pretransfected with the miR-3 mimic. The results showed that miR-3 mimic transfection enhanced virus levels (Fig. 6G) and progeny (Fig. 6H), while the enhancement of virus levels by miR-3 was weakened by IFN-α treatment (Fig. 6G and H). The results of ISG expression analysis showed that significantly increased expression levels of ISG15 and IFIT3 mRNA were observed in the cells treated with IFN-α compared to untreated control (Fig. 6I). These results suggest that miR-3 induced upon PPRV infection facilitates virus infection mainly through suppression of IFN-α production and subsequently stimulation of ISGs, rather than inhibition of IFN-α signaling.

It is interesting to note that although PPRV infection suppressed IFN-α production, as detected in the IC group, increased expression levels of ISG15 and IFIT3 over a time course were detected in the present study (Fig. 6C and D). The inhibition of IFN-α expression in our study suggested that the stimulation of ISGs could be IFN independent. It is has previously been demonstrated that ISGs can be induced directly by IRF3 (30). To assess the role of IRF3 in miR-3-mediated regulation of ISG expression, we first examined the IRF3 expression in PPRV-infected cells pretransfected with novel miR-3 mimic or novel miR-3 inhibitor. Our data showed that PPRV infection significantly increased IRF3 mRNA expression levels (Fig. 6J) and phosphorylation of IRF3 (Fig. 6K) compared to mock-infected cells both in the miR-3 mimic- and miR-3 inhibitor-transfected groups. Then, we used si-IRF3 to repress IRF3 expression in the presence of miR-3 mimic, followed by PPRV infection. Small interfering RNAs (siRNAs) against IRF3 effectively inhibited IRF3 protein expression in PPRV-infected goat PBMCs (Fig. 6L). PPRV infection significantly induced phosphorylation of IRF3 compared to mock-infected cells both in MC and mimic-transfected groups, while increased IRF3 phosphorylation was abrogated by siRNAs against IRF3 (Fig. 6M). Furthermore, knockdown of IRF3 significantly inhibited ISG15 and IFIT3 expression levels both in MC and mimic-transfected groups (Fig. 6N).

Novel miR-3 correlates with PPRV infection in goat and sheep.

It is known that goat is naturally more susceptible to PPRV than sheep due to mostly uncharacterized host- or virus-derived factors (1, 31). To investigate whether the differential susceptibility between goat and sheep to PPRV may be related to novel miR-3-mediated regulation of IFN-α production, we analyzed the levels of PPRV and the endogenous expression levels of miR-3 and IFN-α in goat and sheep PBMCs infected with PPRV. As shown in Fig. 7, viral levels were constitutively increased at a higher level in goat PBMCs than in sheep PBMCs during PPRV infection (Fig. 7A). Moreover, the expression of cellular miR-3 in PBMCs from goat was significantly higher than that from sheep (Fig. 7B). Also, an inverse correlation was observed between miR-3 expression and IFN-α production both in goat and sheep PBMCs (Fig. 7C).

FIG 7.

FIG 7

Novel miR-3 correlates with PPRV infection in goat and sheep. (A) The kinetic levels of PPRV V and N protein in PPRV-infected PBMCs from goat and sheep were determined by Western blotting assay. (B and C) The kinetic levels of miR-3 expression (B) and IFN-α production (C) in PPRV-infected PBMCs from goat and sheep were evaluated by qRT-PCR and ELISA, respectively (n = 25). GAPDH was used as a loading control in Western blotting for PPRV V and N protein analysis. P values were calculated using Student’s t test. An asterisk indicates a comparison with the indicated control; *, P < 0.05; **, P < 0.01; n.s., not significant.

DISCUSSION

PPRV infection has been known to be associated with acute immunosuppression in its natural host, especially innate immunity. Type I interferon is fundamental for antiviral innate immunity, as well as in the mounting of adaptive immunity. PPRV has adopted various strategies to counteract IFN-mediated antiviral effects through different viral proteins. It is well known that miRNAs play a key role in the regulation of immune responses during virus infection (23, 24). Here, we found that novel miR-3, a negative miRNA directly targeting the interleukin-1 receptor-associated kinase 1 (IRAK1) gene, was significantly upregulated by PPRV infection. Importantly, there was a positive correlation between novel miR-3 expression and viral levels in the PPRV-infected goat PBMCs. Subsequently, we demonstrated that miR-3 suppressed IFN-α production by targeting IRAK1, which resulting in the enhancement of PPRV infection. Furthermore, PPRV infection can activates ISGs, including ISG15 and IFIT3, through an IFN-independent and IRF3-dependent pathway. Moreover, our data revealed that miR-3-mediated regulation of IFN-α production may be involved in the differential susceptibility between goat and sheep to PPRV. To the best of our knowledge, this study is the first to show that cellular miRNA acts as a negative regulator of type I IFN production by targeting IRAK1 during PPRV infection, and is involved in the enhancement of viral levels.

Various strategies are adopted by viruses to inhibit the type I IFN system to ensure their successful propagation and spread (32). PPRV infection induces poor type I IFN responses, and several PPRV proteins, including V, N, and P protein, are shown to antagonize and are able to inhibit the production and signaling of IFN-I (16). A previous study demonstrated that the V, N, and P proteins of PPRV inhibit IFN-β production and block IFN signaling transduction by interacting with STAT1/2 in Cos7, HEK293T, and A549 cells (13–15). Recent studies revealed that the N protein suppress IFN-β production and IFN signaling in HEK293T and goat fibroblasts by blocking RIG-I like receptor (RLR) pathway activation via binding to IRF3 (17). MicroRNAs have been reported to regulate the innate and acquired immune responses, as well as the differentiation and development of immune cells. Cellular miRNAs were shown to be used by viruses to evade IFN-I-mediated antiviral responses in host cells (27–29). However, whether miRNAs participate in PPRV-mediated evasion of IFN-I-mediated antiviral responses remains elusive. In this study, we described a new strategy used by PPRV to evade IFN-I-mediated antiviral responses by inducing cellular novel miR-3 in goat PBMCs. However, it is difficult to verify whether miR-3 is more or less important in viral pathogenesis than other reported mechanisms (13–15). Nevertheless, it is reasonable to speculate that PPRV benefits itself when PPRV-induced novel miR-3 cooperates with other viral proteins to interfere with IFN-I-mediated antiviral responses.

Here, we demonstrated that miR-3 suppressed IFN-α production and significantly promoted viral infection by directly targeting IRAK1, a critical signaling component in IFN-I signaling. The importance of IRAK1 is emphasized by the fact that various viruses can reduce the constitutive levels of IRAK1 to facilitate their infection (33, 34). During PPRV infection, we demonstrated that an inverse correlation was detected between miR-3 expression and IRAK1 mRNA expression. In addition, the impaired expression of IRAK1 could be rescued by novel miR-3 inhibitor, which confirmed that PPRV-induced miR-3 is responsible for the decreased levels of IRAK1. Suppression of IRAK1 may attenuate antiviral immunity and facilitate virus infection (27, 33, 34). Here, decreased levels of IRAK1 via inducible miR-3 inhibits IFN-α production in PBMCs infected with PPRV, which enhances virus infection and progeny. Furthermore, the treatment of PBMCs with recombinant IFN-α significantly inhibits viral levels in miR-3 mimic-transfected cells during PPRV infection, which confirms that the induction of novel miR-3 expression may be a new survival strategy of the PPRV to escape the antiviral immune response of the host.

Several PPRV proteins also counteract type I IFN production and their downstream signaling. It has previously been shown that the PPRV V protein can inhibit IFN-β production and block IFN signaling transduction by interacting with STAT1/2 (13, 14). Our results showed the PPRV V protein is essential for PPRV-induced novel miR-3 expression. Here, we broaden previous studies by showing that PPRV V protein can suppress IFN-α production by stimulating novel miR-3 expression.

The NF-κB pathway is the important signaling pathway in the regulation of PPRV replication and NF-κB can be activated by PPRV infection (18). We showed that NF-κB and p38 were both involved in the PPRV-mediated activation of miR-3. Although the role of the p38 pathway during PPRV infection is not understood, we provide direct evidence that the NF-κB and p38 pathways may play a role in the induction of miR-3 in response to PPRV infection. Further studies are needed to illustrate the mechanism involved in the activation of miR-3 mediated by NF-κB and p38 pathways during PPRV infection.

Both infection with pathogenic or vaccine strains of PPRV significantly suppressed type I IFN production in PPRV-susceptible cells. Wild-type PPRV infection inhibits activation of ISGs by blocking JAK-STAT signaling or via binding IRF3, a key regulator in both IFN production and ISG induction (13–15, 17). However, various antiviral ISGs, like ISG15, IFIT3, and IFIT5, were induced in goat PBMCs infected with PPRV vaccine virus (18, 19). Our data are similar to previous reports showing that PPRV vaccine virus strain N75/1 infection suppressed IFN-α production and activated the expression of ISG15, IFIT3, and IRF3, which was accompanied by an increased virus load in goat PBMCs. This discrepancy may be due to the different virulence of virus-, cell-type-, or host-derived factors. Furthermore, it has been indicated that ISGs can be directly induced by IRF3 after PAMP detection and PRR signaling and indirectly stimulated by IFN signaling (30). Here, we showed that knockdown of IRF3 significantly inhibited ISG15 and IFIT3 expression levels in both novel miR-3 mimic- and mimic control-transfected cells during PPRV N75/1 strain infection. This implies that PPRV infection can activate ISGs through IFN-independent and IRF3-dependent pathways. Furthermore, the upregulation of antiviral molecular signature ISG15 and IRF3 after vaccine virus infection presumably reflects the ongoing stimulation of innate immune cells. However, the detailed regulatory mechanism mediating this discrepancy remains to be investigated in the future.

As the target site of novel miR-3 in the 3′UTR of IRAK1 is conserved in goat and sheep, we speculate that miR-3-mediated IFN-α antiviral responses might play a role in the different susceptibility to PPRV infection between goat and sheep (35). As expected, we found significantly enhanced viral levels in goat PBMCs compared to sheep PBMCs. Importantly, the expression of cellular miR-3 in goat PBMCs was significantly higher than that from sheep, and an inverse correlation was observed between novel miR-3 expression and IFN-α production both in goat and sheep PBMCs. Thus, we assume that miR-3-mediated IFN-α antiviral response may be involved in the different susceptibility between goat and sheep to PPRV infection. Although the different susceptibility to PPRV infection between goat and sheep is likely due to tissue tropism (35, 36), efficiency of infection (35), and immunity (37), our data suggest that novel miR-3-mediated IFN-α antiviral response may play an important role in determining PPRV tropism for species. Our model, in which miR-3 directly targets IRAK1 to impair IFN-α production and enhance PPRV infection, is shown in Fig. 8. In this model, PPRV enters the cell through direct fusion (38) and receptor-mediated endocytosis (39–42). The production and signaling of IFN-I following PPRV infection are mediated through retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) (16) and Toll-like receptor (TLR) (31), although how PPRV-associated molecular patterns are recognized is not yet fully understand. Our data suggest a role for miR-3 in repression of IFN-α production by directly targeting IRAK1 during PPRV infection, and PPRV V protein alone was sufficient to induce novel miR-3 expression, and NF-κB and p38 may be involved in the upregulation of novel miR-3. Furthermore, we found that PPRV infection can activated ISGs through an IFN-independent and IRF3-dependent pathway (Fig. 8).

FIG 8.

FIG 8

Proposed model for the activation of novel miR-3 expression upon PPRV infection and the role of novel miR-3 in the regulation of the antiviral activity of IFN-α. PPRV V protein alone can activate novel miR-3 expression during PPRV infection, and the NF-κB and p38 pathways may be involved in the upregulation of miR-3. Novel miR-3 interferes with IFN-α production by repressing IRAK1 expression, leading to viral escape from the host innate-immunity response. ISGs can be stimulated in an IRF3-dependent manner during PPRV infection.

In summary, we present a strategy used by PPRV to escape innate immunity by engaging miRNA, which may help us to further understand PPRV pathogenesis. In addition, our findings underscore the importance of miRNAs in the regulation of IFN-I signaling and PPRV infection, as well as broadening our knowledge about the role of miRNAs in host-virus interactions.

MATERIALS AND METHODS

Ethics statement and experimental animals.

The animal experiments were carried out in strict accordance with guidelines established by the Ethics of Animal Experiments of Northwest A&F University, Yangling, China. All the protocols were approved by this committee (permit number 2014BAD23B11). Healthy 6-month-old goats and sheep used for blood collection were housed in appropriate containment facilities and had ad libitum access to feed and water. Goats were screened for PPRV antibodies using competitive enzyme-linked immunosorbent assay (ELISA) and serum neutralization test and all tested negative.

PBMC isolation and virus infection.

Goat peripheral blood mononuclear cells (PBMCs) were isolated using Histopaque-1077 (Sigma, USA) by density gradient centrifugation following the manufacturer’s instructions. Then, isolated cells from each goat were suspended into 70 ml RPMI 1640 medium (HyClone, Logan, UT, USA) supplemented with 10% fetal calf serum (FCS), 100 mg/ml penicillin, and 100 IU/ml streptomycin. The PPRV vaccine strain, Nigeria 75/1, was obtained from the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Lanzhou, China). Virus stock was prepared by collecting the infected Vero cell supernatants when cytopathic effect (CPE) affected about 80% of the cells. The virus was harvested by three cycles of freezing and thawing and stored at −80°C and purified by banding on a sucrose gradient. The purified virus titers were estimated by estimating 50% tissue culture infective doses (TCID50) using Vero cells in 96-well microtiter plates. The purified virus was tested for its infectivity in Vero cells and was used further for infection in goat PBMCs.

For virus infection, goat PBMCs were seeded into six well plates at a density of 1 × 105 cells/ml and were inoculated with Nigeria 75/1 at a multiplicity of infection (MOI) of 1.0. After 1 h of adsorption, infected cells were maintained in RPMI 1640 medium (HyClone, Logan, UT, USA) supplemented with 2% FCS. PBMCs inoculated with similarly purified preparations from triple freeze-thawed Vero cells were used as the mock-infected group. Viral infection in PBMCs was confirmed with CPE, one-step growth curve,and Western blotting. The CPE were observed under a light microscope at 0, 24, 48, and 72 h postinfection (hpi). Western blotting was performed using a polyclonal antibody against PPRV N or V protein to determine virus levels at the different time points. Three replicates of PPRV- and mock-inoculated cultures were prepared at each time point.

Plasmids construct and virus protein expression.

PPRV genes V, H, N, C, F, and M were amplified from PPRV genomic cDNA and cloned into pcDNA3.1(+) (Invitrogen, V790-20). Goat PBMCs were transfected with pcDNA3.1-H-HA, pcDNA3.1-N-HA, pcDNA3.1-C-HA, and pcDNA3.1-V-HA plasmid, or plasmids expressing Flag-tagged F and M protein, for 48 h and harvested and lysed. Cell lysates from transfected and untransfected control cells were subjected to Western blotting with antibody against HA or Flag for protein expression analysis. All the constructed plasmids were sequenced and the correct insertion of each gene was verified. The empty vector pcDNA3.1 was used as a mock control.

