Skip to main content
3 Biotech logoLink to 3 Biotech
. 2021 May 9;11(6):258. doi: 10.1007/s13205-021-02814-8

miR-9-5p promotes wear-particle-induced osteoclastogenesis through activation of the SIRT1/NF-κB pathway

Liang Zhang 1, Weidong Zhao 1, Dongmei Bao 1, Kening Sun 1, Peng Li 1, Zhihui Gao 1, Zhidong Lu 1,
PMCID: PMC8107064  PMID: 33987074

Abstract

To explore the potential function of miR-9-5p in wear-particle-induced osteoclastogenesis, we examined the expression of SIRT1 and miR-9-5p in particle-induced osteolysis (PIO) mice calvariae and polyethylene (PE)-induced RAW 264.7 cells and found that SIRT1 expression was downregulated while miR-9-5p expression was upregulated in both models. We then verified that miR-9-5p targets SIRT1. miR-9-5p was found to promote PE-induced osteoclast formation from RAW 264.7 cells by tartrate-resistant acid phosphatase staining and detection of osteoclast markers, and miR-9-5p activation of the SIRT1/NF-kB signaling pathway was found in cells by detecting the expression of SIRT1/NF-kB pathway-related proteins and rescue assays. In conclusion, we found that miR-9-5p activated the SIRT1/NF-κB pathway to promote wear-particle-induced osteoclastogenesis. miR-9-5p may be a useful therapeutic target for PIO remission and treatment.

Keywords: miR-9-5p, SIRT1, NF-κB, Osteoclastogenesis, Wear-particle

Introduction

The accepted primary treatment for severe joint diseases like osteoarthritis and rheumatoid arthritis is total joint arthroplasty (TJA) (Harris 2001). However, a prevalent complication of TJA is aseptic loosening, the main reason for revision surgery (Sundfeldt et al. 2006; Fehring et al. 2001; Kawai et al. 1999; Otto et al. 2006). In addition, aseptic prosthetic loosening is a secondary symptom of chronic inflammation and osteoclast-mediated bone resorption in response to a cascade of wear particles near the prosthesis (Greenfield et al. 2002; Holt et al. 2007; Purdue et al. 2007; Wedemeyer et al. 2007). Wear particles are phagocytosed by monocyte/macrophage lineage cells (Rao et al. 2012) that can raise a range of inflammatory cytokines, resulting in elevated osteoclast activity and accelerated osteoclastic induction and osteolysis (Purdue et al. 2006; Zhang et al. 2015). Osteoclasts have become one of the therapeutic targets for alleviation or even treatment of aseptic loosening after total joint arthroplasty due to the important effect on osteoclastic bone resorption during wear particle-induced osteoclastogenesis.

MicroRNAs (miRNAs) are non-coding RNAs (~ 22 nucleotide long) (Croce 2009). MiRNAs play a negative role in regulating gene expression by promoting the degradation of target mRNAs and/or inhibiting the translation process through the binding sequences of specific proteins in the 3'-untranslated regions (3'-UTRs) of mRNAs (Huntzinger and Izaurralde 2011). Using bioinformatics, miRNAs are predicted to modulate approximately one-third of all mammalian genes (Inui et al. 2010). Notably, many miRNAs play an essential role in the differentiation and formation of osteoblasts (Lou et al. 2019; Franceschetti et al. 2013; Chen et al. 2018; Jiang et al. 2018; Sun et al. 2019; Mao et al. 2019; Mizoguchi et al. 2013; Cong et al. 2017). For example, Lou et al. proved that osteoclast differentiation of bone marrow-derived macrophages can be facilitated by miR-142-5p through the PTEN/PI3K/AKT/FoxO1 pathway (Lou et al. 2019). Franceschetti et al. reported that murine osteoclastogenesis can be enhanced by miR-29 through regulating osteoclast invasion and migration (Franceschetti et al. 2013). Chen et al. found that in collagen-induced arthritis, miR-145-5p exacerbated bone erosion by targeting osteoprotegerin (Chen et al. 2018). miR-9-5p is a highly conserved miRNA, and has a critical effect on the development of other diseases, such as cancer (Zheng et al. 2020b; Bandini et al. 2020; Wang et al. 2020; Ying et al. 2020; Zhang et al. 2019; Babion et al. 2019; Li et al. 2017), Parkinson’ s disease (Wang et al. 2019; Tolosa et al. 2018), and myocardial infarction (Xiao et al. 2019). Researchers also found that the development of joint disease was regulated by miR-9-5p. Jin et al. demonstrated that osteoarthritis can be relieved by miR-9-5p exosomal generated from mesenchymal stem cells through suppression of SDC1 (Jin et al. 2020). Li et al. reported that miR-9-5p was likely a potential therapeutic target of rheumatoid arthritis-caused peripheral neuropathy (Li et al. 2019). Chen et al. found that apoptosis of chondrocytes in mice with osteoarthritis after tibial plateau fracture could be suppressed by miRNA-9-5p (Chen et al. 2019). Nevertheless, the precise effect of miR-9-5p on osteoclastogenesis is still unknown.

Sirtuin 1 (SIRT1), a lysine deacetylase, requires nicotinamide adenine dinucleotide (NAD +) to function (Yan et al. 2019a). SIRT1 belongs to the SIR2 family and is mainly localized in the nucleus (Zainabadi et al. 2017; Haigis and Guarente 2006; Almeida and Porter 2019). It significantly affects inflammatory reactions, aging, and metabolism, and has been proven to increase bone mass (Sebastián et al. 2012; Zainabadi et al. 2017; Ghosh 2008). Edwards et al. demonstrated that in osteoclasts, the absence of SIRT1 facilitated osteoclastogenesis in vitro and activated NF-kB by enhancing acetylation of Lysine 310 (Edwards et al. 2013). Shakibaei et al. reported that SIRT-1 activated by resveratrol suppressed NF-kB transcription and osteoclastogenesis (Shakibaei et al. 2011). SIRT1 has also been reported to diminish NF-kB activity of bone marrow macrophages under inflammatory conditions (Hah et al. 2014; Schug et al. 2010). Bioinformatics predictions showed that miR-9-5p could target SIRT1, so we speculated that miR-9-5p might be implicated in osteoclastogenesis through regulation of the SIRT1/NF-kB signaling pathway.

Our study investigated the effect of miR-9-5p on wear-particle-induced osteoclastogenesis from RAW 264.7 cells and its potential molecular mechanism. We also searched for potential therapeutic targets for particle-induced periprosthetic osteolysis.

Materials and methods

Polyethylene (PE) wear particles

The particle size of polyethylene (PE; Newborn, China) particles, was about 65 nm. PE particles were washed three times with 75% ethanol and then disinfected with ethylene oxide to remove endotoxins. We applied the QCL-1000 Endpoint Chromogenic Limulus Amebocyte Kit (Lonza, 50-647U) to examine for endotoxins according to the manufacturer's protocol. Particles that did not contain endotoxin were selected for the study.

Particle-induced osteolysis (PIO) mouse model

C57BL6 female mice aged 6–8-weeks-old (weighting 18–20 g) were used in the study. The mice were placed in two cages, including the sham surgery group (Control) and the PIO model group. For surgery, after the mice were anesthetized, the skull periosteum was separated. The PIO model was created by inserting 50 μL of wear particles suspension (100 mg/mL) in the central part of the skull. Control mice were treated with 50 μL PBS instead of the pellet suspension. Mice were sacrificed 2 weeks later to remove the skull for subsequent experiments. The surgical procedure is described in detail elsewhere (Merkel et al. 1999). All procedures were conducted under the consent of the Animal Experimentation Ethics Committee of the local hospital. The permission number for ethical approval of animals was 2019–241.

Cell culture

The RAW 264.7 macrophage cell line was acquired from The American Type Culture Collection. Cells (Manassas, VA, USA) were grown in RPMI-1640 medium (Gibco, Gaithersburg, MD, USA) with 10% FBS (Invitrogen, Carlsbad, CA, USA) at 37 °C under humidified air with 5% CO2. When cells reached approximately 90% confluence, the cells were seeded into 6-well plates at a density of 106 and cultured serum-free for 12 h, then stimulated with PE (concentrations: 0, 0.5, 1.0, 1.5, 2.0 mg/mL; time: 24 h; or concentration: 1 mg/mL; and time points: 0, 0.5, 1, 3, and 5 days).

Cell transfection

RAW 264.7 macrophage cells were inoculated in 24-well culture plates (2 × 104 cells/well). When the cell density reached 80%, miR-9-5p mimic, miR-9-5p inhibitor (Biomics Biotech, Jiangsu, China), pcDNA-SIRT1, and the corresponding negative controls (HanHeng, Shanghai, China) were transfected into cells with Lipofectamine® 2000 transfection reagent (Invitrogen) as per the protocol. After 48 h, PE or NF-kB inhibitor BAY 11–7082 was used to treat transfected cells.

Dual luciferase reporter assay

Online software TargetScan (http://www.targetscan.org/) was adopted for predicting potential binding sites of miR-9-5p and SIRT1. The 3ʹ untranslated region (3ʹ-UTR) of SIRT1 or the mutant version without the predicted miR-9-5p target sequence were fused into the pISo vector (Promega). RAW 264.7 cells (5 × 104) were spread in 24-well plates and cultured in complete RPMI 1640 medium supplemented with 10% FBS for 24 h. The cells were then co-transfected with WT- SIRT1-3ʹ-UTR-pISo or MUT-SIRT1-3ʹ-UTR-pISo luciferase reporter vector (0.5 μg), and miR-9-5p mimic (1 μg) or NC mimic, miR-9-5p inhibitor (1 μg) or NC inhibitor for 48 h with Lipofectamine 3000 (Invitrogen). Experiments were conducted using the Dual Luciferase Assay System (Promega, Madison, WI, USA).

Tartrate-resistant acid phosphatase (TRAP) staining

RAW 264.7 cells following different treatments were cultured for 7 days. Cells were fixed with 4% paraformaldehyde for 1 min at room temperature after washing two times with PBS. We fixed cells with 4% paraformaldehyde for 1 min at room temperature. Staining for TRAP activity was performed with a leukocyte acid phosphatase kit (No. 387 A; Sigma-Aldrich, St. Louis, MO, USA). TRAP positive macrophage-like cells were stained ruby red.

Real-time quantitative reverse transcription PCR (q-RT-PCR)

Total RNA from RAW 264.7 cells and the calvariae of the mice was extracted with the Trizol regent (Thermo Fisher Scientific, U.S.A). PrimeScript RT reagent kit (TaKaRa, China) was used for cDNA synthesis following the manufacturer instructions. Real time PCR was performed with the SYBR Green kit (TaKaRa, Otsu, Shiga, Japan) and was applied to determine miR-32-5p expression. The primers used are listed in Table 1. The data were evaluated by the 2−ΔΔCt calculation.

Table 1.

Gene sequence adopted in q-RT-PCR

Gene Sequence (5′-3′)
TRAP
Forward CCAATGCCAAAGAGATCGCC
Reverse TCTGTGCAGAGACGTTGCCAAG
MMP-9
Forward CCATCGATTAGAAGCAGGAGGACCCGA
Reverse GGACTAGTTGGCTAACGCTGCCTTTG
MMP-2
Forward CCTCTCTTGGTGTCCATACA
Reverse ATCTCTCTGTACCCTCTGCA
Cathepsin K
Forward CCTCTCTTGGTGTCCATACA
Reverse ATCTCTCTGTACCCTCTGCA
U6
Forward CTGCTTCGGCAGCACA
Reverse AACGCTTCACGAATTTGCGT
GAPDH
Forward GGAAAGCTGTGGCGTGAT
Reverse AAGGTGGAAGAATGGGAGTT

q-RT-PCR real-time quantitative reverse transcription PCR, TRAP tartrate-resistant acid phosphatase, MMP-9 matix metalloproteinase-9, MMP-2 matix metalloproteinase-2

Western blotting

Total proteins extracted from cells were quantified with the BCA kit (Beyotime, Shanghai, China). A total of 20 mg of protein from per sample were run on a polyacrylamide gel. The separated proteins were then transferred to polyvinylidene difluoride (PVDF) membranes. PVDF membranes were probed with primary antibody incubated overnight at 4 °C. After washing in PBS 3 times for 10 min, the secondary antibody (1:2,000, ab6721; Abcam, Pleasanton, CA, USA) was added to the membrane and incubated for 1.5 h at 25℃. The membranes were washed three times for 10 min in PBS after incubation with secondary antibody. Next, the membrane was developed with enhanced chemiluminescent (ECL) reagents. The primary antibodies were as follows: anti-p65 (1:5000, ab32536; Abcam), anti-SIRT1 (1:2000, 9475S; Cell Signaling Technologies, Danvers, MD, USA), anti-MMP-2 (1:3000, ab92536; Abcam), anti-β-actin (1:2000, ab20272; Abcam), anti-TRAP (1:5000, ab126775; Abcam), anti-phosphor-p65 (1: 2000, ab86299; Abcam), anti-phospho-IκBα (1:1000, #9246; Cell Signaling), anti-Cathepsin K (1:1000, ab207086; Abcam), anti-phosphor-NF-kB p50 (1:500, ab28849; Abcam), anti-IκBα (1:1000, #2697; Cell Signaling), anti-IKKα (1:5000, ab109749; Abcam), anti-phospho-IKKα (1:1000, #2697; Cell Signaling), anti-NF-kB p50 (1:1000, #13,586; Cell Signaling), anti-MMP-9 (1:1000, ab228402; Abcam), anti-phosphor-p65 (1: 2000, ab86299; Abcam). The β-actin and Lamin A were used as a loading control for cytoplasm and nucleus, respectively.

Statistical methods

Data analysis was conducted by Student’s t-test and one-way ANOVA using SPSS (version 24.0). Continuous variables were shown as mean values and standard deviation (SD). A p-value under 0.05 was defined as statistically significant. Three independent experiments were conducted.

Results

SIRT1 is down-regulated while miR-9-5p is up-regulated in PE-induced osteoclastogenesis

To determine whether SIRT1/miR-9-5p expression was associated with wear particle-induced osteoclastogenesis, we first measured SIRT1 and miR-9-5p expression in the calvariae of PIO mice and wildtype mice. Results demonstrated that in the PIO mice, SIRT1 mRNA expression was markedly lower whereas miR-9-5p expression was increased compared with the control (p < 0.05, Fig. 1a, b). In RAW 264.7 cells SIRT1 protein expression gradually decreased when in the presence of PE at concentrations of 0, 0.5, 1, and 2.0 mg/mL for 24 h or PE at 1.5 mg/mL at time points 0.5, 1.0, 3.0, and 5.0 days (p < 0.05, p < 0.01, Fig. 1c, d). miR-9-5p expression progressively increased with increasing PE concentration (0, 0.5, 1, and 2.0 mg/mL) for 24 h or 1.5 mg/mL PE treatment time (0.5, 1.0, 3.0, and 5.0 days) (p < 0.05, p < 0.01, p < 0.001, Fig. 1e, f). These results suggested that SIRT1 and miR-9-5p might participate in wear particle-induced osteoclastogenesis.

Fig. 1.

Fig. 1

SIRT1 is downregulated while miR-9-5p is upregulated in PE-induced osteoclastogenesis. a Relative expression of SIRT1 mRNA in the calvariae of PIO mice was examined by q-RT-PCR. *p < 0.05 versus control. b Relative expression of miR-9-5p in the calvariae of PIO mice was examined by q-RT-PCR. *p < 0.05 versus control. c Relative expression of SIRT1 protein in RAW 264.7 cells treated with PE at different concentrations was measured by western blotting. *p < 0.05, 0.5 mg/mL PE; *p < 0.05, 1 mg/mL PE; **p < 0.01, 1.5 mg/mL PE. d Relative expression of SIRT1 protein in RAW 264.7 cells treated with PE at different times was measured by western blotting. *p < 0.05, 0.5 d; *p < 0.05, 1 d; **p < 0.01, 3 d. e Relative expression of miR-9-5p in RAW 264.7 cells treated with PE at different concentrations was measured by q-RT-PCR. **p < 0.01, 0.5 h; ***p < 0.001, 1 h; ***p < 0.001, 1.5 h. f Relative expression of miR-9-5p in RAW 264.7 cells treated with PE at different times (0, 0.5, 1, 3, and 5 d) was measured by q-RT-PCR. *p < 0.05, 0.5 d; *p < 0.05, 1 d; **p < 0.01, 3 d. PE: polyethylene

The miR-9-5p targets SIRT1 directly in RAW 264.7 cells

Next, we explored the regulatory relationship of miR-9-5p on SIRT1. Based on the prediction by TargetScan, we suspected that miR-9-5p could bind to the SIRT1 3'-UTR (Fig. 2a). Figure 2b illustrates that the expression of miR-9-5p was greatly up-regulated in the presence of miR-9-5p mimic and significantly down-regulated in the presence of miR-9-5p inhibitor (p < 0.05) in RAW 264.7 cells. Dual luciferase reporter assay demonstrated that miR-9-5p overexpression dramatically suppressed SIRT1-WT 3'-UTR activity, whereas miR-9-5p inhibitor increased SIRT1-WT 3'-UTR activity. There was no significant change in the activity of SIRT1-MUT 3ʹ-UTR (p < 0.01, Fig. 2c). The q-RT-PCR and western blotting were performed to analyze the expression of SIRT1 mRNA and protein, respectively, in the presence of miR-9-5p mimic or miR-9-5p inhibitor. The expression of SIRT1 mRNA and protein were dramatically decreased in the presence of miR-9-5p mimic, whereas they were greatly enhanced in the presence of miR-9-5p inhibitor, compared to the control (p < 0.001, Fig. 2d, e). The above findings suggested that SIRT1 serves as a direct target for miR-9-5p.

Fig. 2.

Fig. 2

SIRT1 is targeted by miR-9-5p. Cells were transfected with NC mimics, miR-9-5p mimic, NC inhibitor, or miR-9-5p inhibitor. a TargetScan predicted the alignment of sequences between miR-9-5p and the SIRT1 3'-UTR. b MiR-9-5p mimic increased while miR-9-5p inhibitor decreased miR-9-5p expression detected by q-RT-PCR in RAW 264.7 cells. c miR-9-5p mimic reduced and miR-9-5p inhibitor increased the luciferase activities of the wild-type 3ʹ-UTR reporter vector but not mutant 3ʹUTR reporter vector. d Relative SIRT1 mRNA expression detected by q-RT-PCR was significantly decreased after miR-9-5p mimic transfection and increased after miR-9-5p inhibitor transfection. e Relative SIRT1 protein expression detected by western blotting was significantly decreased after miR-9-5p mimic transfection and increased after miR-9-5p inhibitor. *p < 0.05, **p < 0.01, ***p < 0.001 versus NC mimics; #p < 0.05, ##p < 0.01, ###p < 0.001 versus NC inhibitor. NS indicates no significance versus NC mimics group (or NC inhibitor group)

PE induced-osteoclastogenesis can be promoted by miR-9-5p in RAW 264.7 cells

To explore the relevance between miR-9-5p and osteoclast differentiation, miR-9-5p mimic or inhibitor were used to transfect RAW 264.7 cells during osteoclastogenesis. There were considerably more TRAP positive cells in the miR-9-5p mimic-treated group while the miR-9-5p inhibitor-treated group had fewer than the NC mimics group (Fig. 3a). We also found that the mRNA expression of osteoclast differentiating marker genes (MMP-9, cathepsin K, MMP-2, and TRAP) that are stimulated by PE were promoted by miR-9-5p and restrained by miR-9-5p inhibitor in contrast to the controls (p < 0.05, p < 0.01, Fig. 3b–e). Furthermore, in the western blot assay, miR-9-5p mimic induced an increase of TRAP, MMP-2, MMP-9, and cathepsin K protein expression, whereas downregulation of miR-9-5p resulted in the opposite effect (Fig. 3f). These results demonstrated that miR-9-5p could facilitate wear particle induced-osteoclastogenesis.

Fig. 3.

Fig. 3

miR-9-5p promotes osteoclastogenesis. Four groups of cells were transfected with the following reagents: control, PE, PE + miR-9-5p mimic, or PE + miR-9-5p inhibitor. a The fusion ability and number of TRAP-positive differentiated cells were detected by TRAP staining assay in the four groups; be The mRNA expression of osteoclast markers TRAP, MMP-2, MMP-9, and cathepsin K was detected by q-RT-PCR in four groups. f The protein expression of osteoclast markers TRAP, MMP-2, MMP-9, and cathepsin K in RAW 264.7 in the four groups was detected by western blotting. PE, polyethylene; ***p < 0.001 versus control group; *p < 0.05, **p < 0.01 versus control group; #p < 0.05, ##p < 0.01 versus PE group

SIRT1/ NF-κB pathway can be activated by miR-9-5p in RAW 264.7 cells

To further explore the potential mechanism of regulation by miR-9-5p in PE-induced osteoclastogenesis, RAW 264.7 cells were treated with miR-9-5p mimic or inhibitor for 24 h, then subsequently treated with 1.5 mg/mL PE. Western blotting was carried out to measure the expression of SIRT1 and NF-κB pathway-related proteins such as p-NF-κB p50, p-IKKα, and p-IκB. The expression of SIRT1 protein was down-regulated when miR-9-5p was overexpressed and up-regulated when miR-9-5p was inhibited than with PE alone (p < 0.05, p < 0.001, Fig. 4a). In the cytoplasm, the protein levels of the phosphorylated NF-κB p50, IκBα, and IKKα were significantly higher in the PE + miR-9-5p mimic group than in the PE group, whereas the levels of the PE + miR-9-5p inhibitor group were substantially decreased (p < 0.05, p < 0.01, Fig. 4b). In the nucleus, a significant increase of phosphorylated p65 expression was found in the presence of miR-9-5p mimic while miR-9-5p inhibitor caused an opposite effect in PE-induced cells (p < 0.01, p < 0.001, Fig. 4b). These results showed that miR-9-5p activated the SIRT1/ NF-κB pathway in wear particle-induced cells.

Fig. 4.

Fig. 4

miR-9-5p activates the SIRT1/ NF-κB signaling pathway. Four groups of cells were transfected with the following reagents: control, PE, PE + miR-9-5p mimic, or PE + miR-9-5p inhibitor. a Western blots of SIRT protein in the four groups; b Western blots of NF-κ B pathway-related proteins in the cytoplasm in the four groups. c Western blots of p-p65 protein expression in the nucleus of the four groups. PE, polyethylene; *p < 0.05, **p < 0.01, ***p < 0.001 versus control; #p < 0.05, ##p < 0.01, ###p < 0.001 versus PE

Upregulation of SIRT1 or suppression of NF-κB pathway reverses the effect of miR-9-5p on wear particle-induced osteoclastogenesis

We previously confirmed that miR-9-5p activates the SIRT1/NF-κB pathway in RAW 264.7 cells induced by wear particles. We next conducted rescue experiments to investigate whether the SIRT1/NF-κB signaling pathway is required for miR-9-5p to modulate PE-induced osteoclastogenesis. First, we knocked down the expression of SIRT1 or used NF-KB inhibitors for the NF-KB pathway inhibition in cells treated with PE and miR-9-5p mimic. In PE-induced RAW 264.7 cells, the miR-9-5p mimic increased the protein expression of SIRT1, however, overexpression of SIRT1 or restraint of the NF-kB pathway reversed the increase in the expression of SIRT1 protein caused by overexpression of miR-9-5p (Fig. 5a). Next, the effects of overexpression of miR-9-5p, SIRT1, or NF-κB inhibitor on expression of NF-kB pathway-related proteins IKKα, IκBα, and NF-kB p50 in the cytoplasm with PE-stimulated cells was measured through western blotting. Figure 5b shows that overexpression of miR-9-5p in cells stimulated with PE increasing the expression of p-NF-kB, p-IκBα, and p50 p-IKKα proteins in the cytoplasm, while overexpression of SIRT1 or stimulation of cells of cells with NF-κB inhibitor BAY 11-7082 partly reversed the miR-9-5p-induced enhancement in protein expression of the NF-kB pathway-related proteins. Furthermore, the protein expression of p-p65 in the nucleus was the same as that of p-NF-kB, p50p-IKK, and p-IκBα in the cytoplasm (Fig. 5c). In addition, SIRT1 or BAY 11-7082 significantly decreased the mRNA expression of osteoclast markers, cathepsin K, MMP-9, TRAP, and MMP-2, compared with the wear particle-treated cells transfected with miR-9-5p mimic (p < 0.05, p < 0.01, p < 0.001, respectively, Fig. 5d–g). Similar results were observed for protein expression of osteoclast markers cathepsin K, MMP-9, MMP-2, and TRAP (Fig. 5h). Taken together, these data showed that upregulation of SIRT1 or suppression of the NF-kB pathway reversed the effect of miR-9-5p on wear particle-induced osteoclastogenesis, which confirmed that miR-9-5p promoted wear particle-induced osteoclastogenesis via SIRT1/NF-kB signaling.

Fig. 5.

Fig. 5

Upregulation SIRT1 or inhibition of the NF-κB signaling pathway reverses the effect of miR-9-5p on wear particle induced-osteoclastogenesis. Four groups of cells were transfected with the following reagents: PE, PE + miR-9-5p mimic, PE + miR-9-5p mimic + SIRT1, or PE + miR-9-5p mimic + BAY 11–7082. a Western blot of SIRT1 protein in the four groups. b Western blots of NF-κ B pathway-related proteins in the cytoplasm of the four groups. c Western blots of p-p65 protein in the nucleus of the four groups. dg The mRNA expression of osteoclast markers TRAP, MMP-2, MMP-9, and cathepsin K in the four groups was detected by q-RT-PCR. h Western blots of the protein expression of osteoclast markers TRAP, MMP-2, MMP-9, and cathepsin K in the four groups. PE, polyethylene; **p < 0.01, ***p < 0.001 versus group; #p < 0.05, ##p < 0.01, ###p < 0.001 versus PE + miR-9-5p mimic group

Discussion

To preserve the physiological homeostasis of bone, there is a delicate balance between old bone resorption and new bone synthesis. Nevertheless, in pathologies like osteoporosis and rheumatoid arthritis, this delicate balance between synthesis and degradation breaks down (Shakibaei et al. 2011; Clarke and Khosla 2010). Aseptic loosening resulting from wear particles is a widespread complication of major arthroplasties and is the most prevalent contributor to hip and knee arthroplasty (Sundfeldt et al. 2006; Otto et al. 2006; Fehring et al. 2001; Kawai et al. 1999). Research has shown that as many as 70% of all revisions of the hip (Schulte et al. 1993; Herberts and Malchau 2000; Mulroy et al. 1995) and 44% of knee revisions (Kawai et al. 1999; Sharkey et al. 2014; Robertsson et al. 2001) can be attributed to aseptic loosening. Reconstruction operations tend to have poorer outcomes than primary surgery. These procedures are long, risky, expensive, and stressful to sufferers. PIO-induced patients were typified by the formation of a pseudomembrane that is often found on bone and over prosthesis. The main constituent cells of the inflammatory membrane are macrophages (50–80%), fibroblasts (10–30%), endothelial cells (5–10%), and osteoclasts (5%) (Goldring et al. 1983). During aseptic loosening, macrophages phagocytosed wear particles, allowing for proinflammatory cytokine release, thereby causing more inflammatory cell infiltration and stimulation of osteoclast proliferation, resulting in local osteolysis (Noordin and Masri 2012; Bu et al. 2017). Thus, suppression of osteoclast function appears to be a way to prevent PIO and prosthesis loosening.

MiRNAs have post-transcriptional regulatory functions on protein expression (Bartel 2004). Many studies have highlighted the pivotal impact of miRNAs on a multitude of responses. Previous investigations have found that miRNAs were essential in bone remodeling via modulation of differentiation and function of osteoblasts and osteoclasts. It is increasingly found that miRNAs are involved in osteoclast formation, differentiation, apoptosis, and bone resorption (Li et al. 2016). miR-9-5p is a powerful miRNA that is involved in many physiological and pathological processes (Sun et al. 2016; Xie et al. 2016; Zheng et al. 2020a). miR-9-5p is a member of the miR-9 family and acts on bone remodeling and was shown to disrupt skeletal cell proliferation, differentiation as well as adhesion (Sun et al. 2016). Furthermore, miR-9-5p regulated osteosarcoma progression (Xie et al. 2016). An additional study reported that miR-9-5p participates in osteogenic differentiation modulated by the long noncoding RNA XIST (Zheng et al. 2020a). For the present investigation, we explored the effect of miR-9-5p on wear particle-induced osteolysis. miR-9-5p expression was up-regulated in PIO mouse model tissues, and in PE-treated RAW 264.7 cells. Its expression showed a concentration- and time-dependent increase with PE treatment while SIRT1 gave an opposite result with expression in PE-treated cells showing a concentration- and time-dependent decrease with PE treatment. These findings demonstrated that miR-9-5p and SIRT1 expression were related to wear particle-induced peri-implant osteolysis.

Decreased SIRT1 levels and activity have been associated with the development of aging and aging-associated diseases, which include osteoporosis, sarcopenia, cancer, neurodegeneration and diabetes (Haigis and Sinclair 2010; Baur et al. 2012). In addition, inadequate osteoclast targeting of SIRT1 function leads to increased bone resorption (Yan et al. 2019a). The inhibitory effect of SIRT1-stimulating factors (SRT3025 and SRT2183) on receptor activator of nuclear factor κB ligand (RANKL) induced by osteoblast differentiation was reported by Gurt and coworkers. (Gurt et al. 2015; He et al. 2010). SIRT1 directly represses osteoclastogenesis by suppressing reactive oxygen species generation and tumor necrosis factor-α (TNF-α)-regulated TRPV1 channel stimulation (Yan et al. 2019b). To illuminate the molecular mechanism of miR-9-5p regulation on wear particle-induced peri-implant osteolysis, we investigated the correlation of miR-9-5p and SIRT1 based on bioinformatic predictions. As indicated in the luciferase assay, miR-9-5p modulated the luciferase activity of the SIRT1 3ʹ-UTR reporter gene but not the mutated version. The miR-9-5p inhibitor group behaved like the control group. These results suggested that miR-9-5p targeted SIRT1.

Osteoclasts are polymorphonuclear cells arising from the fusion of monocytes and macrophages of hematopoietic lineage in bone marrow and produce high levels of cathepsin K and TRAP 3 (Suda et al. 1992). RANKL, TNF-α, interleukin-1β, and macrophage colony-stimulating factor are thought to activate osteoclasts (Boyle et al. 2003; Janowska-Wieczorek et al. 1991; Sharkey et al. 2014; Pacifici 1998; Manolagas and Jilka 1995). Osteoclast differentiation is regulated post-transcriptionally and during and after translation. MiRNA is an important post-transcriptional regulator of gene expression (Marcelis et al. 2008). Osteoclasts are the direct effector cells that mediate wear particle-induced osteolysis. Thus, the ability of miR-9-5p to regulate osteoclast activity was investigated. Histological results showed large continuous TRAP-positive areas around the PE-induced cells in miR-9-5p mimic groups and only a few TRAP-positive cells in NC mimic. In addition, the mRNA and protein expression of osteoclast markers cathepsin K, MMP-9, MMP-2, and TRAP can be promoted by miR-9-5p. These results indicated that miR-9-5p aggravated osteolysis caused by PE particles by promoting the formation of osteoclasts. miR-9-5p was confirmed to be an important regulator of osteoblast differentiation.

NF-κB has a vital effect on the inflammatory process (Ghosh and Karin 2002). It has been demonstrated that NF-κB is an essential modulator of bone remodeling and wear particle-induced osteolysis (Jimi et al. 2004; Sharkey et al. 2014; Karin 1999; Chang et al. 2013; Yu et al. 2014), Ping et.al revealed that suppression of inflammatory bone disruption can be achieved by repressing NF-κB activation (Ping et al. 2017). Hah et. al reported that deletion of SIRT1 resulted in over acetylation and overactivation of NF-kB, thus causing the worsening of inflammatory arthritis (Hah et al. 2014). We showed that miR-9-5p suppressed SIRT1 expression and promoted the phosphorylation of NF-κB pathway-associated proteins Ikk α, IκB α, NF-κB, p50, and p65, stimulating NF-κB pathway activation in PE-induced cells. However, the promotion of wear particle-induced osteoclastogenesis by miR-9-5p could be reversed by upregulating SIRT1 or inhibiting the NF-kB signaling pathway. The above data suggested that miR-9-5p facilitated PE-induced osteoclastogenesis through the SIRT1/NF-κB pathway.

Conclusion

In brief, this study showed that miR-9-5p participated in the mechanism of PIO occurrence. Wear particle-induced osteoclastogenesis in RAW 264.7 cells was facilitated by miR-9-5p through activating the SIRT1/NF-κB signaling pathway. Our study had the limitation of not investigating the function of miR-9-5p in osteoclast formation in vivo but is planned for our future research. In summary, our current research suggests a central role of miR-9-5p in the pathogenesis of PIO, identifying a prospective target for the treatment of osteolysis-related disease that is likely to offer new insights for further work on the pathology of periprosthetic osteolysis.

Author contributions

Liang Zhang designed the research. Liang Zhang wrote the manuscript with contributions from all authors. All authors participated in part of the experiment. Weidong Zhao and Dongmei Bao are responsible for data acquisition and analysis. Zhihui Gao is responsible for statistical analysis. Kening Sun and Peng Li are responsible for the literature search. Zhidong Lu reviewed and modified the article. All authors read and approved the final manuscript.

Funding

This study was supported by Natural Science Foundation of Ningxia Province (Grant No. 2019AAC03209).

Availability of data and materials

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Ethics approval

This experiment abides by the principle of experimental animals. All experimental animals are treated in accordance with the principles of experimental animals, and the experiment is approved by the Ethics Committee of the General Hospital of Ningxia Medical University. The permission number for ethical approval of animals was 2019-241.

References

  1. Almeida M, Porter R. Sirtuins and FoxOs in osteoporosis and osteoarthritis. Bone. 2019;121:284–292. doi: 10.1016/j.bone.2019.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Babion I, Jaspers A, van Splunter A, van der Hoorn I, Wilting S, Steenbergen R. miR-9–5p exerts a dual role in cervical cancer and targets transcription factor TWIST1. Cells. 2019 doi: 10.3390/cells9010065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bandini E, Fanini F, Vannini I, Rossi T, Plousiou M, Tumedei M, Limarzi F, Maltoni R, Fabbri F, Hrelia S, Cho W, Fabbri M. miR-9-5p as a regulator of the androgen receptor pathway in breast cancer cell lines. Front Cell Dev Biol. 2020;8:579160. doi: 10.3389/fcell.2020.579160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bartel D. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–297. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  5. Baur J, Ungvari Z, Minor R, Le Couteur D, de Cabo R. Are sirtuins viable targets for improving healthspan and lifespan? Nat Rev Drug Discov. 2012;11(6):443–461. doi: 10.1038/nrd3738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boyle W, Simonet W, Lacey D. Osteoclast differentiation and activation. Nature. 2003;423(6937):337–342. doi: 10.1038/nature01658. [DOI] [PubMed] [Google Scholar]
  7. Bu Y, Zheng D, Wang L, Liu J. Abrasive endoprosthetic wear particles inhibit IFN-γ secretion in human monocytes via upregulating TNF-α-induced miR-29b. Inflammation. 2017;40(1):166–173. doi: 10.1007/s10753-016-0465-5. [DOI] [PubMed] [Google Scholar]
  8. Chang J, Liu F, Lee M, Wu B, Ting K, Zara J, Soo C, Al Hezaimi K, Zou W, Chen X, Mooney D, Wang C. NF-κB inhibits osteogenic differentiation of mesenchymal stem cells by promoting β-catenin degradation. Proc Natl Acad Sci USA. 2013;110(23):9469–9474. doi: 10.1073/pnas.1300532110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen Y, Wang X, Yang M, Ruan W, Wei W, Gu D, Wang J, Guo X, Guo L, Yuan Y. miR-145-5p increases osteoclast numbers in vitro and aggravates bone erosion in collagen-induced arthritis by targeting osteoprotegerin. Med Sci Monitor. 2018;24:5292–5300. doi: 10.12659/msm.908219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen H, Yang J, Tan Z. Upregulation of microRNA-9-5p inhibits apoptosis of chondrocytes through downregulating Tnc in mice with osteoarthritis following tibial plateau fracture. J Cell Physiol. 2019;234(12):23326–23336. doi: 10.1002/jcp.28900. [DOI] [PubMed] [Google Scholar]
  11. Clarke B, Khosla S. Physiology of bone loss. Radiol Clin N Am. 2010;48(3):483–495. doi: 10.1016/j.rcl.2010.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cong F, Wu N, Tian X, Fan J, Liu J, Song T, Fu H. MicroRNA-34c promotes osteoclast differentiation through targeting LGR4. Gene. 2017;610:1–8. doi: 10.1016/j.gene.2017.01.028. [DOI] [PubMed] [Google Scholar]
  13. Croce C. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 2009;10(10):704–714. doi: 10.1038/nrg2634s. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Edwards J, Perrien D, Fleming N, Nyman J, Ono K, Connelly L, Moore M, Lwin S, Yull F, Mundy G, Elefteriou F. Silent information regulator (Sir)T1 inhibits NF-κB signaling to maintain normal skeletal remodeling. J Bone Miner Res. 2013;28(4):960–969. doi: 10.1002/jbmr.1824. [DOI] [PubMed] [Google Scholar]
  15. Fehring T, Odum S, Griffin W, Mason J, Nadaud M. Early failures in total knee arthroplasty. Clin Orthop Relat Res. 2001;392:315–318. doi: 10.1097/00003086-200111000-00041. [DOI] [PubMed] [Google Scholar]
  16. Franceschetti T, Kessler C, Lee S, Delany A. miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. J Biol Chem. 2013;288(46):33347–33360. doi: 10.1074/jbc.M113.484568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ghosh H. The anti-aging, metabolism potential of SIRT1. Curr Opin Invest Drugs. 2008;9(10):1095–1102. [PubMed] [Google Scholar]
  18. Ghosh S, Karin M. Missing pieces in the NF-kappaB puzzle. Cell. 2002 doi: 10.1016/s0092-8674(02)00703-1. [DOI] [PubMed] [Google Scholar]
  19. Goldring S, Schiller A, Roelke M, Rourke C, O'Neil D, Harris W. The synovial-like membrane at the bone-cement interface in loose total hip replacements and its proposed role in bone lysis. J Bone Joint Surg Am. 1983;65(5):575–584. doi: 10.2106/00004623-198365050-00001. [DOI] [PubMed] [Google Scholar]
  20. Greenfield E, Bi Y, Ragab A, Goldberg V, Van De Motter R. The role of osteoclast differentiation in aseptic loosening. J Orthopaedic Res. 2002;20(1):1–8. doi: 10.1016/s0736-0266(01)00070-5. [DOI] [PubMed] [Google Scholar]
  21. Gurt I, Artsi H, Cohen-Kfir E, Hamdani G, Ben-Shalom G, Feinstein B, El-Haj M, Dresner-Pollak R. The Sirt1 activators SRT2183 and SRT3025 inhibit RANKL-induced osteoclastogenesis in bone marrow-derived macrophages and down-regulate Sirt3 in Sirt1 null cells. PLoS ONE. 2015;10(7):e0134391. doi: 10.1371/journal.pone.0134391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hah Y, Cheon Y, Lim H, Cho H, Park B, Ka S, Lee Y, Jeong D, Kim H, Han M, Lee S. Myeloid deletion of SIRT1 aggravates serum transfer arthritis in mice via nuclear factor-κB activation. PLoS ONE. 2014;9(2):e87733. doi: 10.1371/journal.pone.0087733s. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Haigis M, Guarente L. Mammalian sirtuins–emerging roles in physiology, aging, and calorie restriction. Genes Dev. 2006;20(21):2913–2921. doi: 10.1101/gad.1467506. [DOI] [PubMed] [Google Scholar]
  24. Haigis M, Sinclair D. Mammalian sirtuins: biological insights and disease relevance. Annu Rev Pathol. 2010;5:253–295. doi: 10.1146/annurev.pathol.4.110807.092250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Harris W. Wear and periprosthetic osteolysis: the problem. Clin Orthop Relat Res. 2001;393:66–70. doi: 10.1097/00003086-200112000-00007s. [DOI] [PubMed] [Google Scholar]
  26. He X, Andersson G, Lindgren U, Li Y. Resveratrol prevents RANKL-induced osteoclast differentiation of murine osteoclast progenitor RAW 264.7 cells through inhibition of ROS production. Biochem Biophys Res Commun. 2010;401(3):356–362. doi: 10.1016/j.bbrc.2010.09.053. [DOI] [PubMed] [Google Scholar]
  27. Herberts P, Malchau H. Long-term registration has improved the quality of hip replacement: a review of the Swedish THR Register comparing 160,000 cases. Acta Orthop Scand. 2000;71(2):111–121. doi: 10.1080/000164700317413067. [DOI] [PubMed] [Google Scholar]
  28. Holt G, Murnaghan C, Reilly J, Meek R. The biology of aseptic osteolysis. Clin Orthop Relat Res. 2007;460:240–252. doi: 10.1097/BLO.0b013e31804b4147. [DOI] [PubMed] [Google Scholar]
  29. Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet. 2011;12(2):99–110. doi: 10.1038/nrg2936. [DOI] [PubMed] [Google Scholar]
  30. Inui M, Martello G, Piccolo S. MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 2010;11(4):252–263. doi: 10.1038/nrm2868. [DOI] [PubMed] [Google Scholar]
  31. Janowska-Wieczorek A, Belch A, Jacobs A, Bowen D, Padua R, Paietta E, Stanley E. Increased circulating colony-stimulating factor-1 in patients with preleukemia, leukemia, and lymphoid malignancies. Blood. 1991;77(8):1796–1803. doi: 10.1182/blood.V77.8.1796.1796. [DOI] [PubMed] [Google Scholar]
  32. Jiang Z, Jiang J, Ma Y, Li H, Shi W, Fu P, Xu C, Lu J, Fu D, Xu J. Downregulation of miR-223 and miR-19a induces differentiation and promotes recruitment of osteoclast cells in giant-cell tumor of the bone via the Runx2/TWIST-RANK/RANKL pathway. Biochem Biophys Res Commun. 2018;505(4):1003–1009. doi: 10.1016/j.bbrc.2018.10.025. [DOI] [PubMed] [Google Scholar]
  33. Jimi E, Aoki K, Saito H, D'Acquisto F, May M, Nakamura I, Sudo T, Kojima T, Okamoto F, Fukushima H, Okabe K, Ohya K, Ghosh S. Selective inhibition of NF-kappa B blocks osteoclastogenesis and prevents inflammatory bone destruction in vivo. Nat Med. 2004;10(6):617–624. doi: 10.1038/nm1054. [DOI] [PubMed] [Google Scholar]
  34. Jin Z, Ren J, Qi S. Exosomal miR-9-5p secreted by bone marrow-derived mesenchymal stem cells alleviates osteoarthritis by inhibiting syndecan-1. Cell Tissue Res. 2020;381(1):99–114. doi: 10.1007/s00441-020-03193-x. [DOI] [PubMed] [Google Scholar]
  35. Karin M. How NF-kappaB is activated: the role of the IkappaB kinase (IKK) complex. Oncogene. 1999;18(49):6867–6874. doi: 10.1038/sj.onc.1203219. [DOI] [PubMed] [Google Scholar]
  36. Kawai A, Lin P, Boland P, Athanasian E, Healey J. Relationship between magnitude of resection, complication, and prosthetic survival after prosthetic knee reconstructions for distal femoral tumors. J Surg Oncol. 1999;70(2):109–115. doi: 10.1002/(sici)1096-9098(199902)70:2<109::aid-jso9>3.0.co;2-x. [DOI] [PubMed] [Google Scholar]
  37. Li J, Ju J, Ni B, Wang H. The emerging role of miR-506 in cancer. Oncotarget. 2016;7(38):62778–62788. doi: 10.18632/oncotarget.11294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li X, He L, Yue Q, Lu J, Kang N, Xu X, Wang H, Zhang H. MiR-9-5p promotes MSC migration by activating β-catenin signaling pathway. Am J Physiol Cell Physiol. 2017;313(1):C80–C93. doi: 10.1152/ajpcell.00232.2016. [DOI] [PubMed] [Google Scholar]
  39. Li Z, Li Y, Li Q, Zhang Z, Jiang L, Li X. Role of miR-9-5p in preventing peripheral neuropathy in patients with rheumatoid arthritis by targeting REST/miR-132 pathway. Vitro Cell Dev Biol Anim. 2019;55(1):52–61. doi: 10.1007/s11626-018-0310-2. [DOI] [PubMed] [Google Scholar]
  40. Lou Z, Peng Z, Wang B, Li X, Li X, Zhang X. miR-142-5p promotes the osteoclast differentiation of bone marrow-derived macrophages via PTEN/PI3K/AKT/FoxO1 pathway. J Bone Miner Metab. 2019;37(5):815–824. doi: 10.1007/s00774-019-00997-y. [DOI] [PubMed] [Google Scholar]
  41. Manolagas S, Jilka R. Bone marrow, cytokines, and bone remodelling. Emerging insights into the pathophysiology of osteoporosis. N Engl J Med. 1995;332(5):305–311. doi: 10.1056/nejm199502023320506. [DOI] [PubMed] [Google Scholar]
  42. Mao Z, Zhu Y, Hao W, Chu C, Su H. MicroRNA-155 inhibition up-regulates LEPR to inhibit osteoclast activation and bone resorption via activation of AMPK in alendronate-treated osteoporotic mice. IUBMB Life. 2019;71(12):1916–1928. doi: 10.1002/iub.2131. [DOI] [PubMed] [Google Scholar]
  43. Marcelis C, Hol F, Graham G, Rieu P, Kellermayer R, Meijer R, Lugtenberg D, Scheffer H, van Bokhoven H, Brunner H, de Brouwer A. Genotype-phenotype correlations in MYCN-related Feingold syndrome. Hum Mutat. 2008;29(9):1125–1132. doi: 10.1002/humu.20750. [DOI] [PubMed] [Google Scholar]
  44. Merkel K, Erdmann J, McHugh K, Abu-Amer Y, Ross F, Teitelbaum S. Tumor necrosis factor-alpha mediates orthopedic implant osteolysis. Am J Pathol. 1999;154(1):203–210. doi: 10.1016/s0002-9440(10)65266-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mizoguchi F, Murakami Y, Saito T, Miyasaka N, Kohsaka H. miR-31 controls osteoclast formation and bone resorption by targeting RhoA. Arthritis Res Ther. 2013;15(5):R102. doi: 10.1186/ar4282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mulroy W, Estok D, Harris W. Total hip arthroplasty with use of so-called second-generation cementing techniques. A fifteen-year-average follow-up study. J Bone Joint Surg Am. 1995;77(12):1845–1852. doi: 10.2106/00004623-199512000-00008. [DOI] [PubMed] [Google Scholar]
  47. Noordin S, Masri B. Periprosthetic osteolysis: genetics, mechanisms and potential therapeutic interventions. Can J Surg. 2012;55(6):408–417. doi: 10.1503/cjs.003711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Otto M, Kriegsmann J, Gehrke T, Bertz S. Wear particles: key to aseptic prosthetic loosening? Pathologe. 2006;27(6):447–460. doi: 10.1007/s00292-006-0868-4. [DOI] [PubMed] [Google Scholar]
  49. Pacifici R. Cytokines, estrogen, and postmenopausal osteoporosis–the second decade. Endocrinology. 1998;139(6):2659–2661. doi: 10.1210/endo.139.6.6087. [DOI] [PubMed] [Google Scholar]
  50. Ping Z, Wang Z, Shi J, Wang L, Guo X, Zhou W, Hu X, Wu X, Liu Y, Zhang W, Yang H, Xu Y, Gu Y, Geng D. Inhibitory effects of melatonin on titanium particle-induced inflammatory bone resorption and osteoclastogenesis via suppression of NF-κB signaling. Acta Biomater. 2017;62:362–371. doi: 10.1016/j.actbio.2017.08.046. [DOI] [PubMed] [Google Scholar]
  51. Purdue P, Koulouvaris P, Nestor B, Sculco T. The central role of wear debris in periprosthetic osteolysis. HSS J Musculoskeletal J Hosp Spl Surg. 2006;2(2):102–113. doi: 10.1007/s11420-006-9003-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Purdue P, Koulouvaris P, Potter H, Nestor B, Sculco T. The cellular and molecular biology of periprosthetic osteolysis. Clin Orthop Relat Res. 2007;454:251–261. doi: 10.1097/01.blo.0000238813.95035.1b. [DOI] [PubMed] [Google Scholar]
  53. Rao A, Gibon E, Ma T, Yao Z, Smith R, Goodman S. Revision joint replacement, wear particles, and macrophage polarization. Acta Biomater. 2012;8(7):2815–2823. doi: 10.1016/j.actbio.2012.03.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Robertsson O, Knutson K, Lewold S, Lidgren L. The Swedish knee arthroplasty register 1975–1997: an update with special emphasis on 41,223 knees operated on in 1988–1997. Acta Orthop Scand. 2001;72(5):503–513. doi: 10.1080/000164701753532853. [DOI] [PubMed] [Google Scholar]
  55. Schug T, Xu Q, Gao H, Peres-da-Silva A, Draper D, Fessler M, Purushotham A, Li X. Myeloid deletion of SIRT1 induces inflammatory signaling in response to environmental stress. Mol Cell Biol. 2010;30(19):4712–4721. doi: 10.1128/mcb.00657-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Schulte K, Callaghan J, Kelley S, Johnston R. The outcome of Charnley total hip arthroplasty with cement after a minimum twenty-year follow-up. The results of one surgeon. J Bone Joint Surg Am. 1993;75(7):961–975. doi: 10.2106/00004623-199307000-00002. [DOI] [PubMed] [Google Scholar]
  57. Sebastián C, Satterstrom F, Haigis M, Mostoslavsky R. From sirtuin biology to human diseases: an update. J Biol Chem. 2012;287(51):42444–42452. doi: 10.1074/jbc.R112.402768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Shakibaei M, Buhrmann C, Mobasheri A. Resveratrol-mediated SIRT-1 interactions with p300 modulate receptor activator of NF-kappaB ligand (RANKL) activation of NF-kappaB signaling and inhibit osteoclastogenesis in bone-derived cells. J Biol Chem. 2011;286(13):11492–11505. doi: 10.1074/jbc.M110.198713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sharkey P, Lichstein P, Shen C, Tokarski A, Parvizi J. Why are total knee arthroplasties failing today–has anything changed after 10 years? J Arthroplasty. 2014;29(9):1774–1778. doi: 10.1016/j.arth.2013.07.024. [DOI] [PubMed] [Google Scholar]
  60. Suda T, Takahashi N, Martin T. Modulation of osteoclast differentiation. Endocr Rev. 1992;13(1):66–80. doi: 10.1210/edrv-13-1-66. [DOI] [PubMed] [Google Scholar]
  61. Sun T, Leung F, Lu W. MiR-9-5p, miR-675-5p and miR-138-5p damages the strontium and LRP5-mediated skeletal cell proliferation, differentiation, and adhesion. Int J Mol Sci. 2016;17(2):236. doi: 10.3390/ijms17020236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Sun L, Lian J, Meng S. MiR-125a-5p promotes osteoclastogenesis by targeting TNFRSF1B. Cell Mol Biol Lett. 2019;24:23. doi: 10.1186/s11658-019-0146-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Sundfeldt M, Carlsson L, Johansson C, Thomsen P, Gretzer C. Aseptic loosening, not only a question of wear: a review of different theories. Acta Orthop. 2006;77(2):177–197. doi: 10.1080/17453670610045902. [DOI] [PubMed] [Google Scholar]
  64. Tolosa E, Botta-Orfila T, Morató X, Calatayud C, Ferrer-Lorente R, Martí M, Fernández M, Gaig C, Raya Á, Consiglio A, Ezquerra M, Fernández-Santiago R. MicroRNA alterations in iPSC-derived dopaminergic neurons from Parkinson disease patients. Neurobiol Aging. 2018;69:283–291. doi: 10.1016/j.neurobiolaging.2018.05.032. [DOI] [PubMed] [Google Scholar]
  65. Wang Z, Sun L, Jia K, Wang H, Wang X. miR-9-5p modulates the progression of Parkinson's disease by targeting SIRT1. Neurosci Lett. 2019;701:226–233. doi: 10.1016/j.neulet.2019.02.038. [DOI] [PubMed] [Google Scholar]
  66. Wang L, Cui M, Cheng D, Qu F, Yu J, Wei Y, Cheng L, Wu X, Liu X. miR-9-5p facilitates hepatocellular carcinoma cell proliferation, migration and invasion by targeting ESR1. Mol Cell Biochem. 2020 doi: 10.1007/s11010-020-03927-z. [DOI] [PubMed] [Google Scholar]
  67. Wedemeyer C, Xu J, Neuerburg C, Landgraeber S, Malyar N, von Knoch F, Gosheger G, von Knoch M, Löer F, Saxler G. Particle-induced osteolysis in three-dimensional micro-computed tomography. Calcif Tissue Int. 2007;81(5):394–402. doi: 10.1007/s00223-007-9077-2. [DOI] [PubMed] [Google Scholar]
  68. Xiao Y, Zhang Y, Chen Y, Li J, Zhang Z, Sun Y, Shen H, Zhao Z, Huang Z, Zhang W, Chen W, Shen Z. Inhibition of MicroRNA-9-5p protects against cardiac remodeling following myocardial infarction in mice. Hum Gene Ther. 2019;30(3):286–301. doi: 10.1089/hum.2018.059. [DOI] [PubMed] [Google Scholar]
  69. Xie C, Cao Y, Huang Y, Shi Q, Guo J, Fan Z, Li J, Chen B, Wu B. Long non-coding RNA TUG1 contributes to tumorigenesis of human osteosarcoma by sponging miR-9-5p and regulating POU2F1 expression. Tumour Biol J Int Soc Oncodev Biol Med. 2016;37(11):15031–15041. doi: 10.1007/s13277-016-5391-5. [DOI] [PubMed] [Google Scholar]
  70. Yan S, Miao L, Lu Y, Wang L. MicroRNA-506 upregulation contributes to sirtuin 1 inhibition of osteoclastogenesis in bone marrow stromal cells induced by TNF-α treatment. Cell Biochem Funct. 2019;37(8):598–607. doi: 10.1002/cbf.3436. [DOI] [PubMed] [Google Scholar]
  71. Yan S, Miao L, Lu Y, Wang L. Sirtuin 1 inhibits TNF-α-mediated osteoclastogenesis of bone marrow-derived macrophages through both ROS generation and TRPV1 activation. Mol Cell Biochem. 2019;455:135–145. doi: 10.1007/s11010-018-3477-7. [DOI] [PubMed] [Google Scholar]
  72. Ying M, Feng H, Zhang X, Liu R, Ning H. MiR-9-5p inhibits the proliferation, migration and invasion of choroidal melanoma by targeting BRAF. Technol Cancer Res Treat. 2020;19:1533033820956987. doi: 10.1177/1533033820956987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Yu B, Chang J, Liu Y, Li J, Kevork K, Al-Hezaimi K, Graves D, Park N, Wang C. Wnt4 signaling prevents skeletal aging and inflammation by inhibiting nuclear factor-κB. Nat Med. 2014;20(9):1009–1017. doi: 10.1038/nm.3586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zainabadi K, Liu C, Caldwell A, Guarente L. SIRT1 is a positive regulator of in vivo bone mass and a therapeutic target for osteoporosis. PLoS ONE. 2017;12(9):e0185236. doi: 10.1371/journal.pone.0185236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Zhang Y, Lin Y, Xiao L, Feng E, Wang W, Lin L. The effects of icariine concentration on osteoclasts bone resorption induced by titanium particles in vitro. Regener Biomater. 2015;2(3):197–202. doi: 10.1093/rb/rbv002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zhang H, Li Y, Tan Y, Liu Q, Jiang S, Liu D, Chen Q, Zhang S. MiR-9-5p inhibits glioblastoma cells proliferation through directly targeting FOXP2 (Forkhead Box P2) Front Oncol. 2019;9:1176. doi: 10.3389/fonc.2019.01176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Zheng C, Bai C, Sun Q, Zhang F, Yu Q, Zhao X, Kang S, Li J, Jia Y. Long noncoding RNA XIST regulates osteogenic differentiation of human bone marrow mesenchymal stem cells by targeting miR-9-5p. Mech Dev. 2020;162:103612. doi: 10.1016/j.mod.2020.103612. [DOI] [PubMed] [Google Scholar]
  78. Zheng J, Shao S, Dai C, Guan S, Chen H. miR-9-5p promotes the invasion and migration of endometrial stromal cells in endometriosis patients through the SIRT1/NF-κB pathway. Int J Clin Exp Pathol. 2020;13(7):1859–1866. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES