Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 May 10.
Published in final edited form as: Cell Rep. 2020 May 26;31(8):107684. doi: 10.1016/j.celrep.2020.107684

CXCR4 Signaling Has a CXCL12-Independent Essential Role in Murine MLL-AF9-Driven Acute Myeloid Leukemia

Ramprasad Ramakrishnan 1, Pablo Peña-Martínez 1, Puneet Agarwal 2, Maria Rodriguez-Zabala 1, Marion Chapellier 1, Carl Högberg 1, Mia Eriksson 1, David Yudovich 3, Mansi Shah 2, Mats Ehinger 4, Björn Nilsson 5, Jonas Larsson 3, Anna Hagström-Andersson 1, Benjamin L Ebert 6, Ravi Bhatia 2, Marcus Järås 1,7,*
PMCID: PMC8109054  NIHMSID: NIHMS1693424  PMID: 32460032

SUMMARY

Acute myeloid leukemia (AML) is defined by an accumulation of immature myeloid blasts in the bone marrow. To identify key dependencies of AML stem cells in vivo, here we use a CRISPR-Cas9 screen targeting cell surface genes in a syngeneic MLL-AF9 AML mouse model and show that CXCR4 is a top cell surface regulator of AML cell growth and survival. Deletion of Cxcr4 in AML cells eradicates leukemia cells in vivo without impairing their homing to the bone marrow. In contrast, the CXCR4 ligand CXCL12 is dispensable for leukemia development in recipient mice. Moreover, expression of mutated Cxcr4 variants reveals that CXCR4 signaling is essential for leukemia cells. Notably, loss of CXCR4 signaling in leukemia cells leads to oxidative stress and differentiation in vivo. Taken together, our results identify CXCR4 signaling as essential for AML stem cells by protecting them from differentiation independent of CXCL12 stimulation.

In Brief

In an in vivo CRISPR screen, Ramakrishnan et al. identify CXCR4 as a critical regulator of AML stem cells. Although the CXCR4 ligand CXCL12 is dispensable for leukemia development, CXCR4 signaling is essential for AML cells because it protects them from differentiation.

Graphical Abstract

graphic file with name nihms-1693424-f0001.jpg

INTRODUCTION

Acute myeloid leukemia (AML) is a clonal disorder characterized by accumulation of immature, abnormally differentiated myeloid cells in the bone marrow. In adults, AML is the most common acute leukemia and is associated with poor survival (Döhner et al., 2015). The disease is sustained by a small population of leukemic cells, termed leukemia stem cells (LSCs), with self-renewal capacity (Dick, 2005). Within the bone marrow, leukemic cells modulate the microenvironment in a manner that promotes leukemia progression over normal blood cell development and contributes to protection from chemotherapy (Schepers et al., 2015; Shlush et al., 2017; Welner et al., 2015). In addition to anchoring LSCs to the bone marrow niche, binding of ligands to cell surface receptors on LSCs triggers cell signaling, which regulates core components of the LSC entity, such as self-renewal, proliferation, differentiation, and localization (Schepers et al., 2015). Certain cell surface receptors, including CD44, CD123, CD99, CD97, and IL1RAP, which are upregulated on LSCs compared with normal hematopoietic stem and progenitor cells (HSPCs), have been shown to convey signals that support leukemia progression (Charrad et al., 1999; Chung et al., 2017; Järås et al., 2010; Jordan et al., 2000; Martin et al., 2019). Such interactions can also facilitate immune evasion, as exemplified by upregulation of CD47 on leukemia cells that inhibit phagocytes by binding to SIRP-α (Majeti et al., 2009). Many of these cell surface proteins have been successfully explored as therapeutic targets in preclinical models using blocking antibodies and antibodies that direct the immune system to leukemia cells (Ågerstam et al., 2015; Jin et al., 2006, 2009; Tseng et al., 2013). These studies highlight that identifying cell surface proteins upregulated on LSCs relative to normal HSPCs may not only contribute to our understanding of the intricate processes that regulate LSCs, but it can also reveal new therapeutic opportunities. However, because not all upregulated cell surface proteins on LSCs may be functionally important for their growth and survival, there is a need to develop tools that identify cell surface proteins that are biologically important for LSCs under physiological conditions.

A powerful approach to identify genes that are critical for leukemia cells in vivo is to perform forward genetic screens. By applying in vivo RNA interference (RNAi) screens in a murine AML model, we and others have identified several leukemia-specific dependencies (Järås et al., 2014; Miller et al., 2013; Vu et al., 2017; Zuber et al., 2011). Although powerful, RNAi screens are associated with a high rate of off-target effects and, in recent years, have often been replaced by CRISPR-based methods because these are associated with higher specificity and efficacy (Liberali et al., 2015).

In this study, we performed an in vivo pooled CRISPR screen that targeted selected cell surface genes that are upregulated in murine MLL-AF9 (KMT2A-MLLT3) LSC-enriched cells and identified CXCR4 as the top regulator of leukemia-initiating cells. Notably, CXCR4 signaling was found to be essential for LSCs independent of its ligand CXCL12 (SDF-1) in vivo by protecting them from differentiation.

RESULTS

CRISPR Screening Identifies In Vivo Dependencies of MLL-AF9-Driven Leukemia

To identify cell surface proteins critical for AML cells in vivo, we generated a CRISPR single guide RNA (sgRNA) library targeting 96 cell surface genes (Table S1; Figures S1AS1C). The genes targeted were selected based on their upregulation in leukemic granulocyte-monocyte progenitor (GMP; LinSca-1c-Kit+CD34+FcγRII/III+) cells, enriched for LSCs in the MLL-AF9-driven murine leukemia model, relative to normal GMPs, according to global gene expression data (Table S1; Krivtsov et al., 2006; Wang et al., 2010).

For the CRISPR screen, we used an MLL-AF9-driven murine leukemia model we generated previously in a dsRed-transgenic background, allowing convenient tracking of leukemia cells upon serial transplantation in recipient mice (Miller et al., 2013). This AML model is suitable for screens because of its short disease latency and high penetrance (Chapellier et al., 2019; Krivtsov et al., 2006; Puram et al., 2016). Cas9-expressing MLL-AF9 leukemia cells (Peña-Martínez et al., 2018) were enriched for LSCs by c-Kit selection (Figure S1D), transduced with the sgRNA pool, and transplanted into five sublethally irradiated recipient mice (Figure 1A). To assess the input representation of sgRNAs within the pool, a fraction of the cells was harvested 24 h (T0) after transduction. Twelve days after transplantation (T12), the bone marrow of recipient mice was harvested, genomic DNA was extracted, and the sgRNAs were PCR amplified prior to sequencing. Based on the number of sgRNAs per gene that were either enriched or depleted beyond a threshold of a median fold change of 2.0 across 5 biological replicates, a ranked gene list of candidate LSC regulators was generated (Figures 1B and 1C; Table S2). Although representation of a nontargeting control sgRNA did not change significantly in vivo, 5 of 5 sgRNAs targeting the positive control Hoxa9, essential for MLL-AF9 leukemia cells (Faber et al., 2009), showed a median depletion of more than 2-fold, demonstrating that the screen was robust (Figure 1C). The genes that ranked as the most important positive regulators for LSCs were Cxcr4, Cd47, Pira6, Ifngr1, and Cd244; at least two sgRNAs targeting these genes showed a depletion of a fold change of more than 2.0 (Figure 1C). Lrp10 was identified as the only negative regulator of LSCs, with 4 of 5 sgRNAs showing more than 2-fold enrichment. By generating lentiviral vectors expressing sgRNAs targeting Lrp10 from the screen and with coexpression of tRFP657, the findings from the screen could be successfully validated, with a significant enrichment of sgRNAs in vivo upon leukemia development in mice (p < 0.01) (Figure S1E).

Figure 1. CRISPR Screening Identifies Cxcr4 as a Critical Regulator of AML Cells In Vivo.

Figure 1.

(A) Schematic of the pooled in vivo CRISPR screen. In brief, 1 × 106 Cas9+dsRed+ MLL-AF9 leukemia cells were transduced with the lentiviral CRISPR sgRNA library targeting selected murine cell surface genes and transplanted into mice (n = 5) after 24 h (T0). Twelve days (T12) after transplantation, the mice were sacrificed, and the bone marrow was harvested. The representation of sgRNAs was determined by next-generation sequencing (NGS) on genomic DNA of leukemic cells from T0 and T12.

(B) Waterfall plot showing the log2 fold change of the 486 unique sgRNAs at T12 versus T0 in a ranked format. The red dotted line indicates the threshold for the sgRNAs that were enriched (red box), and the blue dotted line indicates the threshold for depleted (blue box) sgRNAs in the screen. The red arrow denotes the nontargeting control (NTC) sgRNA.

(C) Waterfall plot showing the log2 fold change of sgRNAs for the top-ranked genes in the screen. The red dotted line indicates the threshold for the sgRNAs that were enriched, and the blue dotted line indicates the threshold for depleted sgRNAs in the screen. The log2 fold change threshold of 1.0 corresponds to an absolute fold change of 2.0.

See also Figure S1 and Tables S1, S2, and S3.

CXCR4 Is Critical for MLL-AF9 Leukemia Cell Growth and Survival In Vivo

Cxcr4 was identified as the top-ranked positive regulator of leukemia cells, with all 5 sgRNAs showing a median depletion of a fold change of more than 2.0 in vivo and with one sgRNA depleted more than 30-fold (5.1-fold depletion in log2 scale) (Figure 1C). High expression of CXCR4 in AML cells has been associated previously with poor prognosis (Spoo et al., 2007; Ahn et al., 2013; Du et al., 2019). In transcriptomics data from AML patients (Ley et al., 2013), we found mildly but significantly increased expression of Cxcr4 in the M5 (monocytic differentiation) subtype and in MLL-rearranged AML (Figures S2A and S2B). Although CXCR4 has been shown to regulate leukemia-initiating cells in T cell acute lymphoblastic leukemia (Passaro et al., 2015), the functional role of CXCR4 in AML development has remained elusive (Monaco et al., 2004; Tavor et al., 2004) and has so far not been investigated using genetic deletion of Cxcr4 in AML cells. Thus, to unravel how CXCR4 regulates the growth and survival of MLL-AF9 AML cells under syngeneic conditions, we selected CXCR4 for follow-up studies.

We first validated the importance of Cxcr4 in AML by transducing Cas9+dsRed+ MLL-AF9 leukemia cells with two different sgRNA-expressing vectors targeting Cxcr4 and coexpressing GFP (Figure 2A). Both sgRNAs induced more than 90% gene editing in the Cxcr4 locus, resulting in loss of CXCR4 expression (Figures 2B and 2C). We next studied how Cxcr4 disruption affects leukemia cells under physiological conditions by performing a competition assay between GFP+ (sgRNA-expressing) and GFP cells in vivo. Consistent with our findings from the screen, GFP+ leukemia cells expressing Cxcr4 sgRNAs transplanted into sublethally irradiated recipient mice showed strong depletion in the bone marrow and spleen compared with GFP+ leukemia cells expressing a control sgRNA (Figure 2D; Figure S3A). In contrast, a corresponding competition assay in vitro with standard cytokines (interleukin-3 [IL-3], IL-6, and stem cell factor [SCF]) demonstrated that disruption of Cxcr4 in c-Kit+ leukemia cells did not affect cell proliferation (FigureS3B). However, by culturing leukemia cells under low stimulatory conditions without cytokines, mild but significant depletion of Cxcr4 sgRNA-expressing GFP+ leukemia cells was observed, suggesting that CXCR4 provides signaling that supportscellular growth and survival (Figure 2E). Combined, these data reveal a critical role of CXCR4 in AML cell growth and survival in vivo.

Figure 2. CXCR4 Is Critical for Growth and Survival of Leukemia Cells In Vivo.

Figure 2.

(A) Green fluorescent protein (GFP) expression inCas9+dsRed+ leukemia cells following transduction with lentiviral vectors coexpressing control or Cxcr4 sgRNAs and GFP.

(B) Quantification of CRISPR editing in Cxcr4 by NGS within sorted GFP+ leukemia cells 3 days after transduction.

(C) CXCR4 cell surface expression as measured by flow cytometry on dsRed+ leukemia cells expressing sgRNAs targeting Cxcr4 3 days after transduction.

(D) Mice (n = 8 for each group) were transplanted with leukemia cells transduced with lentiviral vectors coexpressing Cxcr4 sgRNAs and GFP. The mice were sacrificed 12 or 13 days after transplantation. The percentage of GFP+ cells in the bone marrow was normalized to the input percentage of GFP+ cells 2 days after transduction to compensate for the differences in transduction efficiency between groups.

(E) Leukemia cells were transduced with lentiviral vectors coexpressing Cxcr4 sgRNAs and GFP, and the transduction efficiency was determined after 3 days (input). The cells were cultured without cytokine stimulation for 3 more days (n = 3), and the percentage of GFP+ cells was normalized to the input.

Means and standard deviations are shown (****p < 0.0001). See also Figures S2 and S3.

CXCR4 Is Not Critical for Homing of Leukemia Cells to the Bone Marrow but Essential for AML Development

In normal hematopoiesis, CXCR4 is critical for homing and retention of hematopoietic stem cells (HSCs) in the bone marrow (Foudi et al., 2006; Sugiyama et al., 2006); however, it is unclear whether CXCR4 is involved in homing of AML cells to the bone marrow. Although Tavor et al. (2004) found that homing of primary human AML cells to the bone marrow of non-obese diabetic (NOD)/severe combined immunodeficiency (SCID)/B2mnull mice is CXCR4 dependent, Monaco et al. (2004) reported that CXCR4 is dispensable for repopulation of human AML cells in NOD/SCID mice. To clarify the role of CXCR4 in homing of AML cells in a syngeneic AML model, Cas9+ MLL-AF9 leukemia cells were transduced with the Cxcr4 or control sgRNA vectors, and 3 days later, cells were transplanted into sublethally irradiated mice. The percentage of GFP+ cells in the bone marrow was assessed 24 h after transplantation. No significant differences in the percentages of GFP+ cells were observed at this time point within the leukemic graft (Figure 3A; Figure S4A). Consistent with this, when GFP+ (sgRNA-expressing) leukemia cells were sorted prior to the homing assay, there was no significant difference in the percentage of GFP+ cells in the bone marrow 24 h after transplantation (Figure S4B), suggesting that CXCR4 is not critical for MLL-AF9 leukemia cell homing to the bone marrow.

Figure 3. CXCR4 Is Essential for AML Cells In Vivo but Not for Homing of Leukemic Cells to the Bone Marrow.

Figure 3.

(A) Percentage of GFP+ leukemia cells among dsRed+ cells in the bone marrow 24 h after transplantation (n = 8 for each group). The data were normalized to the percentage of GFP+ cells for each sample prior to injection 3 days after transduction (input).

(B) Survival of recipient mice (n = 7 for each group) transplanted with 40,000 sorted GFP+ leukemia cells 3 days after transduction with sgRNA-expressing vectors.

ns, not significant. See also Figure S4.

To further assess whether CXCR4 is essential for full leukemia development in vivo, we sorted GFP+ (sgRNA-expressing) leukemia cells and transplanted them into sublethally irradiated mice. Although the majority of the mice in the control group developed leukemia, only two mice transplanted with leukemia cells expressing Cxcr4 sgRNAs developed leukemia (Figure 3B; Figures S4C and S4D). Interestingly, the leukemia cells in these two mice expressed normal CXCR4 levels in the bone marrow and spleen, suggesting that the cells had escaped silencing (Figure S4E). These findings demonstrate that CXCR4 is not required for homing of AML cells to the bone marrow but essential for leukemia development in vivo.

Loss of CXCR4 Results in Oxidative Stress and Differentiation of Leukemia Cells

To assess how Cxcr4 deletion in c-Kit+ MLL-AF9 leukemia cells affects the fate of leukemia cells in vivo, we next performed RNA sequencing of sorted Cxcr4 sgRNA-expressing leukemia cells harvested from mice 10 days after transplantation. Cxcr4 disruption resulted in a distinct gene expression signature (Figure 4A). By gene set enrichment analysis (GSEA), we found that the signature was enriched for gene sets related to reactive oxygen species (ROS) pathways and oxidative phosphorylation (Figure 4B). In normal HSCs, disruption of Cxcr4 in mice has been shown to result in oxidative stress, leading to activation of p38 mitogen-activated protein kinase (MAPK) and loss of HSCs (Ito et al., 2006; Zhang et al., 2016). In line with this, gene sets for p38 MAPK signaling and myeloid differentiation were enriched in the Cxcr4-disruption signature in leukemia cells (Figure 4B). In addition, GSEA also revealed enrichment of genes associated with nuclear factor κB (NF-κB) signaling (Figure S5A). Consistent with the transcriptome analysis, in the Cxcr4-disrupted leukemia cells, we observed a significant increase in ROS in both the LSCs (c-Kit+) and the bulk leukemia cells in vivo (Figure 5A; Figure S5BS5D). In addition, there was enhanced phosphorylation of p38 MAPK and NF-κB and upregulation of the myeloid differentiation marker Gr-1 (Figures 5B5D; Figures S5E and S5F). Morphological assessments of these cells identified changes associated with granulocytic differentiation (Figure 5E). Taken together, these findings suggest that loss of CXCR4 in leukemia cells leads to increased oxidative stress, differentiation, and activation of p38 and NF-κB signaling.

Figure 4. CXCR4 Disruption in Leukemia Cells Results in a Distinct Gene Expression Signature Associated with Oxidative Stress and Differentiation.

Figure 4.

(A) Heatmap of the differentially expressed genes(473 genes, false discovery rate [FDR] < 0.01) from RNA sequencing performed on sorted GFP+ (sgRNA-expressing) cells harvested from the bone marrow of recipient mice (n = 4 for control sgRNA and Cxcr4 sgRNA_a; n = 3 for Cxcr4 sgRNA_b) transplanted with MLL-AF9 leukemia cells.

(B) Gene set enrichment analysis (GSEA) of the transcriptional signature obtained upon Cxcr4 disruption. NES, normalized enrichment score.

See also Figure S5.

Figure 5. Loss of CXCR4 Leads to Differentiation of Leukemia Cells.

Figure 5.

(A) Representative histogram showing total ROS levels (measured with CellROX Deep Red) in c-Kit+ cells within GFP+ (sgRNA-expressing) cells harvested from the bone marrow of recipient mice (n = 5 for control sgRNA; n = 4 for Cxcr4 sgRNA_b) 14 days after transplantation.

(B–D) Mean fluorescence intensity (MFI) of (B) phosphorylated p38 MAPK, (C) phosphorylated NF-κB, and (D) Gr-1 within GFP+ (sgRNA-expressing) leukemia cells that were harvested from the bone marrow of recipient mice (n = 3 for each group) 10 days after transplantation.

(E) May-Grünwald-Giemsa-stained cytospin slides from representative sgRNA-expressing leukemia cells 13 days after transplantation. Scale bars represent 10 μm.

Means and standard deviations are shown (*p < 0.05, **p < 0.01, ***p < 0.001). See also Figure S5.

CXCL12 Expression in the Microenvironment Is Dispensable for AML Development

CXCL12 is the main ligand for CXCR4 and a homeostatic chemokine widely expressed by several cell types in the bone marrow, existing as a membrane-bound protein and in soluble form (Nagasawa, 2014). In culture, binding of CXCL12 to CXCR4 has been shown to promote leukemia cell proliferation and trans-well migration (Liesveld et al., 2007; Möhle et al., 1998; Tavor et al., 2004). Consistent with these studies, high CXCL12 levels stimulated survival of MLL-AF9 AML cells in culture (Figure S6A). Under physiological conditions, CXCL12 expression in the bone marrow microenvironment is necessary for keeping HSCs in a quiescent state (Tzeng et al., 2011). In particular, CXCL12 expression in endothelial cells and mesenchymal progenitor cells is needed for retention of normal HSPCs in the bone marrow (Ding and Morrison, 2013; Greenbaum et al., 2013). However, it is unknown whether CXCL12 is also critical for regulating AML cells. To assess whether CXCL12 expression by endothelial cells (ECs) or mesenchymal progenitor cells (MPCs) regulates AML cells, we transplanted c-Kit+ MLL-AF9 cells into Cxcl12f/f-Tek-Cre+ (Cxcl12−/− ECs) and Cxcl12f/f-Prx1-Cre+ (Cxcl12−/− MPCs) recipient mice with Cxcl12 knocked out in ECs and MPCs, respectively (Figure 6A). In the peripheral blood, 16 days after transplantation, we found a mild increase in leukemia cells in Cxcl12−/− EC mice and Cxcl12−/− MPC mice compared with Cxcl12+/+ recipient mice (Figure 6B), but no difference in survival between the groups was observed (Figure 6C). Thus, loss of Cxcl12 expression in ECs and MPCs is dispensable for leukemia development. Upon sacrifice, all mice had fully developed leukemia in the bone marrow and spleen (Figures S6B and S6C). To further assess whether CXCL12, provided by the microenvironment, affects the growth and survival of leukemia cells, we transplanted c-Kit+ MLL-AF9 leukemia cells into Cxcl12f/f-Ubc-Cre+ (referred to as Cxcl12−/−) mice (Figure 6D; Figure S6D), which are devoid of CXCL12 expression in all tissues. Relative to Cxcl12+/+ control mice, we observed an increase in leukemia cell levels in Cxcl12−/− recipient mice in peripheral blood and bone marrow (Figures 6E and 6F). No significant difference in cell cycle status and CXCR4 expression was observed for the leukemia cells between Cxcl12−/− and Cxcl12+/+ recipient mice (Figures S6E and S6F). These data suggest that, in contrast to what has been reported for normal HSPCs, the CXCR4-CXCL12 interaction has a mild negative effect on MLL-AF9 AML development in mice.

Figure 6. CXCL12 Expression in the Bone Marrow Restrains AML Development.

Figure 6.

(A) Schematic of transplantations of c-Kit+dsRed+ leukemia cells into Cxcl12+/+ recipient mice (n = 9), Cxcl12f/f-Tek-Cre+ (Cxcl12−/− ECs) recipient mice (n = 8), and Cxcl12f/f-Prx1-Cre+ (Cxcl12−/− MPCs) recipient mice (n = 12), followed by survival analysis. (B and C) Percentage of dsRed+ leukemia cells in the peripheral blood of recipient mice 16 days after transplantation (B) and subsequent survival analysis (C).

(D) Schematic of transplantations of c-Kit+dsRed+ leukemia cells into Cxcl12+/+ (n = 10) and Cxcl12f/f-Ubc-Cre+ (Cxcl12−/−) recipient mice (n = 10) and subsequent analysis of the leukemia burden.

(E and F) Percentage of dsRed+ leukemia cells 12 days after transplantation in (E) peripheral blood and (F) bone marrow.

Means and standard deviations are shown (*p < 0.05, ***p < 0.001, ****p < 0.0001). See also Figure S6.

CXCR4 Signaling Independent of CXCL12 Is Essential for AML Development

To further characterize how CXCR4 signaling promotes leukemia development, we generated two retroviral vectors expressing murine Cxcr4 mutant cDNAs: Cxcr4D99G and Cxcr4L251P. CXCR4D99G (corresponding to human CXCR4D97G) has an amino acid substitution in the extracellular domain of the receptor and lacks the ability to bind to CXCL12 (Choi et al., 2005; Wescott et al., 2016), and CXCR4L251P (corresponding to human CXCR4L244P) has an amino acid substitution in a transmembrane signaling domain, resulting in a signaling-dead receptor (Wescott et al., 2016; Figure S7A). We also generated a retroviral vector expressing a wild-type Cxcr4 cDNA used as a reference (Cxcr4WT). In all CXCR4 cDNAs, we inserted silent mutations to make them resistant to Cxcr4 sgRNAs. We sequentially transduced MLL-AF9 leukemia cells with Cxcr4 sgRNA_b coexpressing tRFP657 and Cxcr4 cDNAs coexpressing GFP, which resulted in restored CXCR4 expression on the cell surface (Figures 7A and 7B; Figure S7B). As anticipated, leukemia cells expressing Cxcr4D99G or Cxcr4L251P did not respond to CXCL12 stimulation in culture, whereas Cxcr4WT-expressing cells responded (Figure S7C). We also confirmed that Cxcr4L251P is signaling dead by measuring phosphorylation of extracellular-signal-regulated kinase (ERK) following CXCL12 stimulation of leukemia cells (Figure S7D). Next we assessed whether the mutated Cxcr4 cDNA could rescue depletion of leukemia cells in vivo caused by CRISPR-mediated disruption of endogenous Cxcr4. Expression of Cxcr4WT or Cxcr4D99G rescued depletion of leukemia cells in the bone marrow and spleen (Figures 7C and 7D). Given that CXCR4D99G lacks the ability to bind to CXCL12, the results confirm that CXCL12 is dispensable for the growth and survival of MLL-AF9 leukemia cells. Importantly, these findings also show that depletion of leukemia cells following Cxcr4 disruption is on target and not caused by off-target effects of the Cxcr4 sgRNA. Interestingly, expression of the signaling-dead variant of CXCR4, CXCR4L251P, failed to rescue depletion of leukemia cells in the bone marrow and spleen, demonstrating that CXCR4 signaling is essential for leukemia cells (Figures 7C and 7D). Moreover, increased Gr-1 expression following disruption of Cxcr4 in leukemia cells in vivo was abolished by expression of Cxcr4WT or Cxcr4D99G but not by the signaling-dead variant, Cxcr4L251P (Figure 7E). Thus, CXCR4 signaling is essential for AML cells in vivo independent of CXCL12 stimulation. In addition, consistent with the increased phosphorylation of NF-κB upon Cxcr4 disruption (Figure 5C), overexpression of Cxcr4WT in Cxcr4-disrupted leukemia cells resulted in reduced phosphorylation of NF-κB (Figure S7E).

Figure 7. CXCR4 Signaling Independent of CXCL12 Stimulation Is Essential for AML Cells In Vivo.

Figure 7.

(A) Schematic of the in vivo rescue assay with Cxcr4 mutants. Cas9+c-Kit+ dsRed leukemia cells were sequentially transduced with the Cxcr4 sgRNA_b lentiviral vector coexpressing tRFP657, followed by transduction with a retroviral control vector, Cxcr4WT, or a CXCL12-resistant Cxcr4 mutant (Cxcr4L251P or Cxcr4D99G)-expressing vector and transplanted into sublethally irradiated mice.

(B) Representative histograms showing CXCR4 expression in the GFP+ population among dsRed+tRFP657+ leukemia cells 3 days after transduction.

(C and D) Percentage of GFP+ cells within the dsRed+tRFP657+ leukemia cells in the input cells and in the (C) bone marrow and (D) spleen of recipient mice (n = 6 for each group) 14 days after transplantation.

(E) Representative histograms showing Gr-1 expression 11 days after transplantation within GFP+dsRed+tRFP657+ leukemia cells extracted from the bone marrow of mice (n = 3 for each group) transplanted with leukemia cells transduced with different Cxcr4 variants.

(F and G) Cell number after 3 days of culture of 70,000 seeded dsRed+ leukemia cells (red dotted line) exposed to increasing concentrations of (F) UBIQUITIN (n = 3) and (G) MIF (n = 3).

(H) Percentage of GFP+ leukemia cells normalized to the input (3 days after transduction) when cultured in vitro for 3 days in serum-free medium without any cytokines (control) or with 1 μg/mL MIF (n = 3).

Means and standard deviations are shown (***p < 0.001, ****p < 0.0001). See also Figure S7.

Apart from binding to CXCL12, CXCR4 has been described as one of the receptors for extracellular UBIQUITIN and macrophage migration inhibitory factor (MIF) (Bernhagen et al., 2007; Saini et al., 2010). Because we found that CXCL12 is dispensable for AML development, we next assessed whether UBIQUITIN or MIF promotes growth and survival of MLL-AF9 leukemia cells by binding to CXCR4. Although UBIQUITIN did not stimulate growth or survival of MLL-AF9 leukemia cells in vitro, there was a slight but dose-dependent increase in leukemia cell numbers when supplementing the culture medium with MIF (Figures 7F and 7G). To address whether MIF promotes leukemia cells in a CXCR4-dependent manner, we evaluated whether leukemia cells with Cxcr4 disruption responded to MIF. Compared with leukemia cells expressing normal Cxcr4 levels, Cxcr4 deletion did not affect MIF-induced growth or survival of leukemia cells (Figure 7H).

Taken together, our data suggest that CXCR4 signaling is essential for growth and survival of MLL-AF9 leukemia cells independent of CXCL12, MIF, and UBIQUITIN stimulation.

DISCUSSION

CRISPR screening is a powerful method to identify cancer cell dependencies (Behan et al., 2019; Chan et al., 2019) but is often limited by culture conditions that poorly reflect the in vivo tumor microenvironment. We generated a CRISPR library targeting 96 cell surface genes upregulated in LSCs and used it to identify positive and negative regulators of AML cell growth and survival in the bone marrow microenvironment.

Cxcr4 was identified as the top positive regulator of MLL-AF9 leukemia cells, with all five Cxcr4 sgRNAs being depleted in vivo. The finding that Cxcr4 disruption selectively affects growth and survival of leukemia cells in vivo demonstrates the limitation of in vitro assays to address physiologically relevant dependencies of leukemia cells. It also highlights the importance of performing CRISPR screens in systems where essential interactions between tumor cells and the microenvironment can be detected. CXCR4 has been shown to play a key role in normal HSCs in the bone marrow niche (Nie et al., 2008; Sugiyama et al., 2006; Zou et al., 1998) and has been explored as a therapeutic target in leukemia (Abraham et al., 2017; Liu et al., 2017; Tavor et al., 2008). However, the functional in vivo role of CXCR4 in AML has remained elusive; in particular, its role in homing of leukemia cells to the bone marrow, cell signaling, and interactions with CXCL12 is unclear (Monaco et al., 2004; Tavor et al., 2004). Here we used CRISPR-mediated disruption of Cxcr4 in leukemia cells along with expression of mutated CXCR4 variants and show that, although CXCR4 is dispensable for homing of leukemia cells to the bone marrow, CXCR4 signaling is essential for leukemia development, suggesting that CXCR4 is among the core regulators required for LSC maintenance. In contrast, Cxcr4−/− normal HSCs are capable of sustaining long-term hematopoiesis (Nie et al., 2008). Although CXCR4 expression was essential for serial propagation of MLL-AF9 leukemia cells in mice, it is unclear whether CXCR4 is critical for initiation of MLL-AF9 leukemia in a primary recipient mouse.

The dramatic loss of AML cells in vivo following Cxcr4 deletion was associated with oxidative stress and granulocytic differentiation, as shown by the morphology, immunophenotype, and activation of the p38 MAPK and NF-κB pathways. Although enhanced NF-κB signaling is associated with myeloid differentiation in normal hematopoiesis and in MLL-AF9 LSCs (Bottero et al., 2006; Eriksson et al., 2017), the NF-κB subunit, v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) has also been found to sustain an MLL-dependent LSC program (Kuo et al., 2013) and accelerate leukemia development (Xiu et al., 2018). Our data suggest that loss of CXCR4 expression leads to development of leukemia cells that have elevated NF-κB signaling, probably reflecting a more differentiated state of the cells rather than NF-κB signaling driving the differentiation effect itself. An increase in ROS levels has been associated previously with differentiation of normal HSCs (Itkin et al., 2016), and the reduction of HSCs in Cxcr4−/− mice is coupled to oxidative stress, DNA damage, and activation of p38 MAPK (Zhang et al., 2016). The reason why LSCs are more sensitive to oxidative stress than normal HSPCs has been linked previously to a lower reserve spare capacity in their respiratory chain complexes (Testa et al., 2016). In line with these findings, an increase in ROS has been shown to be detrimental to MLL-AF9 AML cells (Roychoudhury et al., 2015). Although we found that Cxcr4 disruption results in increased ROS and differentiation of leukemia cells, it is currently unclear whether it is elevated ROS levels that cause differentiation of the cells.

Given that the CXCR4-CXCL12 interaction is important for retention and regulation of normal HSPCs in the bone marrow (Ding and Morrison, 2013; Greenbaum et al., 2013), we also studied the role of CXCL12 in AML development. Notably, we found that MLL-AF9 leukemia was accelerated in lineage-restricted and global Cxcl12−/− mice, suggesting that CXCL12 expressed by cells in the bone marrow microenvironment restrains AML development. These findings are partially consistent with recent observations in a transgenic chronic myeloid leukemia (CML) mouse model in which deletion of Cxcl12 in MPCs promotes expansion of LSCs (Agarwal et al., 2019). However, in contrast to our findings, deletion of Cxcl12 in ECs in the CML model resulted in depletion of LSCs. This suggest that LSCs in chronic-phase CML are dependent on vascular niches, similar to normal HSPCs (Ding and Morrison, 2013; Greenbaum et al., 2013), whereas in AML, leukemia cells are less dependent on these niches for disease development. Although we did not observe a difference in the cycle status of leukemia cells upon disease development in Cxcl12−/− mice, given that CXCL12 keeps normal HSCs in a quiescent state (Tzeng et al., 2011), we speculate that CXCL12 also restrains cell cycle progression of AML cells at the early stages of AML development. Alternatively, deletion of Cxcl12, which mobilizes normal HSCs to the peripheral blood (Greenbaum et al., 2013), provides niches in the bone marrow that facilitate expansion of AML cells.

By expressing two CXCR4 mutated variants in AML cells with disrupted endogenous Cxcr4, we could show that CXCR4 signaling, but not CXCL12 binding, is essential for MLL-AF9 leukemia cells in vivo. Because deletion of Cxcr4 resulted in depletion of MLL-AF9 leukemia cells in serum-free medium without cytokines and because the CXCR4 ligands UBIQUITIN and MIF failed to promote growth and survival of MLL-AF9 leukemia cells by binding to CXCR4, our data suggest that CXCR4 provides baseline signaling independent of ligand stimulation that is sufficient to promote growth and survival of leukemia cells in vivo. This could explain why CXCL12 is dispensable for AML development in vivo, whereas in vitro, supra-physiological concentrations of CXCL12 promoted survival of leukemia cells in the absence of other cytokine stimuli. Elevated CXCR4 expression has been associated previously with higher CXCR4 signaling (Doijen et al., 2017), indicating that upregulation of CXCR4 on AML cells is responsible for the CXCR4 signaling, potentially related to an increase in CXCR4 homodimer formation in the absence of ligand stimulation (Babcock et al., 2003).

Apart from Cxcr4, the screen also identified Cd47 and Cd244 (also referred to as 2B4) as positive regulators of MLL-AF9 leukemia cells in vivo; both are known to play a role in immune regulation in normal hematopoiesis and to promote AML cell growth and survival (Majeti et al., 2009; Zhang et al., 2017). Lrp10 was the only negative regulator of AML cells identified here and has not been associated previously with leukemia. Interestingly, LRP10 is a negative regulator of Wnt/β-catenin signaling (Jeong et al., 2010), a pathway for self-renewal of LSCs (Wang et al., 2010). Pira6 was also among the top-ranked genes, but because the Pira6 sgRNAs that were depleted in the screen had homology to several members of the Pira family and, therefore, are expected to cause genome instability (Aguirre et al., 2016; Munoz et al., 2016), Pira6 was a putative false positive hit.

Taken together, we established a CRISPR screen targeting genes encoding cell surface proteins and identified in vivo dependencies of MLL-AF9 leukemia cells. Because the results are limited to a murine MLL-AF9 leukemia model, it is currently unclear whether they extend to other types of leukemia. Our findings reveal a critical in vivo role of CXCR4 signaling in LSCs independent of CXCL12 stimulation. Further, CXCR4 signaling protects MLL-AF9 AML cells from oxidative stress and differentiation. Our findings suggest that, for significant AML growth inhibition, therapeutic strategies targeting CXCR4 should be aimed at inhibiting CXCR4 signaling rather than blocking the CXCR4-CXCL12 interaction, which restrains AML development.

STAR★METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact Dr. Marcus Järås (marcus.jaras@med.lu.se).

Materials Availability

All unique/stable reagents generated in this study will be provided by the Lead Contact upon request.

Data and Code Availability

The accession number for the RNA sequencing data reported in this paper is Gene Expression Omnibus (GEO): GSE135275.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Murine leukemia model

The murine AML model was previously generated by retroviral expression of MLL-AF9 in dsRed C57BL/6 transgenic mice (6051; Jackson Laboratory, Bar Harbor, ME, USA) (Hartwell et al., 2013). The leukemia cells were serially propagated in sublethally irradiated (600 cGy) C57BL/6 recipient mice to minimize irradiation effects and the need for bone marrow support cells. Constitutive lentiviral Cas9 expression was introduced into the dsRed+ leukemia cells by transducing pLKO5d.EFS.SpCas9.P2A.PAC into secondary transplanted leukemia cells. Following puromycin (2 μg/mL) selection for three days, the cells were transplanted into sublethally irradiated recipient mice. All experiments were performed with quaternary transplanted leukemia cells. Primitive leukemia cells were enriched by crushing the femurs from leukemic mice followed by red blood cell lysis using NH4Cl solution (Stem cell technologies, Vancouver, Canada). All experiments with murine MLL-AF9 leukemia cells were initiated using c-Kit+ cells to enrich for LSCs (Wang et al., 2010). c-Kit+ leukemia cells were isolated using CD117 microbeads in MACS® cell separation columns (Miltenyi Biotec, Bergisch Gladbach, Germany). The c-Kit-enriched cells were cultured in serum-free expansion medium (SFEM: Stemspan, StemCell Technologies) supplemented with 1% penicillin/streptomycin. During transduction, the medium was supplemented with murine IL3 (mIL3; 20 ng/mL), murine stem cell factor (mSCF; 50 ng/mL) and human IL6 (hIL6; 20 ng/mL), and spinoculation with the viral supernatant was performed at 650 × g for 1 hour. For all transplantation experiments, the mice were sublethally irradiated (600 cGy) prior to injection of leukemia cells. When transplanting transduced leukemia cells, each mouse was injected with cells from separate transductions. Mice of both sexes were included in this study. All the recipient mice were 6–10 weeks old, drug or test naive and were not involved in previous procedures. The mice were gender and age matched and a maximum of 5 mice were used per cage. All experimental mice received autoclaved water and clean rodent chow diet ad libitum and were maintained in individually ventilated cages. The animal experiments were conducted according to an Animal Care and Use Committee protocol approved by the Lund/Malmö Ethical Committee.

Cxcl12−/− mouse models

Tek-Cre+ (stock no. 008863), Prx1-Cre+ (stock no. 005584) and Ubc-Cre-ERT2+ (Ubc-Cre+) (stock no. 007001) mice were procured from Jackson Laboratory. Cxcl12f/f mice (loxP sites flanking exon 2) were crossed with Tek-Cre+, Prx1-Cre+ and Ubc-Cre+ mice to generate Cxcl12f/f-Tek-Cre+ (Cxcl12−/− EC) (Agarwal et al., 2019), Cxcl12f/f-Prx1-Cre+ (Cxcl12−/− MPC) (Agarwal et al., 2019), and Cxcl12f/f-Ubc-Cre+ (Cxcl12−/−) mice. Loss of CXCL12 expression in endothelial cells (Cxcl12−/− EC) and mesenchymal progenitor cells (Cxcl12−/− MPC) from these mice was previously confirmed by real time PCR (Agarwal et al., 2019). Global deletion of Cxcl12 in Cxcl12f/f-Ubc-Cre+ mice was achieved by administration of 50 mg/kg of tamoxifen (Sigma-Aldrich; Cat no. T5648) in corn oil through intraperitoneal injections for five consecutive days. All mice were maintained in an AAALAC-accredited animal facility, and all procedures were carried out in accordance with federal guidelines and protocols approved by the Institutional Animal Care and Use Committee at the University of Alabama, Birmingham.

METHOD DETAILS

Global gene expression analysis

To select genes for the screen, we compared the gene expression profiles of MLL-AF9-induced murine leukemic GMP with the gene expression profiles of normal mouse GMP and HSC (Affymetrix 430A microarrays; NCBI Gene Expression Omnibus accessions GSE3725 and GSE20377) (Krivtsov et al., 2006; Wang et al., 2010) using Smyth’s moderated t test (Smyth, 2005). To enrich for genes encoding cell surface receptors, we selected 97 genes annotated with the Gene Ontology terms GO0004872 (“Receptor activity”), GO0007155 (“Cell adhesion”), and GO0007166 (“Cell surface signaling”) (http://geneontology.org/) and used manual curation involving literature searches to arrive at a final screening set of 96 genes (Table S1).

Generation of viral vectors

pLKO5d.EFS.SpCas9.P2A.PAC (Addgene plasmid #58329), pLKO5.sgRNA.EFS.GFP (Addgene plasmid #57822) and pLKO5.sgRNA.EFS.tRFP657 (Addgene plasmid #57824) were donated by Benjamin Ebert (Heckl et al., 2014). pLKO5.sgRNA.EFS.GFP was linearized using the Bsmb1 restriction enzyme, and individual sgRNAs targeting Cxcr4 and Lrp10 were cloned into the plasmid as described previously (Sanjana et al., 2014). Cxcr4WT, Cxcr4D99G and Cxcr4L251P cDNAs were synthesized (Genscript). Silent mutations in the Cxcr4 sgRNA-binding regions of these cDNAs were included to make them resistant to the specific sgRNAs. The cDNAs were flanked with Ecor1 and Xho1 restriction sites for cloning into pMSCV-IRES-GFP (pMIG) as described previously (Peña-Martínez et al., 2018). The lentiviral particles were produced with VSV-G pseudotyping, and gamma-retroviral vectors were produced with eco-tropic pseudotyping in HEK293T cells using standard procedures. The viral supernatants were harvested after 48 hours.

Lentiviral CRISPR library generation and sequencing

The lentiviral library was generated essentially as previously described (Sanjana et al., 2014). In brief, 5 sgRNAs were designed for each gene using the sgRNA designer tool (Broad Institute). Hoxa9 (essential gene) and a non-targeting negative control sgRNA were also included resulting in a library of 486 unique sgRNAs (Table S3). The oligo pool was ordered from CustomArray Inc, which was subsequently hybridized and ligated into the pLKO5.sgRNA.EFS.GFP vector using Gibson assembly (New England Biolabs). Following electroporation of the plasmids into E. coli, on average, 120 bacterial colonies for each sgRNA were harvested from agar plates and plasmids isolated using the GeneJET Plasmid Maxiprep Kit (Thermo Fisher). To check the representation of the sgRNAs in the library, we sequenced them in the plasmid pool and in the genomic DNA of MLL-AF9 leukemia cells transduced with the corresponding pooled viral library. The sgRNAs were PCR amplified using the primer pair 5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATATCTTGTGGAAAGGACGAAACAC 3′ and 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTTCAAGTTGATAACGGACTAGCC 3′. The PCR product was purified using Agentcourt AMPure XP beads (Beckman Coulter), and a second PCR was performed to add Nextera XT Index Kit v2 (Illumina) sequencing adapters to the amplicons. The PCR products were again purified using magnetic beads, and the DNA concentrations were determined using the Qubit dsDNA Assay Kit (Invitrogen). The samples were then pooled prior to sequencing in a NextSeq 500 Desktop Sequencer (Illumina) using the NextSeq 500/550 Mid Output v2 Kit, 150 cycles (Illumina), according to the manufacturer’s instructions. The fastq files were aligned using Bowtie 2 to custom reference sequences of the sgRNA library, and the read counts were obtained using Samtools.

In vivo CRISPR screen

Freshly isolated Cas9+c-Kit+dsRed+ leukemia cells were transduced with the lentiviral CRISPR library by spinoculation as described above. Twenty-four hours post transduction, the cells were transplanted into sublethally irradiated (600 cGy) recipient mice. The mice were sacrificed on day 12, and the bone marrow cells were harvested. Genomic DNA was isolated from the cells collected at 24 hours (T0) post transduction and on day 12 (T12) post transplantation using a Blood and Cell Culture Kit (QIAGEN). For each sample, a minimum of 4.5 μg (corresponding to on average ~500 cells per sgRNA) of genomic DNA was used for PCR amplification, and the representation of sgRNAs was assessed by next-generation sequencing (NGS) as described above. The raw reads were then normalized in Excel (Microsoft), and the in vivo fold-change of the sgRNAs was calculated by dividing the representation of each sgRNA at T12 versus T0. The sgRNAs were ranked based on the median fold-change of the biological replicates.

Flow cytometry and antibody staining

Flow cytometric analyses were performed using a LSRFortessa cell analyzer (Becton Dickinson; BD), and cell sorting was performed using a FACSAria Fusion (BD). For harvesting of leukemia cells from mice, femurs and tibias were crushed and spleens were mashed, followed by filtration using a 70-μm cell strainer. Red blood cell lysis was performed using NH4Cl solution. Anti-mouse CXCR4 antibodies conjugated to APC (REA107, Miltenyi Biotec) and BV711 (L276F12, Biolegend) were used. Anti-mouse Gr-1-APC-Cy7 (RB6–8C5), anti-mouse CD117-APC (2B8), anti-mouse CD117-AF700 (2B8) antibodies and Annexin V-APC were obtained from Biolegend. A ROS assay kit 520nm (Thermo Fischer Scientific) and CellROX Deep Red reagent (Thermo Fischer Scientific) were used to measure intracellular ROS levels. Flow cytometric data were analyzed using FlowJo (FlowJo LLC). For phospho-flow analysis, the cells were fixed using paraformaldehyde (1.6%) for 10 min at room temperature followed by permeabilization using paraformaldehyde ice-cold ethanol (99%) and immediately vortexed and washed with phosphate buffered saline. The cells were stained with the antibodies specific for phosphorylated forms of the intracellular protein NF-κB-PE/Cy7, p38 MAPK-PE/Cy7 and ERK-BV421 (20A) (BD Biosciences).

Quantification of CRISPR editing

Cas9+dsRed+ MLL-AF9 leukemia cells were transduced with lentiviral Cxcr4 sgRNA vectors coexpressing GFP and cultured for 3 days. Sorting of GFP+ cells was performed by flow cytometry followed by genomic DNA isolation. The binding regions of Cxcr4 sgRNA_a and Cxcr4 sgRNA_b were PCR amplified using the primer pairs 5′TCCACAGGCTATCGGGGTAA3′, 5′GTGACGTTGTCTGTCCCTGT3′ and 5′ATCTGTGACCGCCTTTACCC3′, 5′TCCTGCCTAGACACTCATTCAC3′, followed by amplicon tagmentation prior to NGS (Illumina). CRISPR-mediated DNA editing was quantified using the bioinformatics tool TIGERq (TIGERq, Lund, Sweden).

Bone marrow homing assay

Cas9+c-Kit+dsRED+ leukemia cells were transduced with sgRNA-expressing lentiviral vectors coexpressing GFP and cultured for 3 days. The percentage of GFP+ cells was assessed by flow cytometry, and then 3×106 cells were transplanted into sublethally irradiated mice. Femurs of the recipient mice were harvested after 24 hours, and the percentages of GFP+ cells within leukemic (dsRed+) cells were determined by flow cytometric analysis. Similarly, in the homing experiment with sorted cells, 600,000 GFP+ cells were transplanted into sublethally irradiated mice and the percentage of GFP+ cells in the bone marrow was assessed 24 hours later.

In vivo rescue assays with mutated Cxcr4 variants

Cas9+c-Kit+dsRed+ leukemia cells were transduced with the Cxcr4 sgRNA_b lentiviral vector coexpressing tRFP657. After 24 hours, the cells were washed and transduced with retroviral vectors expressing Cxcr4WT, Cxcr4D99G or Cxcr4L251P. An empty vector without a Cxcr4 insert was used as a control. Twenty-four hours after the second transduction, the cells were washed and plated in serum-free medium supplemented with standard cytokines (see above). Forty-eight hours after the second transduction, the cells were washed, and a fraction of the cells was analyzed by flow cytometry to determine the input percentage of GFP+ cells within dsRed+tRFP657+ cells. The remaining cells were transplanted into sublethally irradiated (600 cGy) C57BL/6 recipient mice. The mice were sacrificed 14 days later, and their bone marrow and spleen were analyzed to quantify the percentage of GFP+ cells within the dsRed+tRFP657+ cell population.

Real-time PCR analysis

RNA was extracted from the tail tissue of Cxcl12f/f-Ubc-Cre+ and Cxcl12f/f-Ubc-Cre mice using an RNeasy micro kit (QIAGEN, Valencia, CA), and cDNA was synthesized using the Superscript III First-Strand Kit (Invitrogen, Grand Island, NY). Quantitative real-time PCR was performed using a TaqMan probe for mouse CXCL12 (Mm00445553_m1) and GAPDH (4352932E) as an endogenous control in a QuantStudio 6 Flex Real-Time PCR System.

Cell cycle analysis

dsRed+ leukemia cells harvested from Cxcl12f/f-Ubc-Cre+ and Cxcl12f/f-Ubc-Cre mice were fixed and permeabilized using BD Cytofix/Cytoperm (BD). Then, the cells were stained with anti-Ki-67 (eBiosciences) and DAPI prior to analyzing their cycle status by flow cytometry.

Culture conditions with CXCR4 ligands

c-Kit+dsRed+ leukemia cells were cultured in SFEM (StemCell Technologies) with 1% penicillin/streptomycin supplemented with increasing concentrations of CXCL12 (CHM324, Prospec), recombinant MIF (300–69, Peprotech), UBIQUITIN (U6253–5MG, Sigma) or without any cytokine in a 96-well plate. Cells were counted using count bright beads (Thermo Fisher) using flow cytometry.

RNA sequencing

Ten days post transplantation of dsRed+ leukemia cells transduced with control or Cxcr4 sgRNA-expressing lentiviral vectors, leukemia cells were harvested from the mice. GFP+ (coexpressed with sgRNA) was sorted by FACS, and RNA was extracted using a RNeasy kit (QIAGEN). RNA sequencing libraries were prepared using the TruSeq RNA Sample prep kit v2 (Illumina, San Diego, CA, USA), and sequencing was performed using the NextSeq 500/550 Mid Output v2 Kit, 150 cycle (Illumina). The sequenced reads were aligned to mm9 mouse reference genomes using TopHat 2.0.13 (Kim et al., 2013). Differential gene expression analysis and visualization of the transcript data were performed using Qlucore omics Explorer 3.0 (Qlucore, Lund, Sweden). Gene expression levels were compared between the control and Cxcr4 sgRNA groups by performing t tests. The logarithms of the p values and the signs of the fold-change were used to prepare ranked gene lists that were used for gene set enrichment analysis (GSEA) (Subramanian et al., 2005). HALLMARK (H), CURATED (C2) and GENE ONTOLOGY (C5) gene sets were downloaded from Molecular Signatures Database (MSigDB) collections.

Cytology

sgRNA-expressing leukemia cells were harvested from the bone marrow of recipient mice 13 days post transplantation. GFP+ cells (coexpressed with sgRNA) were sorted by FACS and were subjected to cytospin preparation onto glass slides. The samples were stained with May-Grünwald (Merck) and Giemsa (Merck) for microscopic imaging using Nikon Eclipse 50i microscope at 100x magnification with oil immersion. The images were acquired using Leica DFC320 camera and Leica IM500 acquisition software.

QUANTIFICATION AND STATISTICAL ANALYSIS

Prism 6 (GraphPad) was used for the statistical analyses, including Student’s t test, linear regression analysis and Kaplan-Meier survival analysis. Significance is depicted with asterisks: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Data are presented as the mean ± standard deviation. Information about the number of biological replicates (n) and the p values are provided in the figure legends.

Supplementary Material

Supplementary Table 3
1

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti mouse CD184 (CXCR4) – APC Miltenyi Biotec Cat# 130-102-245; RRID: AB_2655759
Anti mouse CD184 (CXCR4) – BV711 (Clone L276F12) Biolegend Cat# 146505; RRID: AB_2562782
Anti mouse GR1 – APC-Cy7 (Clone RB6–8C5) Biolegend Cat# 108423; RRID: AB_2137486
Anti mouse phosphorylated p38 – PE-Cy7 (pT180/pY182) (Clone 36/p38) BD Biosciences Cat# 560241; RRID: AB_1645297
Anti mouse phosphorylated NF-κB – PE-Cy7 (pS529) (Clone K10–895.12.50) BD Biosciences Cat# 560335; RRID: AB_1645545
Anti mouse ERK1/2 – BV421 (pT202/pY204) (Clone 20A) BD Biosciences Cat# 561991; RRID: AB_10895978
Anti mouse CD117 microbeads antibody Miltenyi Biotec Cat# 130–091-224; RRID: AB_2753213
Anti mouse CD117 – APC (Clone 2B8) Biolegend Cat# 105812; RRID: AB_313221
Anti mouse CD117 – AF700 (Clone 2B8) Biolegend Cat# 105845; RRID: AB_2783045
Anti-Ki67 Thermo Fisher Scientific Cat#11–5698-80; RRID: AB_11151689
Annexin V - APC Biolegend Cat# 640920

Bacterial and Virus Strains

pLKO5d.EFS.SpCas9.P2A.PAC Heckl et al., 2014 RRID: Addgene_58329
pLKO5.sgRNA.EFS.GFP Heckl et al., 2014 RRID: Addgene_57822
pLKO5.sgRNA.EFS.tRFP657 Heckl et al., 2014 RRID: Addgene_57824

Chemicals, Peptides, and Recombinant Proteins

Mouse CXCL12 Prospec Bio Cat# CHM-324
Recombinant human MIF Peprotech Cat# 300–69
Ubiquitin from bovine erythrocytes Sigma Cat# U6253
Recombinant human IL-6 Peprotech Cat# 200–06
Recombinant mouse SCF Peprotech Cat# 250–03
Recombinant mouse IL-3 Peprotech Cat# 213–13
Ammonium Chloride (NH4Cl) Stem Cell Technologies Cat# 07800
N-Acetyl L-Cysteine Sigma Aldrich Cat# A8199–10G

Critical Commercial Assays

RNeasy Micro Kit QIAGEN Cat# 74004
Nextera XT DNA Library Preparation Kit Illumina Cat# FC-131–1096
Blood and Cell Culture Kit QIAGEN Cat# 13343
GeneJET Plasmid Maxiprep Kit Thermo Fischer Scientific Cat# K0491
NextSeq 500/550 v2 mid output kit (upgraded to v2.5) Illumina Cat# 20024907
TruSeq RNA Library Preparation Kit v2 Illumina Cat# RS-122–2001
Agencourt AMPure XP Beckman Coulter Cat# A63880
Total Reactive Oxygen Species (ROS) Assay Kit 520 nm Thermo Fischer Scientific Cat# 88–5930-74; RRID: AB_2574932
CellROX Deep Red Reagent Thermo Fischer Scientific Cat# C10422

Deposited Data

RNA sequencing data This paper GEO: GSE135275

Experimental Models: Organisms/Strains

Mouse: C57BL/6JRj Janvier Labs N/A
Mouse: B6.Cg-Tg(Tek-cre)1Ywa/J Jackson Laboratory Stock No: 008863
Mouse: B6.Cg-Tg(Prrx1-cre)1Cjt/J Jackson Laboratory Stock No: 005584
Mouse: B6.Cg-Ndor1-Tg(UBC-cre/ERT2)1Ejb/1J Jackson Laboratory Stock No: 007001

Oligonucleotides

mCxcl12 qPCR probe Thermo Fisher Scientific Cat# Mm00445553_m1
mGAPDH qPCR probe Thermo Fisher Scientific Cat# 4352932E

Recombinant DNA

pMIG-CXCR4WT This paper N/A
pMIG-CXCR4D99G This paper N/A
pMIG-CXCR4L251P This paper N/A

Software and Algorithms

FlowJo software (version 8.5.2) FlowJo RRID:SCR_008520
BD FACSDiva BD Biosciences RRID:SCR_001456
GraphPad Prism 7 GraphPad RRID:SCR_002798
Qlucore omics Explorer 3.0 Qlucore N/A
Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Samtools Li et al., 2009 http://samtools.sourceforge.net/
TopHat 2.0.13 Kim et al., 2013 https://github.com/infphilo/tophat

Highlights.

  • In vivo CRISPR screening identifies CXCR4 as a key regulator of AML stem cells

  • CXCL12 expression in the bone marrow is dispensable for AML development

  • CXCR4 signaling protects AML cells from oxidative stress and differentiation

ACKNOWLEDGMENTS

This work was supported by the Swedish Cancer Society, the Swedish Childhood Cancer Foundation; EU-MSCA-COFUND, 754299 CanFaster the Crafoord Foundation, the Gunnar Nilsson Cancer Foundation, the Medical Faculty of Lund University, the Royal Physiographic Society in Lund, the Swedish Research Council, BioCARE, FP7 Marie Curie, and NIH grant R01 CA 172447.

Footnotes

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.celrep.2020.107684.

REFERENCES

  1. Abraham M, Klein S, Bulvik B, Wald H, Weiss ID, Olam D, Weiss L, Beider K, Eizenberg O, Wald O, et al. (2017). The CXCR4 inhibitor BL-8040 induces the apoptosis of AML blasts by downregulating ERK, BCL-2, MCL-1 and cyclin-D1 via altered miR-15a/16–1 expression. Leukemia 31, 2336–2346. [DOI] [PubMed] [Google Scholar]
  2. Agarwal P, Isringhausen S, Li H, Paterson AJ, He J, Gomariz Á, Nagasawa T, Nombela-Arrieta C, and Bhatia R (2019). Mesenchymal Niche-Specific Expression of Cxcl12 Controls Quiescence of Treatment-Resistant Leukemia Stem Cells. Cell Stem Cell 24, 769–784.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ågerstam H, Karlsson C, Hansen N, Sandén C, Askmyr M, von Palffy S, Högberg C, Rissler M, Wunderlich M, Juliusson G, et al. (2015). Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia. Proc. Natl. Acad. Sci. USA 112, 10786–10791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aguirre AJ, Meyers RM, Weir BA, Vazquez F, Zhang CZ, Ben-David U, Cook A, Ha G, Harrington WF, Doshi MB, et al. (2016). Genomic copy number dictates a gene-independent cell response to CRISPR/Cas9 targeting. Cancer Discov 6, 914–929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ahn JY, Seo K, Weinberg OK, and Arber DA (2013). The prognostic value of CXCR4 in acute myeloid leukemia. Appl. Immunohistochem. Mol. Morphol 21, 79–84. [DOI] [PubMed] [Google Scholar]
  6. Babcock GJ, Farzan M, and Sodroski J (2003). Ligand-independent dimerization of CXCR4, a principal HIV-1 coreceptor. J. Biol. Chem 278, 3378–3385. [DOI] [PubMed] [Google Scholar]
  7. Behan FM, Iorio F, Picco G, Gonçalves E, Beaver CM, Migliardi G, Santos R, Rao Y, Sassi F, Pinnelli M, et al. (2019). Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature 568, 511–516. [DOI] [PubMed] [Google Scholar]
  8. Bernhagen J, Krohn R, Lue H, Gregory JL, Zernecke A, Koenen RR, Dewor M, Georgiev I, Schober A, Leng L, et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment. Nat. Med 13, 587–596. [DOI] [PubMed] [Google Scholar]
  9. Bottero V, Withoff S, and Verma IM (2006). NF-kappaB and the regulation of hematopoiesis. Cell Death Differ 13, 785–797. [DOI] [PubMed] [Google Scholar]
  10. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, et al. (2019). WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551–556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chapellier M, Peña-Martínez P, Ramakrishnan R, Eriksson M, Talkhoncheh MS, Orsmark-Pietras C, Lilljebjörn H, Högberg C, Hagström-Andersson A, Fioretos T, et al. (2019). Arrayed molecular barcoding identifies TNFSF13 as a positive regulator of acute myeloid leukemia-initiating cells. Haematologica 104, 2006–2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Charrad RS, Li Y, Delpech B, Balitrand N, Clay D, Jasmin C, Chomienne C, and Smadja-Joffe F (1999). Ligation of the CD44 adhesion molecule reverses blockage of differentiation in human acute myeloid leukemia. Nat. Med 5, 669–676. [DOI] [PubMed] [Google Scholar]
  13. Choi W-T, Tian S, Dong C-Z, Kumar S, Liu D, Madani N, An J, Sodroski JG, and Huang Z (2005). Unique ligand binding sites on CXCR4 probed by a chemical biology approach: implications for the design of selective human immunodeficiency virus type 1 inhibitors. J. Virol 79, 15398–15404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chung SS, Eng WS, Hu W, Khalaj M, Garrett-Bakelman FE, Tavakkoli M, Levine RL, Carroll M, Klimek VM, Melnick AM, and Park CY (2017). CD99 is a therapeutic target on disease stem cells in myeloid malignancies. Sci. Transl. Med. 9, 2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dick JE (2005). Acute myeloid leukemia stem cells. Ann. NY Acad. Sci 1044, 1–5. [DOI] [PubMed] [Google Scholar]
  16. Ding L, and Morrison SJ (2013). Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches. Nature 495, 231–235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Döhner H, Weisdorf DJ, and Bloomfield CD (2015). Acute Myeloid Leukemia. N. Engl. J. Med. 373, 1136–1152. [DOI] [PubMed] [Google Scholar]
  18. Doijen J, Van Loy T, De Haes W, Landuyt B, Luyten W, Schoofs L, and Schols D (2017). Signaling properties of the human chemokine receptors CXCR4 and CXCR7 by cellular electric impedance measurements. PLoS ONE 12, e0185354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Du W, Lu C, Zhu X, Hu D, Chen X, Li J, Liu W, Zhu J, He Y, and Yao J (2019). Prognostic significance of CXCR4 expression in acute myeloid leukemia. Cancer Med. 8, 6595–6603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Eriksson M, Peña-Martínez P, Ramakrishnan R, Chapellier M, Högberg C, Glowacki G, Orsmark-Pietras C, Velasco-Hernández T, Lazarević VL, Juliusson G, et al. (2017). Agonistic targeting of TLR1/TLR2 induces p38 MAPK-dependent apoptosis and NFκB-dependent differentiation of AML cells. Blood Adv. 1, 2046–2057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Faber J, Krivtsov AV, Stubbs MC, Wright R, Davis TN, van den Heuvel-Eibrink M, Zwaan CM, Kung AL, and Armstrong SA (2009). HOXA9 is required for survival in human MLL-rearranged acute leukemias. Blood 113, 2375–2385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Foudi A, Jarrier P, Zhang Y, Wittner M, Geay JF, Lecluse Y, Nagasawa T, Vainchenker W, and Louache F (2006). Reduced retention of radioprotective hematopoietic cells within the bone marrow microenvironment in CXCR4−/− chimeric mice. Blood 107, 2243–2251. [DOI] [PubMed] [Google Scholar]
  23. Greenbaum A, Hsu YMS, Day RB, Schuettpelz LG, Christopher MJ, Borgerding JN, Nagasawa T, and Link DC (2013). CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature 495, 227–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hartwell KA, Miller PG, Mukherjee S, Kahn AR, Stewart AL, Logan DJ, Negri JM, Duvet M, Järås M, Puram R, et al. (2013). Niche-based screening identifies small-molecule inhibitors of leukemia stem cells. Nat. Chem. Biol 9, 840–848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, and Ebert BL (2014). Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat. Biotechnol 32, 941–946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Itkin T, Gur-Cohen S, Spencer JA, Schajnovitz A, Ramasamy SK, Kusumbe AP, Ledergor G, Jung Y, Milo I, Poulos MG, et al. (2016). Distinct bone marrow blood vessels differentially regulate haematopoiesis. Nature 532, 323–328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ito K, Hirao A, Arai F, Takubo K, Matsuoka S, Miyamoto K, Ohmura M, Naka K, Hosokawa K, Ikeda Y, and Suda T (2006). Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat. Med 12, 446–451. [DOI] [PubMed] [Google Scholar]
  28. Järås M, Johnels P, Hansen N, Ågerstam H, Tsapogas P, Rissler M, Lassen C, Olofsson T, Bjerrum OW, Richter J, and Fioretos T (2010). Isolation and killing of candidate chronic myeloid leukemia stem cells by antibody targeting of IL-1 receptor accessory protein. Proc. Natl. Acad. Sci. USA 107, 16280–16285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Järås M, Miller PG, Chu LP, Puram RV, Fink EC, Schneider RK, Al-Shahrour F, Peña P, Breyfogle LJ, Hartwell KA, et al. (2014). Csnk1a1 inhibition has p53-dependent therapeutic efficacy in acute myeloid leukemia. J. Exp. Med 211, 605–612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jeong YH, Sekiya M, Hirata M, Ye M, Yamagishi A, Lee SM, Kang MJ, Hosoda A, Fukumura T, Kim DH, and Saeki S (2010). The low-density lipoprotein receptor-related protein 10 is a negative regulator of the canonical Wnt/β-catenin signaling pathway. Biochem. Biophys. Res. Commun 392, 495–499. [DOI] [PubMed] [Google Scholar]
  31. Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, and Dick JE (2006). Targeting of CD44 eradicates human acute myeloid leukemic stem cells. Nat. Med 12, 1167–1174. [DOI] [PubMed] [Google Scholar]
  32. Jin L, Lee EM, Ramshaw HS, Busfield SJ, Peoppl AG, Wilkinson L, Guthridge MA, Thomas D, Barry EF, Boyd A, et al. (2009). Monoclonal antibody-mediated targeting of CD123, IL-3 receptor α chain, eliminates human acute myeloid leukemic stem cells. Cell Stem Cell 5, 31–42. [DOI] [PubMed] [Google Scholar]
  33. Jordan CT, Upchurch D, Szilvassy SJ, Guzman ML, Howard DS, Pettigrew AL, Meyerrose T, Rossi R, Grimes B, Rizzieri DA, et al. (2000). The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia 14, 1777–1784. [DOI] [PubMed] [Google Scholar]
  34. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, and Salzberg SL (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Krivtsov AV, Twomey D, Feng Z, Stubbs MC, Wang Y, Faber J, Levine JE, Wang J, Hahn WC, Gilliland DG, et al. (2006). Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9. Nature 442, 818–822. [DOI] [PubMed] [Google Scholar]
  36. Kuo HP, Wang Z, Lee DF, Iwasaki M, Duque-Afonso J, Wong SH, Lin CH, Figueroa ME, Su J, Lemischka IR, and Cleary ML (2013). Epigenetic roles of MLL oncoproteins are dependent on NF-κB. Cancer Cell 24, 423–437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ley TJ, Miller C, Ding L, Raphael BJ, Mungall AJ, Robertson A, Hoadley K, Triche TJ Jr., Laird PW, Baty JD, et al. ; Cancer Genome Atlas Research Network (2013). Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N. Engl. J. Med 368, 2059–2074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, and Durbin R; 1000 Genome Project Data Processing Subgroup (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Liberali P, Snijder B, and Pelkmans L (2015). Single-cell and multivariate approaches in genetic perturbation screens. Nat. Rev. Genet 16, 18–32. [DOI] [PubMed] [Google Scholar]
  41. Liesveld JL, Bechelli J, Rosell K, Lu C, Bridger G, Phillips G 2nd, and Abboud CN (2007). Effects of AMD3100 on transmigration and survival of acute myelogenous leukemia cells. Leuk. Res 31, 1553–1563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Liu S-H, Gu Y, Pascual B, Yan Z, Hallin M, Zhang C, Fan C, Wang W, Lam J, Spilker ME, et al. (2017). A novel CXCR4 antagonist IgG1 antibody (PF-06747143) for the treatment of hematologic malignancies. Blood Adv 1, 1088–1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD Jr., van Rooijen N, and Weissman IL (2009). CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell 138, 286–299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Martin GH, Roy N, Chakraborty S, Desrichard A, Chung SS, Woolthuis CM, Hu W, Berezniuk I, Garrett-Bakelman FE, Hamann J, et al. (2019). CD97 is a critical regulator of acute myeloid leukemia stem cell function. J. Exp. Med 216, 2362–2377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Miller PG, Al-Shahrour F, Hartwell KA, Chu LP, Järås M, Puram RV, Puissant A, Callahan KP, Ashton J, McConkey ME, et al. (2013). In Vivo RNAi Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling. Cancer Cell 24, 45–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Möhle R, Bautz F, Rafii S, Moore MA, Brugger W, and Kanz L (1998). The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood 91, 4523–4530. [PubMed] [Google Scholar]
  47. Monaco G, Konopleva M, Munsell M, Leysath C, Wang R-Y, Jackson CE, Korbling M, Estey E, Belmont J, and Andreeff M (2004). Engraftment of acute myeloid leukemia in NOD/SCID mice is independent of CXCR4 and predicts poor patient survival. Stem Cells 22, 188–201. [DOI] [PubMed] [Google Scholar]
  48. Munoz DM, Cassiani PJ, Li L, Billy E, Korn JM, Jones MD, Golji J, Ruddy DA, Yu K, McAllister G, et al. (2016). CRISPR screens provide a comprehensive assessment of cancer vulnerabilities but generate false-positive hits for highly amplified genomic regions. Cancer Discov 6, 900–913. [DOI] [PubMed] [Google Scholar]
  49. Nagasawa T (2014). CXC chemokine ligand 12 (CXCL12) and its receptor CXCR4. J. Mol. Med. (Berl.) 92, 433–439. [DOI] [PubMed] [Google Scholar]
  50. Nie Y, Han Y-C, and Zou Y-R (2008). CXCR4 is required for the quiescence of primitive hematopoietic cells. J. Exp. Med 205, 777–783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Passaro D, Irigoyen M, Catherinet C, Gachet S, Da Costa De Jesus C, Lasgi C, Tran Quang C, and Ghysdael J (2015). CXCR4 Is Required for Leukemia-Initiating Cell Activity in T Cell Acute Lymphoblastic Leukemia. Cancer Cell 27, 769–779. [DOI] [PubMed] [Google Scholar]
  52. Peña-Martínez P, Eriksson M, Ramakrishnan R, Chapellier M, Högberg C, Orsmark-Pietras C, Richter J, Andersson A, Fioretos T, and Järås M (2018). Interleukin 4 induces apoptosis of acute myeloid leukemia cells in a Stat6-dependent manner. Leukemia 32, 588–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Puram RV, Kowalczyk MS, de Boer CG, Schneider RK, Miller PG, McConkey M, Tothova Z, Tejero H, Heckl D, Järås M, et al. (2016). Core Circadian Clock Genes Regulate Leukemia Stem Cells in AML. Cell 165, 303–316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Roychoudhury J, Clark JP, Gracia-Maldonado G, Unnisa Z, Wunderlich M, Link KA, Dasgupta N, Aronow B, Huang G, Mulloy JC, and Kumar AR (2015). MEIS1 regulates an HLF-oxidative stress axis in MLL-fusion gene leukemia. Blood 125, 2544–2552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Saini V, Marchese A, and Majetschak M (2010). CXC chemokine receptor 4 is a cell surface receptor for extracellular ubiquitin. J. Biol. Chem 285, 15566–15576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sanjana NE, Shalem O, and Zhang F (2014). Improved vectors and genome-wide libraries for CRISPR screening. Nat. Methods 11, 783–784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Schepers K, Campbell TB, and Passegué E (2015). Normal and leukemic stem cell niches: insights and therapeutic opportunities. Cell Stem Cell 16, 254–267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Shlush LI, Mitchell A, Heisler L, Abelson S, Ng SWK, Trotman-Grant A, Medeiros JJF, Rao-Bhatia A, Jaciw-Zurakowsky I, Marke R, et al. (2017). Tracing the origins of relapse in acute myeloid leukaemia to stem cells. Nature 547, 104–108. [DOI] [PubMed] [Google Scholar]
  59. Smyth GK (2005). limma: Linear Models for Microarray Data. In Bioinformatics and Computational Biology Solutions Using R and Bioconductor, Gentleman R, Carey VJ, Huber W, Irizarry RA, and Dudoit S, eds. (Springer New York; ), pp. 397–420. [Google Scholar]
  60. Spoo AC, Lübbert M, Wierda WG, and Burger JA (2007). CXCR4 is a prognostic marker in acute myelogenous leukemia. Blood 109, 786–791. [DOI] [PubMed] [Google Scholar]
  61. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Sugiyama T, Kohara H, Noda M, and Nagasawa T (2006). Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity 25, 977–988. [DOI] [PubMed] [Google Scholar]
  63. Tavor S, Petit I, Porozov S, Avigdor A, Dar A, Leider-Trejo L, Shemtov N, Deutsch V, Naparstek E, Nagler A, and Lapidot T (2004). CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice. Cancer Res 64, 2817–2824. [DOI] [PubMed] [Google Scholar]
  64. Tavor S, Eisenbach M, Jacob-Hirsch J, Golan T, Petit I, Benzion K, Kay S, Baron S, Amariglio N, Deutsch V, et al. (2008). The CXCR4 antagonist AMD3100 impairs survival of human AML cells and induces their differentiation. Leukemia 22, 2151–5158. [DOI] [PubMed] [Google Scholar]
  65. Testa U, Labbaye C, Castelli G, and Pelosi E (2016). Oxidative stress and hypoxia in normal and leukemic stem cells. Exp. Hematol 44, 540–560. [DOI] [PubMed] [Google Scholar]
  66. Tseng D, Volkmer J-P, Willingham SB, Contreras-Trujillo H, Fathman JW, Fernhoff NB, Seita J, Inlay MA, Weiskopf K, Miyanishi M, and Weissman IL (2013). Anti-CD47 antibody-mediated phagocytosis of cancer by macrophages primes an effective antitumor T-cell response. Proc. Natl. Acad. Sci. USA 110, 11103–11108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Tzeng YS, Li H, Kang YL, Chen WC, Cheng WC, and Lai DM (2011). Loss of Cxcl12/Sdf-1 in adult mice decreases the quiescent state of hematopoietic stem/progenitor cells and alters the pattern of hematopoietic regeneration after myelosuppression. Blood 117, 429–439. [DOI] [PubMed] [Google Scholar]
  68. Vu LP, Prieto C, Amin EM, Chhangawala S, Krivtsov A, Calvo-Vidal MN, Chou T, Chow A, Minuesa G, Park SM, et al. (2017). Functional screen of MSI2 interactors identifies an essential role for SYNCRIP in myeloid leukemia stem cells. Nat. Genet 49, 866–875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wang Y, Krivtsov AV, Sinha AU, North TE, Goessling W, Feng Z, Zon LI, and Armstrong SA (2010). The Wnt/beta-Catenin Pathway Is Required for the Development of Leukemia Stem Cells in AML. Science 327, 1650–1653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Welner RS, Amabile G, Bararia D, Czibere A, Yang H, Zhang H, Pontes LLDF, Ye M, Levantini E, Di Ruscio A, et al. (2015). Treatment of chronic myelogenous leukemia by blocking cytokine alterations found in normal stem and progenitor cells. Cancer Cell 27, 671–681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wescott MP, Kufareva I, Paes C, Goodman JR, Thaker Y, Puffer BA, Berdougo E, Rucker JB, Handel TM, and Doranz BJ (2016). Signal transmission through the CXC chemokine receptor 4 (CXCR4) transmembrane helices. Proc. Natl. Acad. Sci. USA 113, 9928–9933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Xiu Y, Dong Q, Li Q, Li F, Borcherding N, Zhang W, Boyce B, Xue HH, and Zhao C (2018). Stabilization of NF-κB-Inducing Kinase Suppresses MLL-AF9-Induced Acute Myeloid Leukemia. Cell Rep. 22, 350–358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zhang Y, Dépond M, He L, Foudi A, Kwarteng EO, Lauret E, Plo I, Desterke C, Dessen P, Fujii N, et al. (2016). CXCR4/CXCL12 axis counteracts hematopoietic stem cell exhaustion through selective protection against oxidative stress. Sci. Rep 6, 37827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhang F, Liu X, Chen C, Zhu J, Yu Z, Xie J, Xie L, Bai H, Zhang Y, Fang X, et al. (2017). CD244 maintains the proliferation ability of leukemia initiating cells through SHP-2/p27kip1 signaling. Haematologica 102, 707–718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Zou Y-R, Kottmann AH, Kuroda M, Taniuchi I, and Littman DR (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393, 595–599. [DOI] [PubMed] [Google Scholar]
  76. Zuber J, Shi J, Wang E, Rappaport AR, Herrmann H, Sison EA, Magoon D, Qi J, Blatt K, Wunderlich M, et al. (2011). RNAi screen identifies Brd4 as a therapeutic target in acute myeloid leukaemia. Nature 478, 524–528. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table 3
1

Data Availability Statement

The accession number for the RNA sequencing data reported in this paper is Gene Expression Omnibus (GEO): GSE135275.

RESOURCES