RNA isolation and absolute miRNA quantification.

Total RNA was extracted from goat PBMCs using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Real-time quantitative PCR was carried out using an ABI 7500 system (Applied Biosystems, Warrington, UK) and Power SYBR Green PCR Master Mix (Applied Biosystems).

For detection of miRNA, total RNA was reverse transcribed and quantitative real-time RT-PCR (qRT-PCR) analysis was performed using stem-loop qRT-PCR. Stem-loop RT primers and probes for detecting miRNAs were designed based on their sequences (Table 1) and the sequences of the primer and TaqMan probe are shown in Table 2. TaqMan MicroRNA RT kit (Applied Biosystems) was used, and the reaction mixtures were incubated according to kit instructions. Each 10-μl miRNA PCR included 1 μl of RT product, 5 μl of 2× IQ Supermix (Bio-Rad), 1.5 μM forward primer, 0.7 μM universal reverse primer, and 0.2 μM TaqMan probe (Applied Biosystems). The samples were incubated on an ABI 7500 system (Applied Biosystems, Warrington, UK) at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. All real-time PCRs were performed from the same batch of RT product for each sample and were performed in duplicate. TaqMan microRNA assay for U6 (Applied Biosystems) was used as a loading control.

TABLE 1.

Sequences of the examined miRNAs analyzed in this study

miRNA Sequence (5′–3′)a
Novel miR-3 CACGCUCAUGCACACACCCAC
chi-miR-499-3p GAACAUCACAGCAAGUCUGUGC
Novel miR-3 mimic CACGCUCAUGCACACACCCAC
Novel miR-3 inhibitor GUGGGUGUGUGCAUGAGCGUG

aSequences are taken from miRbase 22 (http://www.mirbase.org).

TABLE 2.

Sequences of the examined miRNA-specific primers and probes used in this study

Ebv-miR Oligo Sequence (5′–3′)
Novel miR-3 RT CTCAACTGGT GTCGTGGAGT CGGCAATTCA GTTGAG GTGGGTGT
Forward ACACTCCAGCTGGGCACGCTCATGCACA
Probe TTCAGTTGAG GTGGGTGT
chi-miR-499-3p RT CTCAACTGGT GTCGTGGAGT CGGCAATTCA GTTGAGGCACAGAC
Forward ACACTCCAGCTGGGGAACATCACAGCAAG
Probe TTCAGTTGAGGCACAGAC

To calculate the copy number of miRNAs examined per cell, we first constructed a standard curve for absolute miRNA quantification using known concentrations of RNA oligonucleotides synthesized by RiboBio Inc. (GuangZhou. China) according to a previous study (43). Then, we measured total miRNA copy numbers detected in the samples (about 1 × 105 cells per sample) by means of the constructed standard curve. The average miRNA copy number per cell can be estimated by taking the total miRNA copy number divided by the cell numbers.

Real-time quantitative PCR analysis.

Total RNA was extracted from goat PBMCs using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. RNA was then reverse transcribed using Superscript III (Invitrogen) and random primers (Invitrogen). Real-time quantitative PCR assay of goat cytokine and housekeeping gene (glyceraldehyde phosphate dehydrogenase [GAPDH]) mRNAs was carried out essentially as described previously (44), except that the primers used for IRAK1, ISG genes, and IRF3 genes were those indicated in Table 3. The PCR cycling conditions were 20 s at 95°C followed by 40 cycles of 3 s at 95°C and 30 s at 60°C. Expression of the GAPDH gene was used to normalize cDNA levels for differences in total cDNA levels in the samples. Then, the threshold cycle (CT) (d) was used to calculate the fold difference in copy number using the formula f = 2(−d), where f = the fold difference in the expression of a specific gene and d = the difference in the CT values between the compared sources of mRNA (corrected for differences in the GAPDH levels). We normalized each sample to control cell sample number 1. Melt curves were performed to confirm the purity of the amplified products.

TABLE 3.

Primer sequence for real-time quantitative PCR (qRT-PCR)

Gene symbol Primer sequence (5′–3′) GenBank accession Product (bp)
IRAK1 TGGAGTGGACCACAGTGAAGC XM_018044609.1 136
GGCAGGAAGCCATAGACAAGG
ISG15 ATCAATGTGCCTGCTTTCC XM_005690795.3 287
ATGGGCTTCCCTTCAAAA
IFIT3 CAAACAATGCCTACCTCT XM_018041262.1 156
TCTCAATCGCTTTACTCAC
IRF3 GAAGTGTTGCGTTTAGCGG JQ308793.1 157
GCACAATGTCTTCCTGGGT

Western blot analysis.

Protein homogenates from goat PBMCs were extracted as previously described (38). Briefly, the cells were lysed for 20 min on ice in ice-cold lysis buffer (Roche). The lysates were centrifuged at 12,000 × g for 20 min at 4°C to obtain a clear lysate. The protein content of each sample was determined using the BCA protein assay kit (Thermo Scientific). Then, equal amounts of protein were separated on a 12% SDS-polyacrylamide gel and transferred to polyvinylidene difluoride membranes. Membranes were probed overnight at 4°C with an anti-PPRV-N or anti-PPRV-V monoclonal antibody provided by China Animal Health and Epidemiology Center (Qingdao, China), a rabbit polyclonal antibody against mouse IL-10 (1:1,500; ABclonal), a rabbit polyclonal antibody against mouse IFN-α (1:1,500; ABclonal), a rabbit polyclonal antibody against mouse IFNG (1:1,500; Abcam), or a rabbit polyclonal antibody against mouse TNF-α (1:1,500; Abcam). The bands were visualized using horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:15,000, Boster) or goat anti-rabbit IgG (1:20,000, Boster) prior to the ECL protocol (Amersham Biosciences, Piscataway, NJ, USA). As an internal standard, all membranes stripped with primary antibodies were reprobed with anti-GAPDH antibody (Invitrogen). Changes in protein expression were determined after normalizing the band intensity of each lane to that of GAPDH. Signal was visualized using the Konica SRX 101A developer (Konica Minolta Medical Imaging, Wayne, NJ, USA) and the Quantity One software (Bio-Rad, Mississauga, ON, Canada) was used for densitometrical analysis.

Transient transfection of miRNA.

Goat PBMCs were grown to logarithmic phase in six-well plates with antibiotic-free medium the day before transfection. The miRNA transfection, including miR-3 mimic, mimic control (MC), miR-3 inhibitor, and inhibitor control (IC) was performed with Lipofectamine RNAiMAX (Life Technologies, USA) on cells of 50% confluence according to the manufacturer's protocol. The sequences of miR-3 mimic and miR-3 inhibitor are shown in Table 1, where the miR-3 inhibitor affects 2′-O-methoxyethyl modification. The final concentrations of miR-3 mimic, miR-3 inhibitor, or their negative controls (RiBoBio, GuangZhou. China) were 100 nM. The effect of transfection was examined by quantitative RT-PCR and Western blotting.

Dual-luciferase reporter assay.

HEK293 cells were transfected with 10 ng each of psiCheck2 reporter plasmids along with15 pmol of the miR-3 mimic or an identical amount of the negative control with Lipofectamine 2000 (Invitrogen). After 48 h, the cells were lysed, and the firefly and Renilla luciferase activities were measured with the Dual-Luciferase reporter assay system kit (Promega, Madison, USA) according to the manufacturer’s protocol. Each fragment containing the putative miRNA-binding sites was cloned into psiCheck2 immediately downstream of the gene encoding Renilla luciferase by the Protein Expression Laboratory (SAIC, Frederick, MD). The results are presented as the ratio of Renilla luciferase activity to firefly luciferase activity. Each transfection was performed at least three times and was assayed in triplicate.

RNA interference.

Small interfering RNAs (siRNAs) targeting IRAK1 (target site: AGATCTACAAGAAGCACCT), IRF3 (target site: CCCACATGGAAGAGGAATT), and scrambled sequences (control siRNA for IRAK1: ATGCTACAGACACAGATCA, and control siRNA for IRF3: CACACCATGAGAGTGAGAT) were designed and synthesized by RiboBio, Inc. (GuangZhou, China). Small interfering RNAs were then used for silencing the target genes. Briefly, isolated goat PBMCs were transfected with 50 nM siRNA targeting IRAK1 or IRF3 or control siRNA by using Lipofectamine RNAiMAX according to manufacturer’s guidelines (Life Technologies, USA). After transfection, PBMCs were cultured in RPMI 1640 medium supplemented with 10% FCS for 48 h, and then infected with PPRV at an MOI of 1 for 24 h before the cells were harvested for Western blotting.

Virus titration.

Virus progeny production was determined by titration as described previously (27). The viral supernatants from goat PBMCs were collected at the indicated time points after virus inoculation, and the 50% tissue culture infective dose (TCID50) was calculated by the Reed-Muench method.

Cytokine production.

Concentrations of IFN-α in the supernatants of goat PBMCs were determined by enzyme-linked immunosorbent assay (ELISA). ELISA kits specific for goat IFN-α were purchased from CUSABIO Biotech (China). Assays were performed according to the manufacturer’s instructions. Culture supernatants were stored at −70°C until use.

Statistical analysis.

All values are expressed as the arithmetic means of triplicates ± standard error of the mean (SEM). Significance was determined by a one-way ANOVA with a Dunnett’s post hoc test, or by the Student’s paired t test. Values of P < 0.05 were considered statistically significant.

Data availability.

RNA sequencing data are available in the Gene Expression Omnibus (GEO) under accession number GSE156378.

ACKNOWLEDGMENTS

This research was financially supported by the National Natural Science Foundation of China (grant no. 31572588), the National Innovation and Entrepreneurship Training Program for College Students (grant no. 201910712033), and Key R&D Projects in Shaanxi Province (General Projects) (grant no. S2018-ZDYF-YBXM-NY-0003).

We declare no competing interests.

H.L. and Q.X. performed the majority of experiments. Y.C., Y.W., S.W., and W.Z. participated in part of the experiments. Y.W. and Y.Z. analyzed the data. X.Q. and J.W. conceived the study and participated in its design and coordination. X.Q. and H.L. prepared the manuscript. All authors have read and approved the final manuscript.

REFERENCES

  • 1.Banyard AC, Parida S, Batten C, Oura C, Kwiatek O, Libeau G. 2010. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J Gen Virol 91:2885–2897. doi: 10.1099/vir.0.025841-0. [DOI] [PubMed] [Google Scholar]
  • 2.Kumar N, Maherchandani S, Kashyap SK, Singh SV, Sharma S, Chaubey KK, Ly H. 2014. Peste des petits ruminants virus infection of small ruminants: a comprehensive review. Viruses 6:2287–2327. doi: 10.3390/v6062287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baron MD, Diallo A, Lancelot R, Libeau G. 2016. Peste des petits ruminants virus. Adv Virus Res 95:1–42. doi: 10.1016/bs.aivir.2016.02.001. [DOI] [PubMed] [Google Scholar]
  • 4.Schneider-Schaulies J, Schneider-Schaulies S. 2008. Receptor interactions, tropism, and mechanisms involved in morbillivirus-induced immunomodulation. Adv Virus Res 71:173–205. doi: 10.1016/S0065-3527(08)00004-3. [DOI] [PubMed] [Google Scholar]
  • 5.Koga R, Ohno S, Ikegame S, Yanagi Y. 2010. Measles virus-induced immunosuppression in SLAM knock-in mice. J Virol 84:5360–5367. doi: 10.1128/JVI.02525-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sen A, Saravanan P, Balamurugan V, Rajak KK, Sudhakar SB, Bhanuprakash V, Parida S, Singh RK. 2010. Vaccines against peste des petits ruminants virus. Expert Rev Vaccines 9:785–796. doi: 10.1586/erv.10.74. [DOI] [PubMed] [Google Scholar]
  • 7.Caufour P, Rufael T, Lamien CE, Lancelot R, Kidane M, Awel D, Sertse T, Kwiatek O, Libeau G, Sahle M, Diallo A, Albina E. 2014. Protective efficacy of a single immunization with capripoxvirus-vectored recombinant peste des petits ruminants vaccines in presence of pre-existing immunity. Vaccine 32:3772–3779. doi: 10.1016/j.vaccine.2014.05.025. [DOI] [PubMed] [Google Scholar]
  • 8.Rajak KK, Sreenivasa BP, Hosamani M, Singh RP, Singh SK, Singh RK, Bandyopadhyay SK. 2005. Experimental studies on immunosuppressive effects of peste des petits ruminants (PPR) virus in goats. Comp Immunol Microbiol Infect Dis 28:287–296. doi: 10.1016/j.cimid.2005.08.002. [DOI] [PubMed] [Google Scholar]
  • 9.Akira S, Uematsu S, Takeuchi O. 2006. Pathogen recognition and innate immunity. Cell 124:783–801. doi: 10.1016/j.cell.2006.02.015. [DOI] [PubMed] [Google Scholar]
  • 10.Beutler B, Eidenschenk C, Crozat K, Imler JL, Takeuchi O, Hoffmann JA, Akira S. 2007. Genetic analysis of resistance to viral infection. Nat Rev Immunol 7:753–766. doi: 10.1038/nri2174. [DOI] [PubMed] [Google Scholar]
  • 11.Lazear HM, Lancaster A, Wilkins C, Suthar MS, Huang A, Vick SC, Clepper L, Thackray L, Brassil MM, Virgin HW, Nikolich-Zugich J, Moses AV, Gale M, Jr, Früh K, Diamond MS. 2013. IRF-3, IRF-5, and IRF-7 coordinately regulate the type I IFN response in myeloid dendritic cells downstream of MAVS signaling. PLoS Pathog 9:e1003118. doi: 10.1371/journal.ppat.1003118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liew FY, Xu D, Brint EK, O'Neill LA. 2005. Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 5:446–458. doi: 10.1038/nri1630. [DOI] [PubMed] [Google Scholar]
  • 13.Ma X, Yang X, Nian X, Zhang Z, Dou Y, Zhang X, Luo X, Su J, Zhu Q, Cai X. 2015. Identification of amino-acid residues in the V protein of peste des petits ruminants essential for interference and suppression of STAT-mediated interferon signaling. Virology 483:54–63. doi: 10.1016/j.virol.2015.03.039. [DOI] [PubMed] [Google Scholar]
  • 14.Chinnakannan SK, Nanda SK, Baron MD. 2013. Morbillivirus v proteins exhibit multiple mechanisms to block type 1 and type 2 interferon signalling pathways. PLoS One 8:e57063. doi: 10.1371/journal.pone.0057063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li P, Zhu Z, Zhang X, Dang W, Li L, Du X, Zhang M, Wu C, Xue Q, Liu X, Zheng H, Nan Y. 2019. The nucleoprotein and phosphoprotein of peste des petits ruminants virus inhibit interferons signaling by blocking the JAK-STAT pathway. Viruses 11:629. doi: 10.3390/v11070629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sanz Bernardo B, Goodbourn S, Baron MD. 2017. Control of the induction of type I interferon by Peste des petits ruminants virus. PLoS One 12:e0177300. doi: 10.1371/journal.pone.0177300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhu Z, Li P, Yang F, Cao W, Zhang X, Dang W, Ma X, Tian H, Zhang K, Zhang M, Xue Q, Liu X, Zheng H. 2019. Peste des petits ruminants virus nucleocapsid protein inhibits interferon-β production by interacting with IRF3 to block its activation. J Virol 93:e00362-19. doi: 10.1128/JVI.00362-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Manjunath S, Mishra BP, Mishra B, Sahoo AP, Tiwari AK, Rajak KK, Muthuchelvan D, Saxena S, Santra L, Sahu AR, Wani SA, Singh RP, Singh YP, Pandey A, Kanchan S, Singh RK, Kumar GR, Janga SC. 2017. Comparative and temporal transcriptome analysis of peste des petits ruminants virus infected goat peripheral blood mononuclear cells. Virus Res 229:28–40. doi: 10.1016/j.virusres.2016.12.014. [DOI] [PubMed] [Google Scholar]
  • 19.Wani SA, Sahu AR, Saxena S, Rajak KK, Saminathan M, Sahoo AP, Kanchan S, Pandey A, Mishra B, Muthuchelvan D, Tiwari AK, Mishra BP, Singh RK, Gandham RK. 2018. Expression kinetics of ISG15, IRF3, IFNγ, IL10, IL2 and IL4 genes vis-a-vis virus shedding, tissue tropism and antibody dynamics in PPRV vaccinated, challenged, infected sheep and goats. Microb Pathog 117:206–218. doi: 10.1016/j.micpath.2018.02.027. [DOI] [PubMed] [Google Scholar]
  • 20.Mehta A, Baltimore D. 2016. MicroRNAs as regulatory elements in immune system logic. Nat Rev Immunol 16:279–294. doi: 10.1038/nri.2016.40. [DOI] [PubMed] [Google Scholar]
  • 21.Jens M, Rajewsky N. 2015. Competition between target sites of regulators shapes post-transcriptional gene regulation. Nat Rev Genet 16:113–126. doi: 10.1038/nrg3853. [DOI] [PubMed] [Google Scholar]
  • 22.Berezikov E. 2011. Evolution of microRNA diversity and regulation in animals. Nat Rev Genet 12:846–860. doi: 10.1038/nrg3079. [DOI] [PubMed] [Google Scholar]
  • 23.Liu F, Du Y, Feng WH. 2017. New perspective of host microRNAs in the control of PRRSV infection. Vet Microbiol 209:48–56. doi: 10.1016/j.vetmic.2017.01.004. [DOI] [PubMed] [Google Scholar]
  • 24.Trobaugh DW, Klimstra WB. 2017. MicroRNA regulation of RNA virus replication and pathogenesis. Trends Mol Med 23:80–93. doi: 10.1016/j.molmed.2016.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Qi X, Wang T, Xue Q, Li Z, Yang B, Wang J. 2018. MicroRNA expression profiling of goat peripheral blood mononuclear cells in response to peste des petits ruminants virus infection. Vet Res 49:62. doi: 10.1186/s13567-018-0565-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Khanduri A, Ranjan Sahu A, Wani SA, Ishaq Khan RN, Pandey A, Saxena S, Malla WA, Mondal P, Rajak KK, Muthuchelvan D, Mishra B, Sahoo AP, Singh YP, Singh RK, Gandham RK, Mishra BP. 2018. Dysregulated miRNAome and proteome of PPRV infected goat PBMCs reveal a coordinated immune response. Front Immunol 9:2631. doi: 10.3389/fimmu.2018.02631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen Y, Chen J, Wang H, Shi J, Wu K, Liu S, Liu Y, Wu J. 2013. HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog 9:e1003248. doi: 10.1371/journal.ppat.1003248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chen J, Shi X, Zhang X, Wang A, Wang L, Yang Y, Deng R, Zhang GP. 2017. MicroRNA 373 facilitates the replication of porcine reproductive and respiratory syndrome virus by its negative regulation of type I interferon induction. J Virol 91:e01311-16. doi: 10.1128/JVI.01311-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhang Q, Huang C, Yang Q, Gao L, Liu HC, Tang J, Feng WH. 2016. MicroRNA-30c modulates type I IFN responses to facilitate porcine reproductive and respiratory syndrome virus infection by targeting JAK1. J Immunol 196:2272–2282. doi: 10.4049/jimmunol.1502006. [DOI] [PubMed] [Google Scholar]
  • 30.Grandvaux N, Servant MJ, tenOever B, Sen GC, Balachandran S, Barber GN, Lin R, Hiscott J. 2002. Transcriptional profiling of interferon factor 3 target genes: direct involvement in the regulation of interferon-stimulated genes. J Virol 76:5532–5539. doi: 10.1128/jvi.76.11.5532-5539.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dhanasekaran S, Biswas M, Vignesh AR, Ramya R, Raj GD, Tirumurugaan KG, Raja A, Kataria RS, Parida S, Elankumaran S, Subbiah E. 2014. Toll-like receptor responses to Peste des petits ruminants virus in goats and water buffalo. PLoS One 9:e111609. doi: 10.1371/journal.pone.0111609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schulz KS, Mossman KL. 2016. Viral evasion strategies in type I IFN signaling—a summary of recent developments. Front Immunol 7:498. doi: 10.3389/fimmu.2016.00498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang H, Du L, Liu F, Wei Z, Gao L, Feng WH. 2019. Highly pathogenic PRRSV induces IL-17 production via the activation of IRAK1-PI3K-p38MAPK-C/EBPβ/CREB pathways. J Virol 93:e01100-19. doi: 10.1128/JVI.01100-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kumar V, Torben W, Kenway CS, Schiro FR, Mohan M. 2016. Longitudinal examination of the intestinal lamina propria cellular compartment of simian immunodeficiency virus-infected rhesus macaques provides broader and deeper insights into the link between aberrant microRNA expression and persistent immune activation. J Virol 90:5003–5019. doi: 10.1128/JVI.00189-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Truong T, Boshra H, Embury-Hyatt C, Nfon C, Gerdts V, Tikoo S, Babiuk LA, Kara P, Chetty T, Mather A, Wallace DB, Babiuk S. 2014. Peste des petits ruminants virus tissue tropism and pathogenesis in sheep and goats following experimental infection. PLoS One 9:e87145. doi: 10.1371/journal.pone.0087145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Balamurugan V, Sen A, Venkatesan G, Bhanot V, Yadav V, Bhanuprakash V, Singh RK. 2012. Peste des petits ruminants virus detected in tissues from an Asiatic lion (Panthera leo persica) belongs to Asian lineage IV. J Vet Sci 13:203–206. doi: 10.4142/jvs.2012.13.2.203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pandey A, Sahu AR, Wani SA, Saxena S, Kanchan S, Sah V, Rajak KK, Khanduri A, Sahoo AP, Tiwari AK, Mishra B, Muthuchelvan D, Mishra BP, Singh RK, Gandham RK. 2017. Modulation of host miRNAs transcriptome in lung and spleen of Peste des petits ruminants virus infected sheep and goats. Front Microbiol 8:1146. doi: 10.3389/fmicb.2017.01146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yang B, Qi X, Guo H, Jia P, Chen S, Chen Z, Wang T, Wang J, Xue Q. 2018. Peste des petits ruminants virus enters caprine endometrial epithelial cells via the caveolae-mediated endocytosis pathway. Front Microbiol 9:210. doi: 10.3389/fmicb.2018.00210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fakri F, Elarkam A, Daouam S, Tadlaoui K, Fassi-Fihri O, Richardson CD, Elharrak M. 2016. Vero Nectin-4 is a highly sensitive cell line that can be used for the isolation and titration of Peste des Petits Ruminants virus. J Virol Methods 228:135–139. doi: 10.1016/j.jviromet.2015.11.017. [DOI] [PubMed] [Google Scholar]
  • 40.Khosravi M, Bringolf F, Röthlisberger S, Bieringer M, Schneider-Schaulies J, Zurbriggen A, Origgi F, Plattet P. 2016. Canine distemper virus fusion activation: critical role of residue E123 of CD150/SLAM. J Virol 90:1622–1637. doi: 10.1128/JVI.02405-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qi XF, Wang T, Li Z, Wan YL, Yang B, Zeng W, Zhang YM, Wang JY. 2019. MicroRNA-218 regulates signaling lymphocyte activation molecular (SLAM) mediated peste des petits ruminants virus infectivity in goat peripheral blood mononuclear cells. Front Immunol 10:2201. doi: 10.3389/fimmu.2019.02201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tatsuo H, Ono N, Yanagi Y. 2001. Morbilliviruses use signaling lymphocyte activation molecules (CD150) as cellular receptors. J Virol 75:5842–5850. doi: 10.1128/JVI.75.13.5842-5850.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Cosmopoulos K, Pegtel M, Hawkins J, Moffett H, Novina C, Middeldorp J, Thorley-Lawson DA. 2009. Comprehensive profiling of Epstein-Barr virus microRNAs in nasopharyngeal carcinoma. J Virol 83:2357–2367. doi: 10.1128/JVI.02104-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Baron J, Bin-Tarif A, Herbert R, Frost L, Taylor G, Baron MD. 2014. Early changes in cytokine expression in peste des petits ruminants disease. Vet Res 45:22. doi: 10.1186/1297-9716-45-22. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

RNA sequencing data are available in the Gene Expression Omnibus (GEO) under accession number GSE156378.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES