Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 May 7;11:9771. doi: 10.1038/s41598-021-89087-6

Intestinal mucosa-derived DNA methylation signatures in the penetrating intestinal mucosal lesions of Crohn’s disease

Yuan Li 1,2, Zhiming Wang 1, Xiuwen Wu 1, Gefei Wang 1, Guosheng Gu 1, Huajian Ren 1, Zhiwu Hong 1, Jianan Ren 1,
PMCID: PMC8105344  PMID: 33963246

Abstract

The purpose of this study was to evaluate genome-wide DNA methylation changes in intestinal mucosa tissue of adult patients with Crohn's disease comprehensively. DNA methylation chip was used to analyze abnormal methylation sites among penetrating and non-penetrating intestinal mucosa tissue of Crohn's disease and normal intestinal mucosa tissue of healthy controls. Methylation abnormalities of different locus were verified by pyrosequencing and quantitative polymerase chain reaction. Differential DNA methylation sites were participated in the positive regulation of apoptosis and the positive regulation of IL-8 production and were enriched in signaling pathways related to inflammatory bowel disease and extracellular matrix receptor interaction signaling pathways. Correlation analysis showed that the methylation abnormalities of HLA-DRB1 (r = − 0.62, P < 0.001), MUC1 (r = − 0.45, P = 0.01), YPEL5 (r = − 0.55, P = 0.001) and CBLB (r = − 0.62, P < 0.001) were significantly negatively correlated with their relative expression levels. The degree of methylation abnormality of MUC1 was negatively correlated with the disease activity score of Crohn's disease (r = − 0.50, P = 0.01). Apoptosis, interleukin-8 production and abnormal extracellular matrix might be involved in the mechanism of penetrating intestinal mucosal lesions in Crohn's disease. The degree of abnormal methylation of MUC1 was negatively correlated with the disease activity of Crohn's disease.

Subject terms: Clinical genetics, Epigenetics, Inflammatory bowel disease, Intestinal diseases

Introduction

Crohn's disease (CD) was a chronic recurrent intestinal disease that primarily affected the end of the small intestine and the beginning of the colon1. Penetrating intestinal mucosal lesions2, including intestinal perforation and intestinal fistula, was one of the serious complications of CD. At present, the etiology of CD was still not clear, and the mainstream opinion was that CD was caused by the complex interaction of multiple factors (including genetic variation, intestinal flora, host immune system and environmental factors). Genome-wide association study (GWAS)3 had identified more than 100 CD-related susceptibilities genetic locus. However, in the actual study4, only a small proportion (13.6%) of CD patients were observed with genetic variation, suggesting that non-genetic factors (such as intestinal flora, environmental factors, etc.) accounted for a certain proportion of CD etiology. Epigenetics, as an important crucial connection between genetic factors and non-genetic factors5, was bound to play an important role in the pathogenesis of CD.

Early studies69 mainly focused on DNA methylation changes in peripheral blood of CD, while only a few studies10,11 noticed the changes in intestinal mucosal tissue of CD. The intestinal mucosal tissue was the most direct joint point among the human body, external environment and intestinal flora, and it contained a rich and complex intestinal immune system. Therefore, the DNA methylation status of the intestinal mucosal tissue of CD was worth further investigation. Besides, the research interests of previous studies12,13 on CD intestinal mucosal tissue methylation had focused on the secondary carcinogenesis of CD-related colitis, but were rarely involved in the more common penetrating intestinal mucosal lesions of CD. The mechanism of penetrating intestinal mucosal lesions in CD was still unknown. Once penetrating intestinal mucosal lesions occurred in CD patients, surgical intervention was often required, and medical risks and costs were greatly increased14. Therefore, exploring the pathogenesis of penetrating intestinal mucosal lesions in CD patients and screening molecular markers might be contributed to the early detection and intervention of the lesions.

The purpose of this study was to use DNA methylation chip to comprehensively evaluate the genome-wide DNA methylation changes in the intestinal mucosal tissue of adult CD patients, and to compare the DNA methylation status with that of healthy controls to screen the differential DNA methylation sites. By exploring different epigenetic regulation signaling pathways in the intestinal mucosal tissue of CD patients, new ideas could be provided to clarify the pathogenesis of CD and screen potential biomarkers, to improve the diagnosis and treatment of CD.

Results

Basic information of patients in both groups

All 7 CD patients enrolled in the CD group were male, with an average age of 31.3 ± 8.3 years. All sampling sites were ileum. After strict age and sex matching between CD group and healthy control group, gender and age data were consistent, and the sampling sites were all ileum. The baseline characteristics of the patients were shown in Supplementary Tables S1 and S2.

Quality control of methylated chips

Principal component analysis (Supplementary Fig. S1) showed that the CD group (red and blue squares) and the control group (blue squares) were distributed in different areas in the two-dimensional space, indicating that the samples were reasonably grouped and had good in-group repeatability.

Differential DNA methylation sites among CD penetrating and CD non-penetrating intestinal mucosal tissue and normal intestinal mucosal tissue

Comparisons of CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue, a total of 5200 different DNA methylation sites were screened. There were 2978 hypermethylation sites and 2222 demethylation sites. Comparison of CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue, a total of 3237 different DNA methylation sites were identified. There were 1157 hypermethylation sites and 2080 demethylation sites.

Volcano plots

Comparisons of CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue, several sites with the highest degree of hypermethylation and demethylation were screened by drawing volcano plots (Fig. 1A) as follows (Table 1): Hypermethylation sites (KCNJ13; GIGYF2, C7orf72 and HLA-DRB1); Demethylation sites (HERPUD2, MUC1, and TMTC2). Comparison of CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue, several sites with the highest degree of hypermethylation and demethylation were screened by drawing volcano plots (Fig. 1B) as follows (Table 2): Hypermethylation sites (MTSS1, YPEL5, EFCAB11 and CBLB); Demethylation sites (PLEKHG1, LINC01506 and KIAA0753).

Figure 1.

Figure 1

Volcano Plots. (A) Comparisons of differential DNA methylation sites between CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue; (B) Comparisons of differential DNA methylation sites between CD penetrating and non-penetrating intestinal mucosal tissue. Figures were performed with affy R package (Version 3.6.1, https://www.r-project.org).

Table 1.

Differential DNA methylation sites information between CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue.

