We report the whole-genome sequence of Listeria monocytogenes UKVDL9 and an edited draft genome sequence of L. monocytogenes 2010L-2198. Both are neurotropic lineage III strains; UKVDL9 was isolated from a sheep brain, and 2010L-2198 was isolated from a human subject with rhombencephalitis.
ABSTRACT
We report the whole-genome sequence of Listeria monocytogenes UKVDL9 and an edited draft genome sequence of L. monocytogenes 2010L-2198. Both are neurotropic lineage III strains; UKVDL9 was isolated from a sheep brain, and 2010L-2198 was isolated from a human subject with rhombencephalitis.
ANNOUNCEMENT
Listeria monocytogenes is a facultative intracellular bacterium that causes gastroenteritis, sepsis, meningoencephalitis, and rhombencephalitis (1). Although most cases of listeriosis occur in immunocompromised individuals, rhombencephalitis presents in young, otherwise healthy patients. This suggests that some L. monocytogenes strains have virulence factors that promote brainstem infections. We recently reported two L. monocytogenes strains that caused brainstem infections in a mouse model of foodborne listeriosis; both were classified as lineage III by the Institut Pasteur multilocus sequence typing (MLST) database (2). Strain UKVDL9 (sequence type 1140 [ST1140] by MLST analysis), provided by the University of Kentucky Veterinary Diagnostic Laboratory, was isolated from the brain of a sheep with “circling disease.” Strain 2010L-2198 (ST1590, serotype 4c), a human rhombencephalitis isolate, was provided by the CDC. Lineage III strains are not well characterized, and there has been some confusion regarding their origins and pathogenic potential (3, 4). Strain 2010L-2198 is unusual because there are no other isolates in the CDC BioNumerics database (14,788 L. monocytogenes strains collected in the United States, as of 7 January 2021) with the same ST; only three strains (one clinical isolate and two food isolates) have the same ST as UKVDL9.
The whole-genome sequence of strain UKVDL9 was generated de novo by ACGT, Inc. (Chicago, IL). A DNA library was prepared from bacteria grown in brain heart infusion (BHI) broth (16 h at 37°C) using the Illumina Nextera XT DNA sample kit and was sequenced on a MiSeq platform (v. 2.6.2.1 software) using a MiSeq 300-cycle microkit (2 × 150 bp), generating a total of 1,926,930 read pairs. An Oxford Nanopore Technologies library was prepared using a ligation sequencing kit (SQKLSK109) and a native barcoding expansion kit (EXP-NBD104) following the manufacturer’s recommended procedure. The median Nanopore read length was 7,630 bases, and the read N50 value was 17,464 bases. The raw reads were trimmed using Porechop (v. 0.2.3) (5). The genome was assembled into a singular contiguous sequence that was polished using five rounds of Pilon (v. 1.22) (6), and the polished genome was fully circularized using Circlator (v. 1.5.5) (7). Default parameters were used for all software. The 2,885,142-bp genome had a GC content of 38.24% and was annotated by the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) (v. 5.0) (8), which identified 2,722 protein-coding sequences.
A draft genome for strain 2010L-2198 containing 35 contigs was originally reported by the CDC (9). The assembled genome had 23 gaps composed of 4,099 unknown nucleotides. To close some of the gaps, primers were designed to amplify 222- to 1,225-bp fragments by PCR using genomic DNA isolated from bacteria grown in BHI broth (16 h at 37°C) as a template. Amplicons were subjected to Sanger sequencing with both forward and reverse primers (Table 1). This resulted in the addition of 918 nucleotides to the 2,860,258-bp genome (GC content, 38.07%), with most of the remaining gaps being found in 16S and 23S rRNA. Annotation by PGAP v. 5.0 (8) identified 2,739 protein-coding sequences.
TABLE 1.
Primers used for PCR and sequencing of gaps in the L. monocytogenes 2010L-2198 genome
| Gap no. | No. of Ns | Forward primer (5′ to 3′) | Reverse primer (5′ to 3′) | Start positiona | End positiona | Amplicon size (bp) | PCR typeb | Outcomec |
|---|---|---|---|---|---|---|---|---|
| 1 | 16 | GCATTAGGTGGAGAGATTGG | CCATAGTATGCTATGCCTATCGTTG | 719 | 734 | 345 | Std. | Consensus, 16 bp added |
| 2 | 69 | GCCTCTAGCTTATATTAGTGTTATGG | CCTTCTCTTTGCTTGTGTTCCG | 52435 | 52503 | 305 | Std. | Consensus, 69 bp added |
| 3 | 64 | CTAGAAATCGCCTGTTTGAGAC | GAGCTGACGGATTACTTGATTC | 454894 | 454957 | 267 | Std. | Consensus, 64 bp added |
| 4 | 69 | CCAGCTTCATTATTCATTTCTCC | CGCCTCCATCTTTTAACCACC | 630544 | 630612 | 281 | Std. | Consensus, 69 bp added |
| 5 | 149 | CCTATGGTTAATTGGTGGTATTC | GTCTCCTGTAAACATTCCACCG | 678010 | 678158 | 515 | Std. | Consensus, 149 bp added |
| 6 | 18 | CCAGAGTTAAGTAATCCAGGATACG | CAAGAGCAGCTGAAAACAACGAC | 695832 | 695849 | 1,225 | Ext. | No PCR product |
| 7 | 48 | GGAAATGCCGTTAATACTGTCAAGC | CTTCCTCAGAATCAGAACCATTTG | 946418 | 946465 | 490 | Std. | Forward sequence only, 48 bp added |
| 8 | 137 | GCGGCACTAACAGTTACAAGTACC | GACTGCAGGAATTGAACCCGCAACC | 1055767 | 1055903 | 794 | Ext. | Consensus, 137 bp added |
| 9 | 57 | GTGTCTTAACCGCTTGACCAAC | GATATTAACACAACAAGGCTTCCCC | 1245831 | 1245983 | 645 | Ext. | No PCR product |
| 10 | 87 | CTAACTGGCGAAGAAGATGAACGCC | GAAAGTGCCTATCCCTAAAGATC | 2436980 | 2437075 | 490 | Std. | No DNA sequence |
| 11 | 9 | GGTTTGTATATCCTGAGCATGGAC | CTATTCCCAACTATGAAACACCGCG | 2181852 | 2181860 | 738 | Ext. | No PCR product |
| 12 | 13 | CTTGCGCCATCGTGTACTAAGAC | GGGATTGCTTCTACGCCATCTTC | 2724201 | 2724213 | 897 | Ext. | No PCR product |
| 13 | 43 | CAAAGTAATCGCAAAATATTGGGCATCTGG | CCCTTCAACTCAATATTGTCTCGC | 2781753 | 2781795 | 425 | Ext. | Consensus, 43 bp added |
| 14 | 117 | CCCTCCTCAATTCAACTCCATCTTTTG | GGGGATAGAAACTAAGCCAGATGATTGG | 2803645 | 2803911 | 414 | Std. | Forward sequence only, 117 bp added |
| 15 | 33 | GGTAATAGAGCTGAGATCGGAAAGC | CTTGTCCAACTCAATTTGCCC | 2806090 | 2806122 | 222 | Std. | Consensus, 33 bp added |
| 16 | 63 | GAGGTATCATGATAGCGCAATTG | CCAAAGACATTTCTGACTGCGAG | 2807070 | 2807132 | 398 | Std. | Reverse sequence only, 63 bp added |
| 17 | 1 | GATAGCACTGCACCCGTCGC | CACCAAGTTCGGTCGCATTTCAC | 1535537 | 1535537 | 617 | Ext. | No PCR product |
| 18 | 1 | CCAACTGAGCTAAAGCGGCAGC | GGCGAAAAAGTTGCTGCAGACTTAG | 1769200 | 1769200 | 642 | Ext. | No PCR product |
| 19 | 62 | GCACTGTCAGGAAATACACTATCATAGGTGTCCCC | CGCTATCACCTGAAACCGAGGCAC | 2079565 | 2079626 | 1,011 | Ext. | Forward sequence only, 62 bp added |
| 20 | 48 | CATCTAATTCTTGACTGGGAGCAACC | CATGACGAATGCGCGACCAGATG | 2327984 | 2328318 | 1,109 | Ext. | Consensus, 48 bp added |
| 21 | 17 | CGCAGCACATATGACCGGTTATGAG | CCTGTTTGTTAGTGCAAGCGTAGGG | 2639718 | 2640084 | 912 | Ext. | No PCR product |
| 22 | 1 | GGTACGAATTGAAGCCCCAGTAAACGG | GGCTTTCTGGTTAGATACCGTCAAGG | 2852978 | 2852978 | 343 | Ext. | No PCR product |
| 23 | 93 | GCAAGGCACCATGCTTGAAGC | CCCAATCTCTCCACCTAATGCTCAGTG | 1 | 93 | 915 | Ext. | No DNA sequence |
Nucleotide positions refer to the original fasta sequence deposited as GenBank accession no. AAKGBO000000000.1. The newly edited version submitted to GenBank under accession no. CP069380 is the reverse complement of that sequence and was rearranged to start with the dnaA gene by convention.
PCR conditions used were as follows: standard (Std.), 2 min at 94°C; 30 s at 94°C, 30 s at 57 to 61°C, and 45 s at 72°C for 30 cycles; and 2 min at 72°C; extended (Ext.), 2 min at 94°C; 45 s at 94°C, 45 s at 61°C, and 1 min at 72°C for 35 cycles; and 2 min at 72°C. For all reactions, Invitrogen Platinum II Hot-Start PCR master mix (2×) containing Platinum II Taq Hot-Start DNA polymerase was used.
Consensus, DNA sequences for the PCR product were obtained from both the forward and reverse primers; no DNA sequence, a PCR product of the expected size was obtained, but it generated noisy reads.
Data availability.
Raw reads for UKVDL9 were deposited in the Sequence Read Archive (SRA) as accession no. SRX10056804 (Illumina) and SRX10056805 (Nanopore); the circular genome sequence can be found as GenBank accession no. CP065028. Raw reads for 2010L-2198 were deposited as BioProject no. PRJNA212117; the revised draft genome is GenBank accession no. CP069380.1.
ACKNOWLEDGMENT
This work was supported by a grant from the National Institutes of Health (grant R21AI130437) to S.E.F.D.
REFERENCES
- 1.Schlech WF, III. 2000. Foodborne listeriosis. Clin Infect Dis 31:770–775. doi: 10.1086/314008. [DOI] [PubMed] [Google Scholar]
- 2.Senay TE, Ferrell JL, Garrett FG, Albrecht TM, Cho J, Alexander KL, Myers-Morales T, Grothaus OF, D’Orazio SEF. 2020. Neurotropic lineage III strains of Listeria monocytogenes disseminate to the brain without reaching high titer in the blood. mSphere 5:e00871-20. doi: 10.1128/mSphere.00871-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Roberts A, Nightingale K, Jeffers G, Fortes E, Kongo JM, Wiedmann M. 2006. Genetic and phenotypic characterization of Listeria monocytogenes lineage III. Microbiology (Reading) 152:685–693. doi: 10.1099/mic.0.28503-0. [DOI] [PubMed] [Google Scholar]
- 4.Orsi RH, den Bakker HC, Wiedmann M. 2011. Listeria monocytogenes lineages: genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol 301:79–96. doi: 10.1016/j.ijmm.2010.05.002. [DOI] [PubMed] [Google Scholar]
- 5.Wick RR, Judd LM, Gorrie CL, Holt KE. 2017. Completing bacterial genome assemblies with multiplex MinION sequencing. Microb Genom 3:e000132. doi: 10.1099/mgen.0.000132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, Earl AM. 2014. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One 9:e112963. doi: 10.1371/journal.pone.0112963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hunt M, De Silva N, Otto TD, Parkhill J, Keane J, Harris SR. 2015. Circlator: automated circularization of genome assemblies using long sequencing reads. Genome Biol 16:294. doi: 10.1186/s13059-015-0849-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Li W, O’Neill K, Haft DH, DiCuccio M, Chetvernin V, Badretdin A, Coulouris G, Chitsaz F, Derbyshire MK, Durkin AS, Gonzales NR, Gwadz M, Lanczycki CJ, Song JS, Thanki N, Wang J, Yamashita RA, Yang M, Zheng C, Marchler-Bauer A, Thibaud-Nissen F. 2021. RefSeq: expanding the Prokaryotic Genome Annotation Pipeline reach with protein family model curation. Nucleic Acids Res 49:D1020–D1028. doi: 10.1093/nar/gkaa1105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Tarr CL, Trees E, Katz LS, Carleton-Romer HA, Stroika S, Kucerova Z, Roache KF, Sabol AL, Besser J, Gerner-Smidt P. 2019. Listeria monocytogenes strain 2010L-2198, whole genome shotgun sequencing project: submitted 6 September 2019 as GenBank accession number AAKGBO010000000. https://www.ncbi.nlm.nih.gov/nuccore/AAKGBO000000000.1?report=genbank.
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw reads for UKVDL9 were deposited in the Sequence Read Archive (SRA) as accession no. SRX10056804 (Illumina) and SRX10056805 (Nanopore); the circular genome sequence can be found as GenBank accession no. CP065028. Raw reads for 2010L-2198 were deposited as BioProject no. PRJNA212117; the revised draft genome is GenBank accession no. CP069380.1.
