Our work has identified a novel transcriptional regulator, LTTR, that regulates the production of CLA by activating the transcription of cla-dh and cla-dc, essential genes participating in CLA synthesis in Lactobacillus plantarum. This study provides insight into the regulatory mechanism of CLA synthesis and broadens our understanding of the synthesis and regulatory mechanisms of the biosynthesis of CLA.
KEYWORDS: LysR family regulator LTTR, transcriptional regulation, cla operon, conjugated linoleic acid biosynthesis, Lactobacillus plantarum
ABSTRACT
Conjugated linoleic acids (CLAs) have attracted more attention as functional lipids due to their potential physiological activities, including anticancer, anti-inflammatory, anti-cardiovascular disease, and antidiabetes activities. Microbiological synthesis of CLA has become a compelling method due to its high isomer selectivity and convenient separation and purification processes. In Lactobacillus plantarum, the generation of CLA from linoleic acids (LAs) requires the combination of CLA oleate hydratase (CLA-HY), CLA short-chain dehydrogenase (CLA-DH), and CLA acetoacetate decarboxylase (CLA-DC), which are separately encoded by cla-hy, cla-dh, and cla-dc. However, the regulatory mechanisms of CLA synthesis remain unknown. In this study, we found that a LysR family transcriptional regulator, LTTR, directly bound to the promoter region of the cla operon and activated the transcription of cla-dh and cla-dc. The binding motif was also predicted by bioinformatics analysis and verified by electrophoretic mobility shift assays (EMSAs) and DNase I footprinting assays. The lttR overexpression strain showed a 5-fold increase in CLA production. Moreover, we uncovered that the transcription of lttR is activated by LA. These results indicate that LttR senses LA and promotes CLA production by activating the transcription of cla-dh and cla-dc. This study reveals a new regulatory mechanism in CLA biotransformation and provides a new potential metabolic engineering strategy to increase the yield of CLA.
IMPORTANCE Our work has identified a novel transcriptional regulator, LTTR, that regulates the production of CLA by activating the transcription of cla-dh and cla-dc, essential genes participating in CLA synthesis in Lactobacillus plantarum. This study provides insight into the regulatory mechanism of CLA synthesis and broadens our understanding of the synthesis and regulatory mechanisms of the biosynthesis of CLA.
INTRODUCTION
Conjugated linoleic acid (CLA) is the general term for positional and geometric isomers of linoleic acid (LA) (C18:2, c9, and c12) with conjugated double bonds. Of all the individual isomers, cis-9, trans-11 CLA (c9,t11-CLA) and trans-10, cis-12 CLA (t10,c12-CLA) have been suggested to be the most common ones with physiological activities. c9,t11-CLA and t10,c12-CLA are receiving more attention due to their biological activities. Extensive studies suggested that the utilization of CLA inhibited the initiation and development of cancer (1–3), decreased atherosclerosis (4), reduced body fat by participating in fat metabolism (5–7), inhibited inflammation (8–10), promoted bone formation (11), increased muscle mass, and reduced cholesterol accumulation (12).
CLAs are widely distributed in dairy products, meat, vegetables, seafood, and their derivatives. Foods from animals contain larger amounts of CLA than those from plants, while foods from ruminants have more CLA than those from nonruminants (13). However, the amount of CLA obtained from dietary sources is too limited to gain health benefits. At present, commercial CLA is synthesized by chemical methods. However, this synthesis process leads to the production of large numbers of by-products. The products of alkaline isomerization, one of the most common chemical methods to synthesize CLA, are mixed with harmful ethylene glycol, dimethylformamide, dimethyl sulfoxide, and propylene glycol. Moreover, the CLA product is a mixture of four cis/trans CLA isomers (8,10-, 9,11-, 10,12-, and 11,13-C18:2) (14). Therefore, it is necessary to find a safe, reliable, and high-isomer-selective method for CLA synthesis.
To date, large numbers of studies have reported that many microorganisms, including rumen bacteria, Lactobacillus, Bifidobacterium, Propionibacterium, Clostridium, and some other producers, have the ability to produce c9,t11-CLA and t10,c12-CLA, which present useful physiological activities. Among these microorganisms, Lactobacillus species have attracted more attention due to their excellent characteristics, including nontoxicity, easy control of culture conditions, and health-promoting activities (15). In rumen bacteria and Propionibacterium, LA is transformed to CLA by a one-step reaction catalyzed by linoleic isomerase (16). However, the biotransformation mechanism of the transformation of LA to CLA in Lactobacillus has been reported to be much more complicated. Kishino et al. observed that hydroxy fatty acids and oxo fatty acids act as intermediates of CLA synthesis in Lactobacillus plantarum AKU 1009a (17). Research showed the combination of CLA-HY (CLA oleate hydratase), CLA-DH (CLA short-chain dehydrogenase), and CLA-DC (CLA acetoacetate decarboxylase) catalyzed the generation of CLA from LA (17). Yang et al. also confirmed that CLA synthesis in Lactobacillus plantarum ZS2058 was catalyzed by a triple-component LA isomerase encoded by the myosin cross-reactive antigen (MCRA), DH, and DC genes, as confirmed by mutant strain construction based on the cre-lox system (18). However, until now, studies on CLA focused on the screening of high-yielding strains and physiological function (19). Although there have been some reports on metabolic pathways, no research projects on the regulation system of synthetic processes have been reported.
Lactobacillus plantarum WCFS1 contains all the genes needed for CLA synthesis. CLA-HY is encoded by lp_0139 (cla-hy), while CLA-DH and CLA-DC are encoded by lp_0060 (cla-dh) and lp_0061 (cla-dc), respectively, and these two genes are located in an operon with another gene, lp_0062 (cla-er [enone reductase]). The LysR-type transcriptional regulator (LTTR) has been reported to regulate the expression of a diverse set of genes involved in metabolism, virulence, motility, and quorum sensing (20, 21). In this study, a typical LysR-type transcriptional regulator binding motif (TTAAAAGTACTAA) was identified in the regulatory region of the cla operon in Lactobacillus plantarum WCFS1. We found that LTTR directly binds to this region and activates the transcription of cla-dh and cla-dc. Additionally, CLA production was increased in an lttR overexpression strain. These results demonstrated that LTTR controls CLA accumulation by directly activating the cla operon, providing new insight into the regulatory mechanisms underlying CLA synthesis.
RESULTS
The cla operon is induced by linoleic acid in L. plantarum.
It was reported that CLA was synthesized by a multiple-step reaction in L. plantarum catalyzed by CLA oleate hydratase (CLA-HY), CLA short-chain dehydrogenase (CLA-DH), and CLA acetoacetate decarboxylase (CLA-DC) (Fig. 1B) (17). CLA-HY catalyzes hydration at the Δ9 site to generate 10-hydroxy-cis-12-octadecenoic acid, CLA-DH catalyzes the dehydrogenation of 10-hydroxy-cis-12-octadecenoic acid at the C-10 position to generate 10-oxo-cis-12-octadecenoic acid, and 10-oxo-cis-12-octadecenoic acid is then isomerized at the Δ12 site under the catalyzation of CLA-DC to produce 10-oxo-trans-11-octadecenoic acid. The generated 10-oxo-trans-11-octadecenoic acid is then hydrogenated at the C-10 site to generate 10-hydroxy-trans-11-octadecenoic acid, catalyzed by CLA-DH. The last reaction is the dehydration of the hydroxy group catalyzed by CLA-HY, generating cis-9, trans-11 CLAs.
FIG 1.
The cla operon was induced by LA in L. plantarum. (A) Gene clusters for CLA metabolic enzymes (17). (B) CLA synthesis pathway. CLA-HY, CLA oleate hydratase; CLA-DH, CLA short-chain dehydrogenase; CLA-DC, CLA acetoacetate decarboxylase. (C) Transcription levels of cla-hy, cla-dh, and cla-dc in the wild-type (WT) strain in MRS medium supplemented with LA. The fold changes represent the transcriptional levels of the indicated genes in MRS medium with LA compared with those in MRS medium. Error bars represent the standard deviations from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
By analyzing the genome of Lactobacillus plantarum WCFS1, cla-dh and cla-dc were located at the cla operon (Fig. 1A). This operon also harbored another gene, cla-er, catalyzing the saturation of the carbon-carbon double bond of CLA. To investigate the response of CLA-HY, CLA-DH, and CLA-DC to LA, we examined the transcriptional changes of their coding genes when the strains were cultured in MRS medium supplemented with 1 mg/ml LA. The results of real-time fluorescence quantitative PCR (qRT-PCR) showed that the transcriptional level of cla-dh increased 3-fold, that of cla-dc increased 5-fold, and that of cla-hy increased by 20% with the addition of LA (Fig. 1C). These results suggested that the cla operon was induced by LA in L. plantarum and indeed played a crucial role in CLA synthesis.
LttR activated the transcription of the cla operon in L. plantarum.
To identify the potential transcriptional regulator of cla-dh and cla-dc, we analyzed the genomic organization of L. plantarum WCFS1. As shown in Fig. 2A, a LysR family regulator, LTTR, encoded by lp_0057 was located upstream of the cla operon. To verify the regulatory effect of LTTR on the cla operon, lttR knockout strains (ΔlttR) and an lttR overexpression strain (PIB184-lttR) were constructed, and the transcriptional changes of cla-dh and cla-dc in wild-type (WT) and mutant strains were analyzed by qRT-PCR. These strains were cultured in MRS medium containing 1 mg/ml LA. As shown in Fig. 2B, the deletion of lttR resulted in a 43% reduction in the transcription level of cla-dh and a 36% decrease in cla-dc. The overexpression of lttR resulted in 11-fold and 13-fold upregulations of cla-dh and cla-dc, respectively. These results indicated that LTTR activated the transcription of the cla operon in L. plantarum. Next, we investigated the growth of WT and mutant strains cultured in MRS medium containing 1 mg/ml LA. As shown in Fig. 2C, the WT and mutant strains showed similar growth curves. In conclusion, LttR activated the transcription of cla-dh and cla-dc but had no significant effect on bacterial growth.
FIG 2.
LTTR activates the transcription of cla-dh and cla-dc. (A) Genetic organization of the cla operon in L. plantarum WCFS1. (B) qRT-PCR analysis of the transcriptional levels of cla-dh and cla-dc in WT, ΔlttR, and PIB184-lttR strains. Error bars represent the standard deviations from three independent experiments. (C) Growth curves of WT, ΔlttR, and PIB184-lttR strains in MRS medium with 1 mg/ml LA.
LttR binds to the promoter region of the cla operon.
The results of the above-described experiments showed that LttR regulated the transcription of cla-dh and cla-dc. To investigate whether this transcriptional regulator binds to the regulatory region of the cla operon, electrophoretic mobility shift assays (EMSAs) were performed. As shown in Fig. 3A, an obvious binding interaction was observed, as free DNA probes containing the regulatory region shifted obviously when incubated with purified recombinant LTTR (see Fig. S1 in the supplemental material), and the shifted band increased with increasing protein concentrations. To further verify the binding of LTTR to the regulatory region of the cla operon and determine the binding affinity, Octet assays were also performed using purified LTTR with different dilutions. As shown in Fig. 3B, purified LTTR bound to the biotin-labeled probes, and the dissociation constant (KD) value was 56.4 nM. These results suggest that the cla operon is transcriptionally regulated by LTTR.
FIG 3.
Binding of LTTR with the regulatory region of the cla operon. (A) EMSAs of His-LttR proteins with the promoter regions of the cla operon. The DNA probe was incubated with different concentrations of His-LttR (0, 0.03, 0.09, 0.27, and 0.81 μM). EMSAs with a 200-fold excess of an unlabeled specific probe (S) were conducted as controls. (B) Binding of the purified recombinant LTTR with the biotin-labeled probe. The concentrations of His-LTTR from top to bottom were 2, 1, 0.5, 0.25, and 0.125 μM.
Identification of the LttR binding sites in the regulatory region of the cla operon.
The LysR-type transcriptional regulator represents a widely conserved transcriptional regulator in prokaryotes. Regulators of this family have a conserved structure: a helix-turn-helix (HTH) motif at the N terminus acting as a DNA binding domain and a substrate binding domain at the C terminus. Extensive, previous studies showed that the LysR-type transcriptional regulator regulated the expression of a large number of genes, including genes involved in metabolism, virulence, motility, and quorum sensing (21). A typical LTTR binding box (TTA-N7/8-TAA) was identified upstream of cbbLSQ and cbbM (22–24). Bioinformatics analysis showed that a similar box (TTAATCGTCGTAA) existed in the regulatory region of the cla operon (Fig. 4A) (boldface type indicates that the nucleotides at this site are highly conserved). We speculated that this might be a potential binding site of LttR. To further verify this hypothesis, a DNase I footprinting assay was performed. As shown in Fig. 4B, a protected region of 12 nucleotides (TACGACGATTAA) was detected after the addition of 10 μg of purified His-LTTR. The reverse complementary sequence of this region was exactly the predicted motif (–TTAATCGTCGTAA–) at positions −154 to −143 from the translational start site. To further confirm the binding site of LTTR, the LTTR target sequence was subjected to nucleotide substitutions, and binding was verified by EMSAs. As shown in Fig. S2, no binding band was detected after mutation.
FIG 4.
Identification of the LttR binding sites in the regulatory region of the cla operon. (A) Promoter prediction of the cla promoter region. (B) DNase I footprinting analysis of the LTTR binding site at the cla regulatory region. The red line indicates the sequencing signal without protein, and the blue line indicates the sequencing signal after the protein binding reaction.
LTTR activates the production of CLA.
CLA-DH and CLA-DC were essential for CLA synthesis in L. plantarum (17, 25). The results described above show that LTTR directly binds to the regulatory region of the cla operon. The transcription of cla-dh and cla-dc was downregulated in the ΔlttR strain and upregulated in PIB184-lttR. We predicted that the overexpression of lttR may lead to an increase in CLA production. To confirm this prediction, we measured CLA production in wild-type and mutant strains. The results showed that the overexpression of lttR resulted in a CLA production increase from 10 μg/ml to 50 μg/ml. In the ΔlttR strain, the production of CLA accounted for only 16% of the production in wild-type bacteria. Taken together, these results demonstrated that LTTR was a transcriptional activator of the cla operon and promoted CLA production by the direct activation of the transcription of cla-dh and cla-dc.
Evidence that LttR is under positive autoregulation.
LysR-type regulators frequently autoregulate. In order to verify whether LttR of Lactobacillus plantarum WCFS1 has a self-regulation function, we first analyzed its regulatory region sequence. As shown in Fig. 5C, a similar LTTR binding motif (–TTATTGGGGTTAT–) was present in the regulatory region at positions −183 to −172 from the translational start site. To verify whether this is the binding site, we investigated the binding characteristics by EMSAs. As shown in Fig. 5A, the DNA probes shifted when incubated with purified LTTR, and the shifted band increased with increasing LTTR concentrations. These results indicate that LttR of Lactobacillus plantarum WCFS1 was under positive autoregulation. In this study, LttR plays a regulatory role in CLA biotransformation from LA. We speculate that it may perceive LA in the medium. To test this hypothesis, we investigated the effects of LA on lttR transcription. As shown in Fig. 5B, the addition of LA resulted in a 1.6-fold increase in lttR transcription. These results suggested that LttR was autoregulated and activated by LA.
FIG 5.
Evidence that LttR is under positive autoregulation. (A) EMSAs of His-LttR proteins with regulatory regions of lttR. The DNA probe was incubated with a protein concentration gradient (0, 0.03, 0.09, 0.27, and 0.81 μM). EMSAs with a 200-fold excess of an unlabeled specific probe (S) were conducted as controls. (B) Transcription levels of lttR in the wild-type (WT) strain in MRS medium and MRS medium supplemented with LA. (C) cis element analysis of the lttR regulatory region.
DISCUSSION
A number of microorganisms have been reported to have the ability to produce CLA, including rumen bacteria, Lactobacillus, and Bifidobacterium, etc. But according to previous studies, the CLA synthesis mechanisms in these bacteria were different. In the rumen of ruminants, CLA is an intermediate in the pathway converting LA to stearic acid. Among the many rumen bacteria, Butyrivibrio fibrisolvens was the first bacterium proven to have the ability of biohydrogenation. Linoleic acid isomerase of B. fibrisolvens has been proven to be a membrane-bound enzyme. This enzyme can catalyze c9,c12 diene bonding substrates with a free carboxyl group (including LA, α-linolenic acid, and γ-linolenic acid) and has high activity in a certain range of substrate concentrations (26). The active enzyme protein has not yet been isolated and purified, as the LA isomerase is a membrane protein. Unlike rumen bacteria, the polyunsaturated fatty acid isomerase (PAI) from Propionibacterium can use a variety of free fatty acids containing at least two methylene-separated cis-trans double bonds as the substrates, such as LA, linolenic acid (LNA) (C18:3), and long-chain fatty acids (27). Because PAI is an intracellular soluble protein and is not easily inhibited by substrates, it has been successfully expressed in many systems, such as Escherichia coli, Lactococcus lactis, and Saccharomyces cerevisiae (27–29). The crystal structure of the PAI protein was previously elucidated, with results showing that PAI contained 424 amino acids, and flavin adenine dinucleotide (FAD) was an essential cofactor (16).
Similar to rumen bacteria and Propionibacterium, scholars studying CLA biosynthesis in Lactobacillus considered that linoleate isomerase was the key to CLA biotransformation. However, when the coding gene of linoleic isomerase of Lactobacillus was expressed heterologously, no CLA was detected, but hydroxy fatty acid derived from LA was detected. Ogawa and colleagues explained that the synthesis of CLA from LA is not a one-step reaction. HY1 (10-hydroxy-trans-12-octadecenoic acid) and HY2 (10-hydroxy-cis-12-octadecenoic acid) act as intermediates in CLA synthesis in Lactobacillus acidophilus AKU 1137 (14). In 2013, Kishino et al. reported that the mechanism for CLA production in L. plantarum contains multiple reactions. The process includes hydration, dehydration, and isomerization catalyzed by three enzymes, CLA-HY, CLA-DH, and CLA-DC (17).
To date, studies on CLA have mainly focused on the screening of high-yield strains and physiological function. Research has shown that bacteria with CLA biotransformation capacities tend to have a high tolerance to LA, which is toxic to many bacteria. Therefore, it is speculated that the biotransformation of CLA may be a detoxification mechanism of bacteria (18). Microorganisms in the gastrointestinal tract interact with the host in many ways. These microorganisms metabolize and produce a variety of fatty acids, which change the fatty acid composition of the host, thus affecting the health of the host (17). Although some scholars have begun to explore the CLA synthesis mechanism, as yet, there is no report on the regulatory mechanism of the synthesis process. LTTR widely exists in prokaryotes. Stragier et al. proved that LysR acted as a transcriptional activator of lysA (the gene encoding diaminopimelate decarboxylase), which was the best-characterized member of this family at that time; therefore, it was used to provide the family name (30). LTTR retained conservatism in structure and function. At the N terminus, researchers found a DNA binding motif named HTH, and a coinducer binding domain was located at the C terminus. Originally, LTTR showed regulatory activity in activating a single divergently transcribed gene. With the development of research, more and more single and operonic genes with different functions have been reported to be transcriptionally activated or repressed by LTTR. The target genes of LTTR were involved in metabolism, virulence, oxidative stress responses, and so on. In Lactobacillus brevis, KaeR, a LysR-type transcriptional regulator, activated the transcription of LVIS1986, LVIS1987, LVIS1988, and kaeR in response to the inducer kaempferol (31).
In this study, we discovered that the novel transcriptional regulator LTTR (LysR family regulator) regulated the CLA synthesis process at transcriptional levels in L. plantarum. We found that LTTR directly bound to the promoter region of the cla operon and activated its transcription. This regulatory system promotes the biotransformation of CLA. Interestingly, LttR also responded to LA in the environment and played a self-regulating role. The transcription of lttR was upregulated when LA was added. LTTR further activated the expression of cla-dh and cla-dc and thus accelerated the biotransformation of LA to CLA (Fig. 6) to maintain the relative stability of LA concentrations. A higher concentration of CLA was detected in an lttR overexpression strain (PIB184-lttR) compared with that in the wild-type strain.
FIG 6.
LTTR sensed LA and mediated CLA synthesis regulation in L. plantarum. Blue lines indicate gene expression, black solid lines with arrows represent positive regulation, gray solid lines with arrows indicate metabolic processes, and lttR box represents the LTTR binding box.
These findings provide new insight into the regulatory mechanism of CLA biosynthesis and reveal a new metabolic engineering strategy to increase the yield of CLA.
MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions.
Bacterial strains and plasmids used in this study are listed in Table 1. L. plantarum and derivate strains were grown in MRS medium with 1.0% beef extract powder, 0.5% yeast extract, 2.0% glucose, 0.5% sodium acetate, 0.2% diammonium hydrogen citrate, 0.02% MgSO4·7H2O, 0.005% MnSO4·H2O, and 0.1% Tween 80. L. plantarum strains were cultured in MRS medium at 37°C for 12 h under aerobic conditions. The activated strains were transferred to fresh MRS medium with 1.0 μg/ml LA (Yuanye Bio-Technology Co., Ltd., Shanghai, China) at 37°C for 3 days to produce CLA. To prepare MRS medium containing 1 mg/ml LA, 30 mg/ml LA mother liquor was prepared: 300 mg LA and 200 mg Tween 80 were dissolved in water, and the volume was fixed to 10 ml. After being fully emulsified, it was filtered with a filter membrane. To avoid demulsification caused by freezing and thawing, a sterile magnetic rotor was placed during preservation, and the mixture was fully stirred before each use.
TABLE 1.
Bacterial strains and plasmids used in this study
| Bacterial strain or plasmid | Description | Reference or source |
|---|---|---|
| Bacterial strains | ||
| Lactobacillus plantarum WCFS1 | Wild type | This study |
| L. plantarum WCFS1 ΔlttR | lttR deletion mutant strain | This study |
| L. plantarum WCFS1/pIB184-lttR | lttR overexpression strain carrying pIB-lttR | This study |
| E. coli BL21(DE3) | Expression strain | Novagen |
| Plasmids | ||
| pET28a | Expression vector; Kanr | Thermo Scientific |
| pET28a-lttR | pET28a derivative carrying lttR | This study |
| pMD-18T | TA cloning vector | TaKaRa |
| pIB184 | E. coli-L. plantarum integrative shuttle vector; Ampr | Our laboratory |
| pIB-lttR | pIB184 carrying lttR for gene overexpression | This study |
Cloning, overexpression, and purification of LttR protein.
The lttR gene was amplified from Lactobacillus plantarum WCFS1 by PCR using primers lttR-F and lttR-R (Table 2). The PCR products were cloned into pET28a using a seamless cloning and assembly kit to generate recombinant vector pET28a-lttR. The recombinant vector was introduced into Escherichia coli BL21(DE3) competent cells, and a single colony was confirmed by colony PCR and sequencing analysis. LttR protein was expressed using E. coli BL21(DE3). A single positive colony was selected to start growth in 5 ml LB medium with 0.1% kanamycin overnight and then transferred to a 250-ml flask containing 50 ml LB. When the optical density at 600 nm (OD600) reached 0.7, 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added. The cells were then induced with IPTG at 20°C overnight or at 37°C for 6 h.
TABLE 2.
Primers used in this study
| Primer | Sequence (5′–3′) |
|---|---|
| LttR-F | ATGGGTCGCGGATCCGAATTCGTGAATGAACGCGATTTAAAGTACTTCTGT |
| LttR-R | CTCGAGTGCGGCCGCAAGCTTCTAATTAGCCCGTCTAATTTGACGTAGGAC |
| EMSA-cla-F | AGCCAGTGGCGATAAGGCAGTATTAAGAAAATAAATCCAATTATAATGATG |
| EMSA-cla-R | AGCCAGTGGCGATAAGGATGTTTTGCGTCCTCCTCGATG |
| EMSA-lttR-F | AGCCAGTGGCGATAAG TATTGGCATTTGCTGGTTCAATCAA |
| EMSA-lttR-R | AGCCAGTGGCGATAAG GTCAACGCCCCCATTCAATCTATTT |
| qPCR-16S-F | CACATTGGGACTGAGACACGG |
| qPCR-16S-R | CGATGCACTTCTTCGGTTGAG |
| qPCR-LttR-F | AATGTTGCGGGTGGTATTTG |
| qPCR-LttR-R | CGTGTTTAGGACGAGCGATG |
| qPCR-DH-F | TGCCGAGGTGTTGATGGTTA |
| qPCR-DH-R | GTCCGTTGGGTCGCTGTATT |
| qPCR-DC-F | TGGGTTTGCTTATGCCACTG |
| qPCR-DC-R | AACTATTCATTTCGGCTTCCTTAC |
| pMD18T-cla-F | GCAGTATTAAGAAAATAAATCCAATTATAATGATG |
| pMD18T-cla-R | GATGTTTTGCGTCCTCCTCGATG |
Cells were harvested by centrifugation at 5,000 × g for 10 min and then resuspended in 20 ml phosphate-buffered saline (PBS) buffer. The cells were disrupted using sonication, and the cell debris was removed by centrifugation at 5,000 × g for 30 min. The supernatant components were purified using a Ni-nitrilotriacetic acid (NTA) agarose column (Merck), which had been preequilibrated with binding buffer. After the supernatant component flowthrough step, the column was washed with 20 ml washing buffer (20 mM imidazole in 50 mM NaH2PO4 and 300 mM NaCl [pH 8.0]). After the washing buffer flowthrough step, the His-LttR protein was eluted using 20 to 250 mM imidazole in a solution containing 50 mM NaH2PO4 and 300 mM NaCl (pH 8.0). The fractions were checked by SDS-PAGE. The protein concentration was determined using a bicinchoninic acid (BCA) protein assay kit.
Electrophoretic mobility shift assay.
The upstream region (from positions −300 to 0) of the cla operon and lttR containing LttR binding sites were amplified by PCR with primers EMSA-cla-F/R and EMSA-lttR-F/R, respectively (Table 2). A universal biotinylated primer (5′-biotin-AGCCAGTGGCGATAAG-3′) was used to label the PCR products with biotin. The PCR products were analyzed by agarose gel electrophoresis and then purified using a PCR purification kit (Shanghai Generay Biotech). The concentration of purified biotin-labeled PCR products was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). Electrophoretic mobility shift assays (EMSAs) using His-tagged LttR were carried out according to the manual provided with the chemiluminescent EMSA kit (Beyotime Biotechnology, China), as described in our previous work (32, 33). Various amounts of purified His-tagged LttR and 1 μl (10 ng) DNA probes were incubated in a binding mixture with a total volume of 10 μl at 25°C for 20 min. The binding reaction mixture contains 10 mM Tris-HCl (pH 8.0), 50 mM NaCl, 25 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol (DTT), 0.01% Nonidet P-40, 50 μg/ml poly(dI-dC), and 10% glycerol. After the binding reaction, the samples were separated on 6% nondenaturing PAGE gels at 160 V in ice-cold 0.5× TBE (Tris-borate-EDTA) buffer. Bands were detected using BeyoECL Plus (Beyotime Biotechnology, China).
RNA preparation and RT-PCR.
L. plantarum wild-type (WT) and lttR overexpression (PIB184-lttR) strains were harvested by centrifugation at 4°C for 10 min at the indicated times. An RNA prep pure cell/bacterial kit (Tiangen Biotech, Beijing, China) was used to prepare total RNA according to our previous work (32, 34). The quality was analyzed by 1% agarose gel electrophoresis, and the concentration was determined using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). Genomic DNA was removed by DNase digestion before reverse transcription at 42°C for 5 min. Total RNA (1 μg) was reversed to cDNA using a PrimeScript RT reagent kit (TaKaRa, Japan). Fifty micrograms of cDNA was added to the PCR system in a total volume of 20 μl, and quantitative PCR (qPCR) was conducted using Hieff Unicon Power qPCR SYBR green master mix (Yeasen Biotech Co., Ltd.). The primers used for qPCR are listed in Table 2. Each PCR was performed on a LightCycler 96 qRT-PCR system (Roche Diagnostics, Switzerland). The PCR procedures were as follows: 95°C for 5 s followed by 40 cycles of denaturation at 95°C for 5 s and annealing at 60°C for 30 s. Each condition was performed in three technical replicates. 16S rRNA was used as the reference gene. The data were analyzed by using an analytical LightCycler 96 system, and the 2−ΔΔCT method was used to calculate the transcriptional fold changes.
DNase I footprinting assay.
The promoter region of the cla operon was amplified by PCR using primers pMD18T-cla-F and pMD18T-cla-R (Table 2) from Lactobacillus plantarum WCFS1. The amplicon was inserted into pMD-18T (T-vector; TaKaRa). The obtained recombinant plasmid was used as the template for further preparation of fluorescent 6-carboxyfluorescein (FAM)-labeled probes using primers M13F-47 (FAM) and M13R-48. The obtained FAM-labeled probes were purified using a QIAquick gel extraction kit (Qiagen) and then quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). The DNase I footprinting assay was performed as described previously (35, 36). In each assay, 400 ng probes was incubated with different amounts of His-LttR in a total volume of 40 μl at 25°C for 30 min. After incubation, 0.015 U DNase I (Promega) was added to digest the sample at 25°C for 1 min. One hundred forty microliters of a DNase I stop solution (30 mM EDTA, 200 mM unbuffered sodium acetate, and 0.15% SDS) was added to stop the digestion reaction. After that, the samples were extracted using phenol-chloroform and then precipitated with ethanol. The precipitated DNA was dissolved in 30 μl Milli-Q ultrapure water. Preparation of the DNA ladder, electrophoresis, and data analysis were performed as described previously (36).
Kinetic binding analysis using the Octet system.
The binding affinities of LttR for the regulatory region of the cla operon were determined using the Octet system (ForteBio, USA) based on biomembrane interference technology as described previously (33). The streptavidin biosensors were incubated in loading buffer for 5 min and then loaded with the biotinylated DNA fragment (regulatory region of the cla operon) in a 3-μg/ml solution for 5 min. The biosensors were washed in running buffer for 5 min. After that, the biosensors were transferred to different concentrations of His-LttR solutions to allow association for 10 min and then moved to running buffer to dissociate. Analyses of all samples were performed in a total volume of 200 μl in a 96-well plate at 37°C at 1,000 rpm. The loading buffer contains 100 mM HEPES, 2 mM MgCl2, 0.1 mM EDTA, and 200 mM KCl at pH 8.0. The running buffer also contains 10 μg/ml bovine serum albumin (BSA) and 0.02% Tween 20 at pH 8.0. Kinetic parameters such as kon, koff, and KD were calculated with Octet Data Analysis version 7.0 using a 1:1 binding model.
Fatty acid analysis.
Cell-free supernatants were used to determine the production of CLA by gaseous chromatography-mass spectrometry (GC-MS) and UV absorption methods. For this, a 4-ml fresh sample was vortexed with isopropanol for 30 s and then vortexed for 30 s after adding 4 ml n-hexane. After centrifugation at 5,000 × g for 5 min at 4°C, the upper part was transferred to a new pipe. These samples were used for methylation for analysis by GC-MS.
For methylation, the extracted lipid was first dried by nitrogen and then resuspended in 400 μl methanol. About 200 μl of trimethylsilyl-diazomethane was added to the sample until the yellow did not disappear and then methylated at room temperature for 15 min (17). After methylation, the liquid was dried by nitrogen and then resuspended in 1 ml n-hexane used for GC-MS analysis. The gas chromatograph-mass spectrometer system that we used was Trace 1300-ISQ (Thermo Fisher). This system was equipped with a DB-Wax column (30 m by 0.25 mm by 0.25 μm; Agilent Technology). The initial column temperature was 100°C for 2 min, which was then increased to 300°C at a rate of 10°C/min and maintained for 5 min at this temperature. The injector was operated at 300°C, and the detector was operated at 230°C. The carrier gas (helium) was at a constant flow rate of 1.0 ml/min. The peaks of the desired fatty acid were identified by comparing the retention time to standards.
Supplementary Material
ACKNOWLEDGMENTS
This work was sponsored by the Shanghai Agriculture Applied Technology Development Program, China (grant no. 2019-02-08-00-07-F01152); the Natural Science Foundation of China (grant no. 31972101); the Shanghai Sailing Program (20YF1433500); the National Science Fund for Distinguished Young Scholars (32025029); the National Key R&D Program of China (grant no. 2018YFC1604305); the Natural Science Foundation of China (grant no. 31871757); the Shanghai Technical Standard Program, China (18DZ2200200); and the Shanghai Engineering Research Center of Food Microbiology Program (19DZ2281100).
Footnotes
Supplemental material is available online only.
REFERENCES
- 1.Arab A, Akbarian SA, Ghiyasvand R, Miraghajani M. 2016. The effects of conjugated linoleic acids on breast cancer: a systematic review. Adv Biomed Res 5:115. doi: 10.4103/2277-9175.185573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lau DSY, Archer MC. 2010. The 10t,12c isomer of conjugated linoleic acid inhibits fatty acid synthase expression and enzyme activity in human breast, colon, and prostate cancer cells. Nutr Cancer 62:116–121. doi: 10.1080/01635580903191536. [DOI] [PubMed] [Google Scholar]
- 3.Flowers M, Thompson PA. 2009. t10,c12 conjugated linoleic acid suppresses HER2 protein and enhances apoptosis in SKBr3 breast cancer cells: possible role of COX2. PLoS One 4:e5342. doi: 10.1371/journal.pone.0005342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nicolosi RJ, Rogers EJ, Kritchevsky D, Scimeca JA, Huth PJ. 1997. Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atherosclerosis in hypercholesterolemic hamsters. Artery 22:266–277. [PubMed] [Google Scholar]
- 5.Castro-Webb N, Ruiz-Narvaez EA, Campos H. 2012. Cross-sectional study of conjugated linoleic acid in adipose tissue and risk of diabetes. Am J Clin Nutr 96:175–181. doi: 10.3945/ajcn.111.011858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Balci Yuce H, Akbulut N, Ocakli S, Kayir O, Elmastas M. 2017. The effect of commercial conjugated linoleic acid products on experimental periodontitis and diabetes mellitus in Wistar rats. Acta Odontol Scand 75:21–29. doi: 10.1080/00016357.2016.1244355. [DOI] [PubMed] [Google Scholar]
- 7.McFarlin BK, Strohacker KA, Kueht ML. 2009. Pomegranate seed oil consumption during a period of high-fat feeding reduces weight gain and reduces type 2 diabetes risk in CD-1 mice. Br J Nutr 102:54–59. doi: 10.1017/S0007114508159001. [DOI] [PubMed] [Google Scholar]
- 8.Cook ME, Miller CC, Park Y, Pariza M. 1993. Immune modulation by altered nutrient metabolism: nutritional control of immune-induced growth depression. Poult Sci 72:1301–1305. doi: 10.3382/ps.0721301. [DOI] [PubMed] [Google Scholar]
- 9.Olson JM, Haas AW, Lor J, McKee HS, Cook ME. 2017. A comparison of the anti-inflammatory effects of cis-9,trans-11 conjugated linoleic acid to celecoxib in the collagen-induced arthritis model. Lipids 52:151–159. doi: 10.1007/s11745-016-4228-8. [DOI] [PubMed] [Google Scholar]
- 10.Jaudszus A, Foerster M, Kroegel C, Wolf I, Jahreis G. 2005. cis-9,trans-11-CLA exerts anti-inflammatory effects in human bronchial epithelial cells and eosinophils: comparison to trans-10,cis-12-CLA and to linoleic acid. Biochim Biophys Acta 1737:111–118. doi: 10.1016/j.bbalip.2005.11.001. [DOI] [PubMed] [Google Scholar]
- 11.Kim J, Park Y, Park Y. 2014. trans-10,cis-12 CLA promotes osteoblastogenesis via SMAD mediated mechanism in bone marrow mesenchymal stem cells. J Funct Foods 8:367–376. doi: 10.1016/j.jff.2014.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ringseis R, Wen G, Saal D, Eder K. 2008. Conjugated linoleic acid isomers reduce cholesterol accumulation in acetylated LDL-induced mouse RAW264.7 macrophage-derived foam cells. Lipids 43:913–923. doi: 10.1007/s11745-008-3226-x. [DOI] [PubMed] [Google Scholar]
- 13.Fritsche J, Steinhart H. 1998. Amounts of conjugated linoleic acid (CLA) in German foods and evaluation of daily intake. Z Lebensm Unters Forsch A 206:77–82. doi: 10.1007/s002170050218. [DOI] [Google Scholar]
- 14.Ogawa J, Matsumura K, Kishino S, Omura Y, Shimizu S. 2001. Conjugated linoleic acid accumulation via 10-hydroxy-12-octadecaenoic acid during microaerobic transformation of linoleic acid by Lactobacillus acidophilus. Appl Environ Microbiol 67:1246–1252. doi: 10.1128/AEM.67.3.1246-1252.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Yang B, Gao H, Stanton C, Ross RP, Zhang H, Chen YQ, Chen H, Chen W. 2017. Bacterial conjugated linoleic acid production and their applications. Prog Lipid Res 68:26–36. doi: 10.1016/j.plipres.2017.09.002. [DOI] [PubMed] [Google Scholar]
- 16.Liavonchanka A, Hornung E, Feussner I, Rudolph MG. 2006. Structure and mechanism of the Propionibacterium acnes polyunsaturated fatty acid isomerase. Proc Natl Acad Sci U S A 103:2576–2581. doi: 10.1073/pnas.0510144103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kishino S, Takeuchi M, Park SB, Hirata A, Kitamura N, Kunisawa J, Kiyono H, Iwamoto R, Isobe Y, Arita M, Arai H, Ueda K, Shima J, Takahashi S, Yokozeki K, Shimizu S, Ogawa J. 2013. Polyunsaturated fatty acid saturation by gut lactic acid bacteria affecting host lipid composition. Proc Natl Acad Sci U S A 110:17808–17813. doi: 10.1073/pnas.1312937110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yang B, Qi H, Gu Z, Zhang H, Chen W, Chen H, Chen YQ. 2017. Characterization of the triple-component linoleic acid isomerase in Lactobacillus plantarum ZS2058 by genetic manipulation. J Appl Microbiol 123:1263–1273. doi: 10.1111/jam.13570. [DOI] [PubMed] [Google Scholar]
- 19.Li H, Liu Y, Bao Y, Liu X, Zhang H. 2012. Conjugated linoleic acid conversion by six Lactobacillus plantarum strains cultured in MRS broth supplemented with sunflower oil and soymilk. J Food Sci 77:M330–M336. doi: 10.1111/j.1750-3841.2012.02723.x. [DOI] [PubMed] [Google Scholar]
- 20.Sperandio V, Li CC, Kaper JB. 2002. Quorum-sensing Escherichia coli regulator A: a regulator of the LysR family involved in the regulation of the locus of enterocyte effacement pathogenicity island in enterohemorrhagic E. coli. Infect Immun 70:3085–3093. doi: 10.1128/iai.70.6.3085-3093.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Maddocks SE, Oyston PCF. 2008. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology (Reading) 154:3609–3623. doi: 10.1099/mic.0.2008/022772-0. [DOI] [PubMed] [Google Scholar]
- 22.Dubbs JM, Tabita FR. 2003. Interactions of the cbbII promoter-operator region with CbbR and RegA (PrrA) regulators indicate distinct mechanisms to control expression of the two cbb operons of Rhodobacter sphaeroides. J Biol Chem 278:16443–16450. doi: 10.1074/jbc.M211267200. [DOI] [PubMed] [Google Scholar]
- 23.Padungsri D, Dubbs JM, Robert T. 2004. Effector-mediated interaction of CbbRI and CbbRII regulators with target sequences in Rhodobacter capsulatus. J Bacteriol 186:8026–8035. doi: 10.1128/JB.186.23.8026-8035.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Smith SA, Tabita FR. 2002. Up-regulated expression of the cbbI and cbbII operons during photoheterotrophic growth of a ribulose 1,5-bisphosphate carboxylase-oxygenase deletion mutant of Rhodobacter sphaeroides. J Bacteriol 184:6721–6724. doi: 10.1128/jb.184.23.6721-6724.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yang B, Chen H, Gao H, Ren Q, Zhang H, Chen W. 2020. Genetic determinates for conjugated linolenic acid production in Lactobacillus plantarum ZS2058. J Appl Microbiol 128:191–201. doi: 10.1111/jam.14466. [DOI] [PubMed] [Google Scholar]
- 26.Kepler CR, Tove SB. 1967. Purification and properties of a linoleate delta-12-cis, delta-11-trans-isomerase from Butyrivibrio fibrisolvens. J Biol Chem 242:5686–5692. [PubMed] [Google Scholar]
- 27.Hornung E, Krueger C, Pernstich C, Gipmans M, Porzel A, Feussner I. 2005. Production of (10E,12Z)-conjugated linoleic acid in yeast and tobacco seeds. Biochim Biophys Acta 1738:105–114. doi: 10.1016/j.bbalip.2005.11.004. [DOI] [PubMed] [Google Scholar]
- 28.Deng M-D, Grund AD, Schneider KJ, Langley KM, Wassink SL, Peng SS, Rosson RA. 2007. Linoleic acid isomerase from Propionibacterium acnes: purification, characterization, molecular cloning, and heterologous expression. Appl Biochem Biotechnol 143:199–211. doi: 10.1007/s12010-007-8075-1. [DOI] [PubMed] [Google Scholar]
- 29.Rosberg-Cody E, Johnson MC, Fitzgerald GF, Ross PR, Stanton C. 2007. Heterologous expression of linoleic acid isomerase from Propionibacterium acnes and anti-proliferative activity of recombinant trans-10, cis-12 conjugated linoleic acid. Microbiology (Reading) 153(Part 8):2483–2490. doi: 10.1099/mic.0.2006/001966-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Stragier P, Richaud F, Borne F, Patte JC. 1983. Regulation of diaminopimelate decarboxylase synthesis in Escherichia coli. I. Identification of a lysR gene encoding an activator of the lysA gene. J Mol Biol 168:307–320. doi: 10.1016/s0022-2836(83)80020-5. [DOI] [PubMed] [Google Scholar]
- 31.Pande SG, Pagliai FA, Gardner CL, Wrench A, Narvel R, Gonzalez CF, Lorca GL. 2011. Lactobacillus brevis responds to flavonoids through KaeR, a LysR-type of transcriptional regulator. Mol Microbiol 81:1623–1639. doi: 10.1111/j.1365-2958.2011.07796.x. [DOI] [PubMed] [Google Scholar]
- 32.Liu XX, Shen MJ, Liu WB, Ye BC. 2018. GlnR-mediated regulation of short-chain fatty acid assimilation in Mycobacterium smegmatis. Front Microbiol 9:1311. doi: 10.3389/fmicb.2018.01311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Liu W-B, Liu X-X, Shen M-J, She G-L, Ye B-C. 2019. The nitrogen regulator GlnR directly controls transcription of the prpDBC operon involved in methylcitrate cycle in Mycobacterium smegmatis. J Bacteriol 201:e00099-19. doi: 10.1128/JB.00099-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Xu Z, Wang M, Ye BC. 2017. TetR family transcriptional regulator PccD negatively controls propionyl coenzyme A assimilation in Saccharopolyspora erythraea. J Bacteriol 199:e00281-17. doi: 10.1128/JB.00281-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Liao CH, Yao LL, Ye BC. 2014. Three genes encoding citrate synthases in Saccharopolyspora erythraea are regulated by the global nutrient-sensing regulators GlnR, DasR, and CRP. Mol Microbiol 94:1065–1084. doi: 10.1111/mmi.12818. [DOI] [PubMed] [Google Scholar]
- 36.Wang Y, Cen XF, Zhao GP, Wang J. 2012. Characterization of a new GlnR binding box in the promoter of amtB in Streptomyces coelicolor inferred a PhoP/GlnR competitive binding mechanism for transcriptional regulation of amtB. J Bacteriol 194:5237–5244. doi: 10.1128/JB.00989-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.