Methylation state Gene name Target ID Gene ID Delta_Beta value Diffscore value Chromosome
Up KCNJ13;GIGYF2 cg03946744 3769;26058 0.2422366 25.99213 2
Up C7orf72 cg20233834 100130988 0.1600762 68.88832 7
Up HLA-DRB1 cg09949906 3123 0.2346621 16.65833 6
Down HERPUD2 cg23759826 64224 − 0.09881615 − 73.61388 7
Down MUC1 cg00930306 4582 − 0.2432761 − 62.10949 1
Down TMTC2 cg07690222 160335 − 0.1874332 − 64.20343 12

Table 2.

Differential DNA methylation sites information between CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue.

Methylation state Gene name Target ID Gene ID Delta_ Beta value Diffscore value Chromosome
Up MTSS1 cg13992976 9788 0.1865852 48.12816 8
Up YPEL5 cg26462319 51646 0.1361087 67.35131 2
Up EFCAB11 cg26886948 90141 0.2068419 65.19701 14
Up CBLB cg21116912 868 0.1975454 63.97843 3
Down PLEKHG1 cg26116556 57480 − 0.1961553 − 70.83961 6
Down LINC01506 cg10940369 101927015 − 0.16296 − 63.23583 9

Cluster analysis

Comparisons of CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue

According to the 5200 differential DNA methylation sites screened by the methylation chips, the CD penetrating intestinal mucosal tissue were compared with the normal intestinal mucosal tissue for cluster analysis. We found that the methylation status of the two groups were significantly different (Fig. 2A).

Figure 2.

Figure 2

Cluster analysis of CD penetrating intestinal mucosal tissue and normal intestinal mucosal tissue. (A) The overall; (B) Top 20 highest degree of hypermethylation and demethylation sites; Cluster analysis of CD penetrating and non-penetrating intestinal mucosal tissue. (C) The overall; (D) Top 20 highest degree of hypermethylation and demethylation sites. The serial numbers at the bottom of (A) and (C) presented: (A) CD penetrating intestinal mucosal tissue; (B) CD non-penetrating intestinal mucosal tissue; X: normal intestinal mucosal tissue. Figures were performed with affy R package (Version 3.6.1, https://www.r-project.org).

According to the clustering analysis of previously screened top 20 highest degree of hypermethylation and demethylation sites (Fig. 2B), CD intestinal mucosal tissue and normal intestinal mucosal tissue could be distinguished and classified completely.

Comparisons of CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue

According to the 3237 differential DNA methylation sites screened by the methylation chips, CD penetrating intestinal mucosal tissue were compared with non-penetrating intestinal mucosal tissue for cluster analysis. It was found that the methylation status of the two groups were significantly different (Fig. 2C).

According to the clustering analysis of previously screened top 20 highest degree of hypermethylation and demethylation sites (Fig. 2D), CD penetrating and non-penetrating intestinal mucosal tissue and normal mucosal tissue could be distinguished and classified completely.

GO analysis

Comparisons of CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue

As shown in Fig. 3A, differential DNA methylation sites were enriched in the positive regulation of the apoptotic process and the positive regulation of interleukin-8 production in the biological process.

Figure 3.

Figure 3

Go analysis. (A) Comparisons of differential DNA methylation sites between CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue; (B) Comparisons of differential DNA methylation sites between CD penetrating and non-penetrating intestinal mucosal tissue. GO data were downloaded from GO website (http://geneontology.org).

Comparisons of CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue

As shown in Fig. 3B, differential DNA methylation sites were enriched in the renal duct development and the regulation of chemotaxis in the biological process.

KEGG analysis

Comparisons of CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue

Pathway analysis of differential DNA methylation sites with KEGG database showed that the differentially expressed sites were mainly concentrated in signal pathways associated with IBD (Fig. 4A).

Figure 4.

Figure 4

KEGG analysis. (A) Comparisons of differential DNA methylation sites between CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue; (B) Comparisons of differential DNA methylation sites between CD penetrating and non-penetrating intestinal mucosal tissue. KEGG pathways were downloaded from KEGG website (https://www.kegg.jp). The permission was provided by Kanehisa laboratory.

Comparisons of CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue

Pathway analysis of differential DNA methylation sites with KEGG database showed that the differentially expressed sites were mainly concentrated in signal pathways associated with ECM-receptor interaction signal pathway (Fig. 4B).

Verification of methylation chip results

The verification of pyrosequencing

As shown in Fig. 5A, the methylation abnormality degrees of HLA-DRB1, YPEL5 and CBLB in the intestinal mucosal tissue of the CD group were significantly higher than that of the control group (P < 0.001, as shown in figure ***, the same below), while that of MUC1 was significantly lower (P < 0.001).

Figure 5.

Figure 5

(A) The methylation abnormality degrees of HLA-DRB1, YPEL5, CBLB and MUC1 in the intestinal mucosal tissue of the CD group were verified by pyrosequencing. (B) The relative expression levels of HLA-DRB1, YPEL5, CBLB and MUC1in the intestinal mucosal tissue of CD group were tested by qPCR. (C) Correlation between methylation abnormality degrees of HLA-DRB1, YPEL5, CBLB and MUC1 and gene expression level. (D) Correlation between methylation degree of MUC1 and disease activity of CD. Figures were performed with Prism (Version 6.0c, https://www.graphpad.com/scientific-software/prism/).

The verification of gene expression levels

As shown in Fig. 5B, compared with the control group, the relative expression levels of HLA-DRB1, YPEL5 and CBLB in the intestinal mucosal tissue of CD group were significantly reduced by qPCR (P < 0.001), while the relative expression levels of MUC1 were significantly increased (P < 0.001).

Correlation between methylation abnormality degrees and gene expression levels

According to the correlation analysis (Fig. 5C), the methylation abnormality degrees of HLA-DRB1 (r = − 0.62, P < 0.001), MUC1 (r = − 0.45, P = 0.01), YPEL5 (r = − 0.55, P = 0.001) and CBLB (r = − 0.62, P < 0.001) were found to have significant negative correlations with their relative expression levels in the intestinal mucosal tissue in CD group and control group.

Correlation between methylation degree of MUC1 and disease activity of CD

The CDAI scores of CD group were evaluated and calculated on the day of sampling. Through correlation analysis (Fig. 5D), methylation abnormality degree of MUC1 in the intestinal mucosa of CD group was negatively correlated with the corresponding CDAI scores (r = 0.50, P = 0.01), while methylation abnormality degrees of HLA-DRB1 (r = 0.02, P = 0.91), YPEL5 (r = 0.33, P = 0.11) and CBLB (r = 0.08, P = 0.71) were not correlated with CDAI scores.

The fold changes of DEGs among GSE95095, GSE83448, GSE103027 and GSE102133

Heat maps were generated to visualize the fold changes (FC) of expressed genes between CD and normal controls from different studies. As shown in Fig. 6, heat maps were generated with R based on the FC of selected DEGs (HLA-DRB1, YPEL5, CBLB and MUC1) in GSE95095, GSE83448, GSE103027 and GSE102133. The red columns represented up-regulated (FC > 1), while the blue ones represented downregulated (FC > 1). The depth of color was positively correlated with FC values.

Figure 6.

Figure 6

The fold changes of DEGs among GSE95095, GSE83448, GSE103027 and GSE102133. The GEO databases were obtained from NCBI-GEO databases (https://www.ncbi.nlm.nih.gov/geo). Figures were performed with affy R package (Version 3.6.1, https://www.r-project.org).

Discussion

In this study, we used Illumina HD 850 K DNA methylation chips were used to screen the abnormal DNA methylation sites in intestinal mucosal tissue of CD with penetrating intestinal mucosal lesions in the study. We recruited a large cohort of CD patients and health control, and developed the pyrosequencing was used to verify the differential sites of DNA methylation screened by methylated chips, and MUC1, a new molecular marker. We obtained potential early clinical diagnosis of CD-penetrating intestinal mucosal lesions by this novel assay.

DNA methylation played an important role in gene expression15,16. In most cases, gene promoter methyl attachment (hypermethylation) was associated with gene silencing or inactivation. Conversely, hypomethylation of gene promoters activated transcription. Therefore, hypermethylation of DNA sites resulted in down-regulated expression of corresponding genes, while demethylation resulted in up-regulated expression of the corresponding genes17.

By strictly matching the age and gender of the experimental group and the control group in the early stage, the bias of age and gender on the final results was minimized. A total of 5200 sites of differential DNA methylation were screened by comparing CD penetrating intestinal mucosal tissue with normal intestinal mucosal tissue. There were 2978 hypermethylation sites and 2222 demethylation sites. The highest degree of differential hypermethylation sites included KCNJ13; GIGYF2, C7orf72, and HLA-DRB1, and differential demethylation sites included HERPUD2, MUC1, and TMTC2. A total of 3237 differential DNA methylation sites were identified by comparing CD penetrating intestinal mucosal tissue with non-penetrating intestinal mucosal tissue. There were 1157 hypermethylation sites and 2080 demethylation sites. The most differential hypermethylation locus included MTSS1, YPEL5, EFCAB11 and CBLB, and differential demethylation locus included PLEKHG1, LINC01506 and KIAA0753. Most of the differential hypermethylated and hypomethylated CpG sites were located in the body. Only few of them, like PLEKHG1 and KIAA0753 were located in 5′UTR. The differentiated methylated regions directly affected gene expression. This was worth in-depth study in the future.

By screening the differential methylation sites, CD penetrating intestinal mucosal tissue, non-penetrating intestinal mucosal tissue and normal intestinal mucosal tissue could be well distinguished. The results also showed that the differential DNA methylation sites were involved in the positive regulatory process of apoptosis and the positive regulatory process of IL-8 production, and were enriched in the inflammatory bowel disease related signaling pathways and extracellular matrix receptor interaction signaling pathways.

The methylation degrees of HLA-DRB1, MUC1, YPEL5 and CBLB were verified by pyrosequencing method. Compared with the control group, the methylation levels of HLA-DRB1, YPEL5 and CBLB sites in the intestinal mucosal tissue of the CD group were significantly increased, while the methylation level of MUC1 site was significantly reduced. Comparing the relative expression levels of the four genes, it was found that the relative expression levels of HLA-DRB1, YPEL5 and CBLB in the CD group were significantly reduced, while the relative expression level of MUC1 gene was significantly increased. Correlation analysis showed that the abnormal degrees of the four methylation sites was negatively correlated with their relative expression levels. The analysis of methylation levels and CD disease activity showed that the abnormal methylated status of MUC1 was negatively correlated with CDAI scores.

In comparing the differential DNA methylation sites screened by CD penetrating intestinal mucosal tissue and normal intestinal mucosal tissue, C7orf7218 and HLA-DRB119 were the susceptibility genetic locus that had been confirmed by GWAS studies to be related to the pathogenesis of CD. Using GWAS, HLA-DRB1 was selected as the susceptibility gene of CD in CD patients in Chinese20, Japanese21, British22 and African American23 populations. Studies had also found that HLA-DRB1 was related to the polymorphism of IL-10 gene24, and IL-10 gene abnormality was involved in the important mechanisms of CD25.

MUC1, as a selective methylation site, was involved in the regulation of mucin-1 expression. Mucin-1 was a major product which secreted by goblet cells26 and was a component of ECM27. Recent studies2832 had found that the expression of MUC1 in CD was significantly increased. This was consistent with the fact that methylation of MUC1 was reduced in this study. Interestingly, the MUC1 expression in CD was reduced in earlier studies33,34. In addition, studies3538 had confirmed that MUC1 was confirmed to be involved in multiple apoptosis signaling pathways.

In comparing the differential DNA methylation sites screened by CD penetrating intestinal mucosal tissue and non-penetrating intestinal mucosal tissue, YPEL539 had been proved to be involved in the mitochondrial dependent apoptosis process caused by DNA damage. CBLB was regulated by the NF-κb signaling pathway and was involved in the activation of T cells and macrophages40.

Through screening of top 20 highest degree of hypermethylation and demethylation sites, CD penetrating intestinal mucosal tissue, non-penetrating intestinal mucosal tissue and normal intestinal mucosal tissue could be well distinguished, indicating that these differential methylation sites could be used as molecular markers to guide the diagnosis and therapy of CD in the future.

By GO analysis41,42, we found that the differential DNA methylation sites were involved in the positive regulatory process of apoptosis and the positive regulatory process of IL-8 production. It was found that the apoptosis process was significantly enhanced in CD43, especially in the penetrating lesions. Tight junction proteins were also shown to be closely related to the apoptosis process in CD44. The secretion of IL-8 in CD was also significantly increased45,46, and some studies47 had used it as a biomarker. IL-8 and MUC1 were both important factors involved in the pathophysiological process of CD28,38.

Through KEGG analysis48,49, our study found that the methylation site of CD was enriched in the classic IBD pathway. Previous research50 had explored that the epigenetic modifications of the classic pathway in IBD (nuclear factor Kappa-B Signaling Pathway) and its impact on IBD. The results confirmed again that the selected differential methylation sites could be used as molecular markers for the diagnosis of CD. The methylation sites associated with penetrating inflammatory lesions were concentrated in the related pathways of ECM receptor interaction. Recent studies51,52 had also found that ECM-receptor interaction was closely related to the course of CD.As mentioned earlier, mucin-1 was one of the components of ECM. The formation of CD penetrating intestinal mucosal lesions was suggested to be the result of the destruction of ECM53, while the abnormal MUC1 expression product mucin-1 just explained the origin of CD penetrating intestinal mucosal lesions, indicating that intestinal mucosal penetrating lesions are correlated with ECM. However, as mentioned above, the expression of MUC1 in CD was still controversial and needs further study to clarify.

In this study, high-throughput technology was used to screen the differential DNA methylation sites related to CD penetrating intestinal mucosal diseases through methylation chips. Using the selected methylation sites, CD penetrating intestinal mucosal tissue and non-penetrating intestinal mucosal tissue could be well distinguished from normal intestinal mucosal tissue. Among the selected methylation sites, C7orf7218 and HLA-DRB119 had been confirmed to be related to CD by GWAS. As mentioned previously, MUC13538 and YPEL539 were genes involved in the process of apoptosis, which proved that CD penetrating intestinal mucosal lesions were related to apoptosis. Methylation abnormalities in MUC1 also suggested that CD penetrating intestinal mucosal lesions were associated with ECM abnormalities. The results of GO analysis and KEGG analysis confirmed the above conclusions again.

Pyrosequencing54 was a common method for quantifying the abnormal degrees of methylation. Using pyrosequencing method, it was found that the abnormal degree of four methylation sites in CD group was consistent with the results of the methylation chip in the previous study. QPCR was used to detect the relative expression levels of the four genes, which was also consistent with the abnormal degrees of methylation. Correlation analysis showed that the abnormal degrees of methylation and relative expression levels of the four sites were significantly correlated, which confirmed that the four differential methylation sites screened by methylated chips, namely HLA-DRB1, MUC1, YPEL5 and CBLB, were reliable and correlated with the process of CD penetrating intestinal mucosal lesions.

CDAI scores of CD group was further analyzed, and correlation analysis was used to explore the relationship between methylation abnormality degree and disease activity degree. It was found that methylation abnormality degree of MUC1 was negatively correlated with CDAI score. The results suggested that MUC1 could be used as a molecular marker of CD activity. In the future, the disease activity of CD could be predicted by detecting the methylation level of MUC1. For CD patients with atypical clinical manifestations and insignificant endoscopic or imaging manifestations, the discovery of novel biomarkers might be helped to make a definite diagnosis earlier, providing a possibility for early intervention of CD disease course.

We had also compared the four significant DEGs (HLA-DRB1, YPEL5, CBLB and MUC1) among four independent studies. By comparing the DEGs, some trends of gene expressions were consistent with our study, especially the MUC1. Among the four independent studies, the expression levels of MUC1 were all up-regulated , which were the same as our study.

In previous studies on DNA methylation of CD, peripheral blood samples7,8,11,5557 were often used. Some DNA hypermethylated genes in peripheral blood of CD were considered as promising new biomarkers for CD5860. However, intestinal mucosal tissue might be more suitable for epigenetic studies as a bridge between the internal environment of the body and the external environment and intestinal flora. Furthermore, research61 that related to DNA methylation in intestinal mucosal tissue as biomarkers had achieved some initial results. Although existing research62 confirmed a moderate-strong correlation between methylation levels in colon biopsies and peripheral blood samples. However, the methylation levels in peripheral blood samples as biomarkers remained to be debated63. The results pointed to a new research direction. The differences of methylation profiles between intestinal mucosal tissue and peripheral blood specimens could be conducted in the further study. In the field of inflammatory bowel diseases, previous studies6466 had focused on the relationship between DNA methylation abnormalities and CD-related colorectal canceration.

The sample size of this study was small. Although the selected differential methylation sites suggested the possible mechanism of CD penetrating intestinal mucosal lesions, further studies were needed to verify the above findings. As mentioned above, the expression of MUC1 gene was different in different literatures, which also need further research and verification. Secondly, only four different methylation sites that had been studied a lot in the past were selected for verification. The verification of other sites need to be completed in the future. Finally, as a participant in the process of apoptosis and the formation of ECM, the mechanism of MUC1 in CD penetrating intestinal mucosal lesions also need further study.

In summary, through methylation chip technology, this study screened out gene locus related to the pathogenesis of CD penetrating intestinal mucosal diseases, such as C7orf72, HLA-DRB1, MUC1, YPEL5, CBLB, etc. CD—penetrating intestinal mucosal lesions were also associated with apoptosis, IL-8 production, and ECM abnormalities. The methylation of HLA-DRB1, YPEL5 and CBLB was abnormally increased in CD penetrating intestinal mucosal lesions, while the methylation of MUC1 was decreased. The methylation abnormality of MUC1 was negatively correlated with CD disease activity.

At present, CD was a disease with unclear pathogenesis. With the increasing incidence of CD all over the world, more and more patients were troubled by its diverse clinical manifestations and complicated complications. The study provided a new direction for the study of the pathogenesis of CD. By exploring the abnormal sites of DNA methylation in CD, it could provide provide an effective basis for screening novel biomarkers and therapeutic targets, so as to improve the prognosis of patients and reduce medical expenses..

Methods

Ethical approval

The study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Jinling Hospital. The study was registered on the Clinical Trials (No. : NCT03272152). Informed consent was obtained from all patients and healthy volunteers before their enrollment in this study.

Patients

The study included two cohorts of patients.

  1. Seven CD patients who underwent colonoscopy in Jinling Hospital in November 2016 were randomly selected among outpatients. All 7 patients were diagnosed with CD and were active. 7 healthy people were matched with age and sex as the control group.

  2. Twenty-five CD patients and seven healthy controls who underwent colonoscopy in Jinling Hospital in January 2017 were randomly selected for colonoscopy in Jinling Hospital. All 25 patients were diagnosed with CD, were active, and had penetrating intestinal mucosal lesions.

Inclusion criteria:

  1. Age: > 18 years old;

  2. A definitive diagnosis of CD was based on the results of multiple examinations, such as colonoscopy, enteroscopy, gastroscope, computed tomography, enterography, histopathological examination, and blood tests (including routine blood examination, erythrocyte sedimentation rate, C‐reactive protein, and autoimmune‐related antibodies);

  3. Imaging and endoscopic examination confirmed penetrating intestinal mucosal lesions (perforation or fistula);

  4. Crohn's disease activity index (CDAI) is greater than 150;

  5. At least two following laboratory indexes of blood sedimentation to meet: erythrocyte sedimentation rate > 30 mm/h, hemoglobin < 12 g/dl (male) or < 11.5 g/d (female), platelet > 350*109/L, or C—reactive protein more than 2 times higher than normal;

  6. No smoking history or quit smoking for more than 6 months;

  7. Participate in clinical trials voluntarily and sign informed consent.

Exclusion criteria:

  1. The lesion was located in the upper digestive tract;

  2. Existing other diseases, such as systemic diseases, liver and kidney dysfunction, malignant tumors, lung diseases, etc.;

  3. Treatment history of immunosuppressive agents and biological agents within nearly half one year;

  4. Pregnancy or lactation;

  5. Patients who participated in other clinical studies within the last 3 months;

  6. Patients who are not suitable for electronic colonoscopy;

  7. Patients with other conditions that the investigator considers inappropriate for participation.

Data collection

All patient data were collected from the electronic medical record system of Jinling Hospital. Data include age, gender, CDAI score, blood indexes, etc.

Grouping and acquisition of intestinal mucosa samples

All enrolled individuals underwent electronic colonoscopy and intestinal mucosal tissue was taken from the ileum or ileum side of the ileocolon anastomotic site. Among them, intestinal mucosa tissues were taken from the penetrating lesion site as well as the normal site in the CD penetrating group and the CD non-penetrating group. Healthy volunteers in the control group also underwent colonoscopy and had their intestinal mucosa collected.

All the intestinal mucosa samples were immediately frozen in liquid nitrogen, and then frozen at − 80℃ for later use.

DNA extraction and bisulphite treatment

DNA was extracted from tissue samples using a QIAamp DNA Mini Kit (QiagenTM, Valencia, California, USA). DNA purity was assessed by measuring the A260/A280 ratio using a NanoDrop (Thermo Scientific) and DNA quality was checked by agarose gel electrophoresis for a strong band at high molecular weight. The concentration, purity and integrity of DNA were tested in accordance with the requirements of Ilumina 850 K BeadChips according to the Illumina methylation protocol. Bisulphite treatment of each sample was undertaken using the Zymo EZ DNA Methylation kit(ZYMO Research, Orange County, California, USA). BeadChips were processed with robotics and analyzed using the Illumina Hi-Scan system.

Illumina Human Methylation 850K microarray

Genomestudio software (Version 2011.1, Illumina, Inc., Albany, New York, USA) was used to standardize the processing of chip scan data, calculate standardized signal value and evaluate the situation of detected genes (detection standard: P < 0.05). Illumina Human Methylation 850K microarray profiling and data analysis were performed by Oebiotech (Shanghai, China).

Validation by pyrosequencing

Pyrosequencing assays were performed to validate the results obtained from previous findings of HLA-DRB1(cg24760581), MUC1(cg00930306), YPEL5(cg26462319), CBLB(cg21116912). PyroMark Assay Design software (Version 2.0, Qiagen, Valencia, California, USA) was used to Design PCR primers and detect mutated sites. Primer sequence is shown in Table 3.

Table 3.

Pyrosequencing primer.

Pyrosequencing primer Primer sequences Fragment length (nt)
HLA-DRB1 F GAGTAAAGGAGATGGAGGGAATAT 24
R AAAACATCCACAAAATCACATTTTCTAAT 29
MUC1 F TGGAGGGGAGGTGGAGTTT 19
R ACCCCCCCCCCAACCCAC 18
YPEL5 F GGTATTTTGGTGTTGTTGTTAAATATAGT 29
R TAACACCCCCCAAATAAATACTAAC 25
CBLB F TTGTTTTGTTTGGGTGGTAAAAAAT 25
R CTAAACTCCTTCTACAATCCTACTC 25

Note F represented the forward primer of 5′-3′, and R represented the reverse primer of 3′-5'.

Quantitative Real-time PCR

The primers were synthesized by Invitrogen Biotechnology Co., LTD, China, and the sequences were shown in Table 4.

Table 4.

Quantitative Real-time PCR primers.

Quantitative Real-time PCR primer Primer sequence Primer length (bp)
β-actin Forward 5′-CAGGGCGTGATGGTGGGCA-3' 253
REVERSE 5′-CAAACATCATCTGGGTCATCTTCTC-3'
HLA-DRB1 Forward 5′-TCCCTGAGTGAGACTTGCCTG-3' 209
Reverse 5′-CTCCGTCCCATTGAAGAAATG-3'
MUC1 Forward 5′-CAGCCACTTCTGCCAACTTG-3' 124
Reverse 5′-AGCTCACCAGCCCAAACAG-3'
YPEL5 Forward 5′-AGCACCAGAGCCCATTCTTC-3' 125
Reverse 5′-CAACCCAGCAGTTCTGTCCC-3'
CBLB Forward 5′-AGTGCTTATGCGGAAACACAG-3′ 147
Reverse 5′-TTTATGCTAGGGAGGAGGGTG-3′

Statistics

Statistical analysis and Figures were performed with Prism (GraphPad Software, Inc., version 6.0c). Categorical variables, such as mortality, were analyzed by Fisher’s exact test. Continuous variables are shown as the mean ± S.D. Mann–Whitney U test was used to compare continuous variables between groups67. Intergroup comparisons of continuous variables were performed using the Mann–Whitney U test, and intergroup comparisons of classified variables were performed using the chi-square test or Fisher's exact test67. The correlation between methylation degree and relative gene expression and the correlation between methylation degree and CDAI score were both analyzed by Pearson correlation analysis. P-values < 0.001 was regarded as statistically different and indicated by *** in figures. All P-values were two-sided.

Data source

The original datasets comparing the gene expression profiles between CD and normal controls were downloaded from NCBI GEO databases68. The accession number was GSE95095, GSE83448, GSE103027 and GSE102133 respectively. The microarray data of GSE95095 was based on GPL14951 (Illumina HumanHT-12 WG-DASL V4.0 R2 expression beadchip). The microarray data of GSE83448 was bsaed on GPL18134 (CodeLink Human Whole Genome Array). The microarray data of GSE103027 was bsaed on GPL13534 (Illumina HumanMethylation450 beadChip). and the microarray data of GSE102133 was bsaed on GPL6244 (Affymetrix Human Gene 1.0 ST Array).

Data pre-processing and differential expression analysis

Robust multi-array average (RMA) approach was performed for background correction and normalization69. Batch effects were removed in all data. The original GEO data were then converted into expression measures using affy R package (R version 3.6.1)70. Limma R package was subsequently employed for identifying differentially expressed genes (DEGs). P < 0.05 and absolute log2FC > 1 were chosen as the cut-off criteria based on Benjamini & Hochberg (BH) procedure. Intersect function in R was used for identifying the common DEGs among GSE95095, GSE83448, GSE103027 and GSE102133.

Supplementary Information

Supplementary Figure S1. (4.5MB, tiff)
Supplementary Table S1. (14.8KB, docx)
Supplementary Table S2. (14.1KB, docx)
Supplementary Table S3. (15.4KB, docx)
Supplementary Table S4. (15.7KB, docx)

Acknowledgements

This study was supported by the Innovation Project of Military Medicine (16CXZ007), Distinguished Scholars Foundation of Jiangsu Province (JCRCB2016006) and National Major Scientific and Technological Special Project for “Significant New Drugs Development” (2018ZX09J18111-004). The authors thank Oebiotech (Shanghai, China) for performing Illumina Human Methylation 850K microarray profiling and data analysis.

Author contributions

Basic study idea was made by Y.L. and J.R. Z.W. and J.R. conducted patient management and procedures. Data were curated by G.W., G.G. and H.R., analyzed by Z.H., and validated by X.W. and Z.W. Draft of manuscript was written by Y.L. and reviewed by all authors. J.R. and X.W. edited the manuscript.

Funding

This study was supported by the Innovation Project of Military Medicine (16CXZ007), Distinguished Scholars Foundation of Jiangsu Province (JCRCB2016006) and National Major Scientific and Technological Special Project for “Significant New Drugs Development” (2018ZX09J18111-004).

Data availability

No additional data are available.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-89087-6.

References

  • 1.Van Assche G, et al. The second European evidence-based Consensus on the diagnosis and management of Crohn's disease: Definitions and diagnosis. J. Crohns Colitis. 2010;4:7–27. doi: 10.1016/j.crohns.2009.12.003. [DOI] [PubMed] [Google Scholar]
  • 2.de Barros KSC, Flores C, Harlacher L, Francesconi CFM. Evolution of clinical behavior in Crohn's disease: Factors associated with complicated disease and surgery. Dig. Dis. Sci. 2017;62:2481–2488. doi: 10.1007/s10620-017-4685-9. [DOI] [PubMed] [Google Scholar]
  • 3.Ventham NT, Kennedy NA, Nimmo ER, Satsangi J. Beyond gene discovery in inflammatory bowel disease: The emerging role of epigenetics. Gastroenterology. 2013;145:293–308. doi: 10.1053/j.gastro.2013.05.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jostins L, et al. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012;491:119–124. doi: 10.1038/nature11582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fogel O, Richard-Miceli C, Tost J. Epigenetic changes in chronic inflammatory diseases. Adv. Protein Chem. Struct. Biol. 2017;106:139–189. doi: 10.1016/bs.apcsb.2016.09.003. [DOI] [PubMed] [Google Scholar]
  • 6.Kellermayer R. Hurdles for epigenetic disease associations from peripheral blood leukocytes. Inflamm. Bowel Dis. 2013;19:E66–67. doi: 10.1097/MIB.0b013e318280eca4. [DOI] [PubMed] [Google Scholar]
  • 7.Lin Z, et al. Identification of disease-associated DNA methylation in B cells from Crohn's disease and ulcerative colitis patients. Dig. Dis. Sci. 2012;57:3145–3153. doi: 10.1007/s10620-012-2288-z. [DOI] [PubMed] [Google Scholar]
  • 8.Harris AR, et al. Genome-wide peripheral blood leukocyte DNA methylation microarrays identified a single association with inflammatory bowel diseases. Inflamm. Bowel Dis. 2012;18:2334–2341. doi: 10.1002/ibd.22956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Weisenberger D, Van Den Berg D, Pan F, Berman B, Laird P. Comprehensive DNA Methylation Analysis on the Illumina Infinium Assay Platform. Illumina; 2008. [Google Scholar]
  • 10.Johnson DH, et al. DNA methylation and mutation of small colonic neoplasms in ulcerative colitis and Crohn's colitis: Implications for surveillance. Inflamm. Bowel Dis. 2016;22:1559–1567. doi: 10.1097/MIB.0000000000000795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.McDermott E, et al. DNA methylation profiling in inflammatory bowel disease provides new insights into disease pathogenesis. J. Crohns Colitis. 2016;10:77–86. doi: 10.1093/ecco-jcc/jjv176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lennerz JK, et al. Colorectal cancer in Crohn's colitis is comparable to sporadic colorectal cancer. Int. J. Colorectal Dis. 2016;31:973–982. doi: 10.1007/s00384-016-2574-x. [DOI] [PubMed] [Google Scholar]
  • 13.Barral M, et al. Gastrointestinal cancers in inflammatory bowel disease: An update with emphasis on imaging findings. Crit. Rev. Oncol. Hematol. 2016;97:30–46. doi: 10.1016/j.critrevonc.2015.08.005. [DOI] [PubMed] [Google Scholar]
  • 14.Leppaniemi A, et al. Management of abdominal sepsis: A paradigm shift? Anaesthesiol. Intensive Ther. 2015;47:400–408. doi: 10.5603/AIT.a2015.0026. [DOI] [PubMed] [Google Scholar]
  • 15.Suzuki MM, Bird A. DNA methylation landscapes: provocative insights from epigenomics. Nat. Rev. Genet. 2008;9:465–476. doi: 10.1038/nrg2341. [DOI] [PubMed] [Google Scholar]
  • 16.Wright ML, et al. Establishing an analytic pipeline for genome-wide DNA methylation. Clin Epigenet. 2016;8:45. doi: 10.1186/s13148-016-0212-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Corso-Diaz X, Jaeger C, Chaitankar V, Swaroop A. Epigenetic control of gene regulation during development and disease: A view from the retina. Prog. Retin. Eye Res. 2018 doi: 10.1016/j.preteyeres.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Robinson PC, et al. Exome-wide study of ankylosing spondylitis demonstrates additional shared genetic background with inflammatory bowel disease. NPJ Genom. Med. 2016;1:16008. doi: 10.1038/npjgenmed.2016.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kawasaki A, Tsuchiya N, Hagiwara K, Takazoe M, Tokunaga K. Independent contribution of HLA-DRB1 and TNF alpha promoter polymorphisms to the susceptibility to Crohn's disease. Genes Immun. 2000;1:351–357. doi: 10.1038/sj.gene.6363689. [DOI] [PubMed] [Google Scholar]
  • 20.Yun J, Xu CT, Pan BR. Epidemiology and gene markers of ulcerative colitis in the Chinese. World J. Gastroenterol. 2009;15:788–803. doi: 10.3748/wjg.15.788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Arimura Y, et al. Characteristics of Japanese inflammatory bowel disease susceptibility loci. J. Gastroenterol. 2014;49:1217–1230. doi: 10.1007/s00535-013-0866-2. [DOI] [PubMed] [Google Scholar]
  • 22.Hancock L, et al. Clinical and molecular characteristics of isolated colonic Crohn's disease. Inflamm. Bowel Dis. 2008;14:1667–1677. doi: 10.1002/ibd.20517. [DOI] [PubMed] [Google Scholar]
  • 23.Brant SR, et al. Genome-wide association study identifies African-specific susceptibility loci in African Americans with inflammatory bowel disease. Gastroenterology. 2017;152:206–217.e202. doi: 10.1053/j.gastro.2016.09.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Shahbazi M, et al. Combination of interleukin-10 gene promoter polymorphisms with HLA-DRB1*15 allele is associated with multiple sclerosis. Indian J. Med. Res. 2017;145:746–752. doi: 10.4103/ijmr.IJMR_1225_15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.McDonald BS, et al. Interleukin-10 receptor mutation presenting with severe nappy ulceration and infantile inflammatory bowel disease. Clin. Exp. Dermatol. 2017;42:771–773. doi: 10.1111/ced.13157. [DOI] [PubMed] [Google Scholar]
  • 26.Ma J, Rubin BK, Voynow JA. Mucins, mucus, and goblet cells. Chest. 2017 doi: 10.1016/j.chest.2017.11.008. [DOI] [PubMed] [Google Scholar]
  • 27.Ciborowski P, Finn OJ. Non-glycosylated tandem repeats of MUC1 facilitate attachment of breast tumor cells to normal human lung tissue and immobilized extracellular matrix proteins (ECM) in vitro: Potential role in metastasis. Clin. Exp. Metas. 2002;19:339–345. doi: 10.1023/a:1015590515957. [DOI] [PubMed] [Google Scholar]
  • 28.Gersemann M, et al. Differences in goblet cell differentiation between Crohn's disease and ulcerative colitis. Differentiation. 2009;77:84–94. doi: 10.1016/j.diff.2008.09.008. [DOI] [PubMed] [Google Scholar]
  • 29.Vancamelbeke M, et al. Genetic and transcriptomic bases of intestinal epithelial barrier dysfunction in inflammatory bowel disease. Inflamm. Bowel Dis. 2017;23:1718–1729. doi: 10.1097/MIB.0000000000001246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kadayakkara DK, et al. Inflammation driven by overexpression of the hypoglycosylated abnormal mucin 1 (MUC1) links inflammatory bowel disease and pancreatitis. Pancreas. 2010;39:510–515. doi: 10.1097/MPA.0b013e3181bd6501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Furr AE, Ranganathan S, Finn OJ. Aberrant expression of MUC1 mucin in pediatric inflammatory bowel disease. Pediatr. Dev. Pathol. 2010;13:24–31. doi: 10.2350/08-06-0479.1. [DOI] [PubMed] [Google Scholar]
  • 32.Hashash JG, et al. Altered expression of the epithelial mucin MUC1 accompanies endoscopic recurrence of postoperative Crohn's disease. J. Clin. Gastroenterol. 2021;55:127–133. doi: 10.1097/MCG.0000000000001340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Buisine MP, et al. Abnormalities in mucin gene expression in Crohn's disease. Inflamm Bowel Dis. 1999;5:24–32. doi: 10.1097/00054725-199902000-00004. [DOI] [PubMed] [Google Scholar]
  • 34.Buisine MP, et al. Mucin gene expression in intestinal epithelial cells in Crohn's disease. Gut. 2001;49:544–551. doi: 10.1136/gut.49.4.544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhao P, et al. Decreased expression of MUC1 induces apoptosis and inhibits migration in pancreatic cancer PANC-1 cells via regulation of Slug pathway. Cancer Biomark. 2017;20:469–476. doi: 10.3233/CBM-170297. [DOI] [PubMed] [Google Scholar]
  • 36.Yamaguchi N, et al. The different roles of innate immune receptors in inflammation and carcinogenesis between races. Environ. Health Prev. Med. 2017;22:70. doi: 10.1186/s12199-017-0678-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Xu T, et al. MUC1 downregulation inhibits non-small cell lung cancer progression in human cell lines. Exp. Ther. Med. 2017;14:4443–4447. doi: 10.3892/etm.2017.5062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Nijhuis A, et al. MCL-1 is modulated in Crohn's disease fibrosis by miR-29b via IL-6 and IL-8. Cell Tissue Res. 2017;368:325–335. doi: 10.1007/s00441-017-2576-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lee JY, et al. Pro-apoptotic role of the human YPEL5 gene identified by functional complementation of a yeast moh1delta mutation. J. Microbiol. Biotechnol. 2017;27:633–643. doi: 10.4014/jmb.1610.10045. [DOI] [PubMed] [Google Scholar]
  • 40.Liu Y, et al. NF-kappaB downregulates Cbl-b through binding and suppressing Cbl-b promoter in T cell activation. J. Immunol. 2015;194:3778–3783. doi: 10.4049/jimmunol.1402104. [DOI] [PubMed] [Google Scholar]
  • 41.Ashburner M, et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000;25:25–29. doi: 10.1038/75556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gene Ontology C. The Gene Ontology resource: Enriching a GOld mine. Nucleic Acids Res. 2021;49:D325–D334. doi: 10.1093/nar/gkaa1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nunes T, Bernardazzi C, de Souza HS. Cell death and inflammatory bowel diseases: Apoptosis, necrosis, and autophagy in the intestinal epithelium. Biomed. Res. Int. 2014;2014:218493. doi: 10.1155/2014/218493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kuo WT, et al. Inflammation-induced occludin downregulation limits epithelial apoptosis by suppressing caspase-3 expression. Gastroenterology. 2019;157:1323–1337. doi: 10.1053/j.gastro.2019.07.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mitsuhashi S, et al. Luminal extracellular vesicles (EVs) in inflammatory bowel disease (IBD) exhibit proinflammatory effects on epithelial cells and macrophages. Inflamm. Bowel Dis. 2016;22:1587–1595. doi: 10.1097/MIB.0000000000000840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Warner N, Burberry A, Pliakas M, McDonald C, Nunez G. A genome-wide small interfering RNA (siRNA) screen reveals nuclear factor-kappaB (NF-kappaB)-independent regulators of NOD2-induced interleukin-8 (IL-8) secretion. J. Biol. Chem. 2014;289:28213–28224. doi: 10.1074/jbc.M114.574756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kessel C, et al. Serum biomarkers confirming stable remission in inflammatory bowel disease. Sci. Rep. 2021;11:6690. doi: 10.1038/s41598-021-86251-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kanehisa M, Furumichi M, Sato Y, Ishiguro-Watanabe M, Tanabe M. KEGG: Integrating viruses and cellular organisms. Nucleic Acids Res. 2021;49:D545–D551. doi: 10.1093/nar/gkaa970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kanehisa M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 2019;28:1947–1951. doi: 10.1002/pro.3715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Papoutsopoulou S, Campbell BJ. Epigenetic modifications of the nuclear factor kappa B signalling pathway and its impact on inflammatory bowel disease. Curr. Pharm. Des. 2021 doi: 10.2174/1381612827666210218141847. [DOI] [PubMed] [Google Scholar]
  • 51.Mortensen JH, et al. The intestinal tissue homeostasis: The role of extracellular matrix remodeling in inflammatory bowel disease. Expert Rev. Gastroenterol. Hepatol. 2019;13:977–993. doi: 10.1080/17474124.2019.1673729. [DOI] [PubMed] [Google Scholar]
  • 52.Cheng C, et al. Identification of differentially expressed genes, associated functional terms pathways, and candidate diagnostic biomarkers in inflammatory bowel diseases by bioinformatics analysis. Exp. Ther. Med. 2019;18:278–288. doi: 10.3892/etm.2019.7541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Shimshoni E, Yablecovitch D, Baram L, Dotan I, Sagi I. ECM remodelling in IBD: innocent bystander or partner in crime? The emerging role of extracellular molecular events in sustaining intestinal inflammation. Gut. 2015;64:367–372. doi: 10.1136/gutjnl-2014-308048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Nyrén P, Pettersson B, Uhlén M. Solid phase DNA minisequencing by an enzymatic luminometric inorganic pyrophosphate detection assay. Anal. Biochem. 1993;208:171–175. doi: 10.1006/abio.1993.1024. [DOI] [PubMed] [Google Scholar]
  • 55.Li Yim AYF, et al. Peripheral blood methylation profiling of female Crohn's disease patients. Clin. Epigenet. 2016;8:65. doi: 10.1186/s13148-016-0230-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Nimmo ER, et al. Genome-wide methylation profiling in Crohn's disease identifies altered epigenetic regulation of key host defense mechanisms including the Th17 pathway. Inflamm. Bowel Dis. 2012;18:889–899. doi: 10.1002/ibd.21912. [DOI] [PubMed] [Google Scholar]
  • 57.Kim SW, et al. Genetic polymorphisms of IL-23R and IL-17A and novel insights into their associations with inflammatory bowel disease. Gut. 2011;60:1527–1536. doi: 10.1136/gut.2011.238477. [DOI] [PubMed] [Google Scholar]
  • 58.Samarani S, et al. CpG methylation in TGFbeta1 and IL-6 Genes as surrogate biomarkers for diagnosis of IBD in children. Inflamm. Bowel Dis. 2020;26:1572–1578. doi: 10.1093/ibd/izaa074. [DOI] [PubMed] [Google Scholar]
  • 59.Li Yim AYF, et al. Whole-genome DNA methylation profiling of CD14+ monocytes reveals disease status and activity differences in Crohn's disease patients. J. Clin. Med. 2020;9:1055. doi: 10.3390/jcm9041055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Moret-Tatay I, et al. Identification of epigenetic methylation signatures with clinical value in Crohn's disease. Clin. Transl. Gastroenterol. 2019;10:e00083. doi: 10.14309/ctg.0000000000000083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kim TO, et al. Genome-wide analysis of the DNA methylation profile identifies the fragile histidine triad (FHIT) gene as a new promising biomarker of Crohn's disease. J. Clin. Med. 2020;9:1338. doi: 10.3390/jcm9051338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Karatzas PS, Mantzaris GJ, Safioleas M, Gazouli M. DNA methylation profile of genes involved in inflammation and autoimmunity in inflammatory bowel disease. Medicine. 2014;93:e309. doi: 10.1097/MD.0000000000000309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Gasparetto M, et al. Transcription and DNA methylation patterns of blood-derived CD8(+) T cells are associated with age and inflammatory bowel disease but do not predict prognosis. Gastroenterology. 2021;160:232–244. doi: 10.1053/j.gastro.2020.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Tokarz P, Pawlowska E, Bialkowska-Warzecha J, Blasiak J. The significance of DNA methylation profile in metastasis-related genes for the progression of colorectal cancer. Cell. Mol. Biol. 2017;63:79–87. doi: 10.14715/cmb/2017.63.2.12. [DOI] [PubMed] [Google Scholar]
  • 65.Puccini A, et al. Colorectal cancer: Epigenetic alterations and their clinical implications. Biochem. Biophys. Acta. 1868;439–448:2017. doi: 10.1016/j.bbcan.2017.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Emmett RA, Davidson KL, Gould NJ, Arasaradnam RP. DNA methylation patterns in ulcerative colitis-associated cancer: A systematic review. Epigenomics. 2017;9:1029–1042. doi: 10.2217/epi-2017-0025. [DOI] [PubMed] [Google Scholar]
  • 67.Parab S, Bhalerao S. Choosing statistical test. Int. J. Ayurveda Res. 2010;1:187–191. doi: 10.4103/0974-7788.72494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Edgar R, Domrachev M, Lash AE. Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30:207–210. doi: 10.1093/nar/30.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.McCall MN, Bolstad BM, Irizarry RA. Frozen robust multiarray analysis (fRMA) Biostatistics. 2010;11:242–253. doi: 10.1093/biostatistics/kxp059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Liu J, et al. Identification of potential biomarkers in association with progression and prognosis in epithelial ovarian cancer by integrated bioinformatics analysis. Front. Genet. 2019;10:1031. doi: 10.3389/fgene.2019.01031. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure S1. (4.5MB, tiff)
Supplementary Table S1. (14.8KB, docx)
Supplementary Table S2. (14.1KB, docx)
Supplementary Table S3. (15.4KB, docx)
Supplementary Table S4. (15.7KB, docx)

Data Availability Statement

No additional data are available.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES