Abstract
Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in any of the genes encoding for the branched-chain keto dehydrogenase (BCKDH) components. This study screened MSUD patients throughout the whole Upper Egypt describing their symptoms, clinical and laboratory findings, genetic studies, and their treatment, with a 6-month follow-up for their responses. Screening identified three children with MSUD. Homozygous mutation in R195Q single nucleotide polymorphism (SNP) within the BCKDHA gene was found with the second MSUD patient. Follow-up for 6 months to assess the treatment regimens and progression of cases demonstrated that early treatment regimens including a dietary restriction of branched-chain amino acids with L-Carnitine administration could prevent MSUD-associated intellectual disabilities. It was concluded that R195Q SNP is pathogenic, and it may cause inherited forms of MSUD in some patients. MSUD cases have rarely been reported; so these findings will be highly useful for future cases of MSUD in the Upper Egyptian population.
Keywords: MSUD, L-carnitine, R195Q
Introduction
Maple syrup urine disease (MSUD) is considered a rare autosomal recessive inherited metabolic disorder of branched-chain amino acid (BCAA) metabolism caused by a defect in the activity of branched-chain α-keto acid dehydrogenase complex (BCKADH), which consists of four subunits of E1a, E1b, E2 and E3, which are encoded by BCKDHA, BCKDHB, DBT, and DLD genes, respectively. 1 2 The worldwide incidence of MSUD was estimated to be 1 in 185,000 live births. 3 4 5 Prevalence: 1–9/1000000 (worldwide), 1–9/1000000 (United States), 1–9/1000000 (Italy), 1–9/100000 (Tunisia), 1–9/1000000 (Japan); however, in Egypt, incidence of MSUD was found to be 1 for each 25,276 healthy newborns and 17 in 3900 high risk pediatric patients. 6
Branched-chain keto-dehydrogenase (BCKDH) catalyzes the oxidative decarboxylation of branched-chain α-keto acids derived from the BCAAs using thiamine pyrophosphate as coenzyme. 7
The deficient activity of BCKAD leads to the accumulation of leucine, isoleucine, valine, and their respective metabolites that leads to a remarkable increase in the amount of L-alloisoleucine, and their α-keto acids (α-ketoisocaproate, α-keto-β-methylvalerate, and α-ketoisovalerate) in the plasma, urine, and cerebrospinal fluid, 8 causing systematic manifestations of toxicity, especially in the central nervous system. 9
The clinical picture depends on the severity of the underlying disorder and metabolic decompensation, ranging from intermittent symptoms of various degrees, such as hypotonia and failure to thrive to acute life-threatening encephalopathy. MSUD has different forms: classic, intermediate (mild), intermittent, thiamine-responsive, and MSUD is caused by a deficiency of E3 subunit. 10 Pathogenic homozygous or compound heterozygous variants in BCKDHA, BCKDHB, or DBT can lead to MSUD. 11
Classic MSUD is the most severe phenotype; it accounts for 75% of the cases, and is characterized by BCKDH complex activity ranging from 0 to 2%. In the classic MSUD, clinical onset usually occurs within the first week after birth, including maple syrup odor, poor feeding, acute metabolic decompensation, and drowsiness, followed by progressive coma, seizures, and even central respiratory failure. Brain edema is a common complication of metabolic decompensation. Branched-chain amino or organic acidopathies also lead to secondary metabolic imbalances, transport competition, and deficiencies of metabolic intermediates, micronutrients with disturbed energy production, and oxidative stress. 12
To date, ∼48 mutations of the BCKDHA gene are found, of which, NM_000709.3: c.476G > A and NM_001164783.1:c.476G > A are BCKDHA transcript variant mutations. Others are 2-oxoisovalerate dehydrogenase subunit α, mitochondrial isoforms precursors missense variant mutation as NP_001158255.1:p.Arg159Gln and NP_000700.1:p.Arg159Gln.
The R195Q (rs773048903) NM_000709.3(BCKDHA):c.476G > A (p.Arg159Gln) is a single nucleotide variant, it is a missense variant, it is located in BCKADH E1, α polypeptide affecting activity of BCKDA responsible for MSUD. Its genomic location is Chr19: 41414149 (on Assembly GRCh38) and Chr19: 41920054 (on Assembly GRCh37), with preferred name of NM_000709.3(BCKDHA): c.476G > A (p.Arg159Gln), HGVS: NC_000019.10:g.41414149G > A, NG_013004.1:g.21361 G > A, NP_000700.1: p.Arg159Gln, NC_000019.9:g.41920054G > A. Its cytogenetic location is 19q13.2, with a sequence ontology (SO) 0001583. 7
This single nucleotide polymorphism (SNP) is pathognomonic and of clinical importance reported on ClinVar. Frequencies reported are A = 0.00001 (3/245250, GnomAD) and A = 0.00002 (2/118794, ExAC), whereas identifiers are Orphanet: 511, and OMIM: 248600.
MSUD is amenable to be treated to prevent intellectual disabilities. With early treatment and by dietary restriction of BCAAs, patients typically have good clinical outcomes. 13 The treatments for MSUD include low protein diet supplementation with BCAAs-free formula and symptomatic treatment during metabolic crises as mannitol intake to cure cerebral edema and use of D-carbamoyl glutamate to decrease the blood ammonia level. 14
Aim
In this study, screening of MSUD patients was done throughout upper Egypt during the study period, explaining the early clinical criteria and interpreting different maneuvers for diagnosis of MSUD. Together with urinary and plasma BCAAs analysis, BCKDHA-1 gene deletion and R195Q mutation were investigated as a trial to identify the underlying main etiological genetic features of those diseased infants in the study population. The follow-up on the diagnosed cases for 6 months was also done, to assess the effect of the given treatment regimens and to find the decreased mortality and morbidity in the affected cases.
Materials and Methods
The present study was a descriptive cross-sectional study. Screening was conducted in Assiut University Children Hospital, with collaboration with genetic and metabolic disorder unit at Medical Biochemistry Department, Faculty of Medicine, Assiut University, in the period from March 2018 to Feb 2019. The number of patients attending outpatient genetic clinics (and/or) admitted in Assiut University Children Hospital were 8,2730, all were included in this study. Assiut University Children Hospital is considered as a tertiary center that receives cases from five governments in Upper Egypt, including Aswan, Qena, Sohag, Assiut, and Minia governments.
The study was reviewed and approved by the local ethics committee of the Faculty of Medicine, Assiut University (code: 17100624). Written informed consent was obtained from the parents of all included subjects for participation in the study and publication of the results.
Subjects
After screening of the included subjects, 51 infant patients were selected to be included in the present study, according to the following inclusion criteria: babies with unexplained poor sucking, decreased activity, lethargy, coma and convulsion without acute metabolic condition, unexplained hypotonia, hepatomegaly, hyperammonemia, liver cell failure, unexplained cholestasis, or persistent hypoglycemia. Other patients were excluded from the study according to the following exclusion criteria: multiple congenital anomalies, hypoxic-ischemic encephalopathy, neonatal sepsis, central brain abnormalities, any diagnosed systematic organic illness (e.g., renal, heart, or thyroid disease), or any suspected acute metabolic conditions rather than MSUD.
Complete pediatric history was taken from each participant, including personal history, birth history, feeding history, immunization history, developmental history, family history, and drug history; all relevant data was collected by a well-designed questionnaire. Family history was taken including the age of parents, consanguinity, parents' health, medications taken by the mother during pregnancy, the number and age of siblings, family history of any genetic or metabolic disorders, duration of illness, and history of stillbirth or miscarriages.
The 51 inborn errors of metabolism suspected patients were divided into three subgroups according to their main presenting symptoms:
Group A included 22 patients with poor oral intake and poor sucking.
Group B included 17 patients with delayed physical and mental development, with hypotonia and hyporeflexia as striking signs.
Group C included 12 patients who presented mainly with convulsions.
Then after laboratory analysis and according to the results of serum and urinary amino acids profiles, the participants were divided into two groups;
MSUD positive included 3 positive MSUD patients.
Non-MSUD group included 48 patients without MSUD.
The parents of the three MSUD cases were also recruited in the study only to assess their genetic analysis; however, their clinical presentations and laboratory investigations were not included in the statistical analysis.
General Examination
The means of the weight (kg), height percentile, weight/height ratio, BMI percentile, and blood pressure were measured for all study population.
Blood Samples
Five mL of peripheral upper or lower limb venous blood was taken from all the patients. One mL of whole blood was collected in ethylenediaminetetraacetic acid containing tubes and was used for deoxyribonucleic acid (DNA) extraction, 4 mL of blood was collected in a heparinized tube, mixed, and centrifuged at 3000 rpm for 10 minutes, then plasma was separated and stored at −70 °C for measurement of the free amino acid profiles and other biochemical parameters.
Urine Samples
Five mL of freshly voided middle stream urine samples was taken and preserved at –70°C for amino acids estimation; urine samples were taken during urination of infants or by the application of catheter or through urine collection bags.
The Quantitative Assay of Amino Acids
Plasma and urine assessment for amino acids was done with Sykam Automatic Amino Acid Analyzer S433 provided by Sykam GmbH, Germany (catalog no. 1120001) that ensured quantitative and qualitative assessment of amino acids. Plasma and urine samples preparation were done by acidic protein precipitation using 10% sulfosalicylic acid, and sample dilution buffer (catalog no. S000015). Sample analysis was done by the ion exchange separation method using high-performance liquid chromatography. Amino acid physiological standard (catalog no. 6006005), cation separation column LCAK06/Li was used (catalog no. 5112008) with size: 150 mm× 4.6 mm, specification range was met efficiency: > 48000, asymmetry: 0.8–1.5, resolution THR/SER: > 1700, and column pressure was 45–80 bar, ready to use ninhydrin reagent (catalog no. S000025) and citrate buffers in different pH (2.9, 4.2, and 8.0) were used. The dilution factor was 2.5, analysis was done at wavelength 570 nm. Then the sample chromatogram was compared with the standard curve.
Analysis of Other Biochemical Parameters
Plasma glucose was investigated using spectrum-diagnostics (catalog no. GL1320). EnzyChrom Ammonia/Ammonium Assay Kit Catalog No: ENH3–100 was used for the determination of ammonia, QuantiChrom Urea Assay Kit II (Catalog No: DUR2–100) for urea, and DetectX Serum Creatinine Kit Catalog No: KB02-H2 for the determination of creatinine.
DNA Extraction
Genomic DNA was extracted from the peripheral whole blood samples from MSUD diagnosed patients and their parents by QIAamp DNA mini extraction kits (catalog no. 51104) supplied by Qiagen, Germany (Lima, 2007), according to instructions provided by the manufacturer. The DNA was kept at –20°C until genotyping. Polymerase chain reaction (PCR) was performed in a Veriti thermal cycler (Applied Biosystems, Foster City, California, United States).
Screening for the Detection of Deletion in Intron-1 BCKDHA Gene
Primer3 algorithm was used to design the forward and reverse PCR primers for amplifying the BCKDHA gene. Amplification was done with an initial denaturation step at 95°C for 5 minutes, followed by 30 cycles of 30 seconds at 95°C, annealing for 15 seconds at 69°C, and extension for 30 seconds at 72°C, then a final extension was done at 72°C for 10 minutes; PCR products were electrophoresed on a 2.0% agarose gel containing 0.5 μg/mL ethidium bromide then viewed on BIODOC gel documentation system, as the expected size of the product was 682bp.
Primers Sequence (5′ to 3′) used: (Sense primer) GAGGGAAGGGACAGAAACTAAC
(Antisense primer) GGAGAAGGAGAGGAAAGA
Genotyping for the Screening of Missense Variant R195Q or (rs773048903) NM_000709.3 (BCKDHA) (rs773048903) Single Nucleotide Polymorphism
Identification of BCKDHA gene mutations were found through the accession of genetic bioinformatics databases. R195Q or (rs773048903) NM_000709.3 (BCKDHA), SNP in the BCKADH E1, α polypeptide was done by allele-specific PCR technique (AS-PCR).
Genotyping testing by AS-PCR was done by using two sets of PCRs. In the first set called wild type, the two wild forward and reverse primer were added along with other reagents required to do the PCR. In the second set of PCRs, primers specific to the known mutation that forms a 3′ mismatch with the DNA reverse primer together with the wild type were added along with other PCR reagents that were required. AS-PCR was performed on MSUD detected patients and their parents together with the non-MSUD patients to check whether this mutation had a functional significance in MSUD or not Primers Sequence (5′ to 3′) used:
Wild F: CGGATCTCCTTCTACATGAC
Wild R: GACAGACGTACCTGCCTCAC
Mut R: GACAGACGTACCTGCCTCAT
The PCR products were electrophoresed on a 3.0% agarose gel containing 0.5 μg/mL ethidium bromide, then viewed on the BIODOC gel documentation system, to verify genotyping quality, the genotyping call was performed by two independent persons, few random samples were re-genotyped, and both showed 100% concordance.
Statistical Analysis
The statistical analysis was done using IBM SPSS Statistics version 17 (IBM Corp.; Armonk, New York, United States), MedCalc version 14 (MedCalc software bvba, Ostend, Belgium), and XLSTAT Version2014.5.03 (Addinsoft, Massachusetts, United States).
The data that did not obey the normal distribution were presented by the median (interquartile range intelligence quotient [IQ]), and the Kruskal–Wallis test was used to determine whether the differences among three groups (groups according to presenting symptoms) were statistically significant.
The differences among the two groups (MSUD and non-MSUD) were assessed by Mann–Whitney U test.
The interquartile range IQ is the range of values within which 50% of the intermediate grades exist.
Qualitative data were presented as number (percentile). And chi-squared test was used to determine the difference between MSUD and non-MSUD groups.
p -Value of (< 0.05) was considered statistically significant and p -value (< 0.01) was considered highly statistically significant.
Results
The study included 51 patients, and according to their presenting symptoms, 43% patients of them presented with poor oral intake and poor sucking, 33% with delayed physical and mental development, and 24% mainly with convulsion. The data in the Table 1 shows their anthropometric characters and laboratory investigations.
Table 1. Anthropometric characters and laboratory investigations of the three studied group according to the presenting symptoms.
| Group A | Group B | Group C | p -Value | ||
|---|---|---|---|---|---|
| No. 22 (43%) Median (IQ range) |
No. 17 (33%) Median (IQ range) |
No. 12 (24%) Median (IQ range) |
|||
| Weight (kg) | 2.73(1.6–3.1) | 6(1.42–8.5) | 3(1.97–7) | 0.407 | |
| BMI (kg/m 2 ) | 11.73(8.65–13.08) | 11.48(8.76–15.14) | 14.2(13.09–15.27) | 0.095 | |
| Height (cm) | 48.0(42.0–54.0) | 65.0(42.0–68.0) | 45.0(38.0–65.0) | 0.149 | |
| W/H ratio | 0.05(0.04–0.07) | 0.09(0.04–0.11) | 0.07(0.05–0.11) | 0.709 | |
| Height percentile | 18.4(1.8–100) | 99.8(34.9–100) | 89.15(22.05–97.98) | 0.638 | |
| Weight percentile | 3.25(1.03–22.45) | 18.4(0.55–91.6) | 3.9(0.65–18.33) | 0.638 | |
| BMI percentile | 15.9(6.7–100) | 65.5(6.7–100) | 48.15(9.88–77.58) | 0.852 | |
| Blood gases | |||||
| PH | 7.42(7.32–7.49) ** | 7.41(7.34–7.56) | 7.5(7.4–7.57) | 0.179 | |
| PCO2 | 39.3(30.4–45.3) | 32.3(23.7–33.8) | 28.1(23.3–34.3) | 0.024 | |
| HCO-3 | 23.9(18.1–28.8) * | 23.25(17.6–24.4) # | 22.3(17.4–29.8) | 0.615 | |
| Systolic BP (mm Hg) | 70(70–90) | 90(70–95) | 70(60–81) | 0.060 | |
| Diastolic BP (mm Hg) | 50(40–55) | 59(47.5–64) | 50(40–50) $ | 0.065 | |
| Serum glucose (mg/dL) | 83(60–109) | 96(60.5–108.5) | 88(53–113) | 0.799 | |
| Serum creatinine (mg/dL) | 0.5(0.4–0.8) | 0.4(0.3–0.7) | 0.5(0.3–1.1) | 0.624 | |
| BUN (mg/dL) | 3.5(2.24–7.93) | 5.13(2.64–8.17) | 6.07(1.87–11.2) | 0.709 | |
| Urea (mg/dL) | 7.5(4.8–17) | 11(5.65–17.5) | 13(4–24) | 0.709 | |
| Valine | Plasma (µmol/L) | 85(50–145) | 90(67–152.5) | 130.56(87–170) | 0.423 |
| Urine (µmol/mmol Cr) | 18(9–24) | 15(7–20.46) | 14(10–19) | 0.436 | |
| Leucine | Plasma (µmol/L) | 155(106–170) ** | 85(74.5–127.5) | 105(90–152.24) | 0.001 |
| Urine (µmol/mmol Cr) | 19(14.9–24.7) ** | 11.79(5.5–15.28) | 14(9.1–21) | 0.015 | |
| Isoleucine | Plasma (µmol/L) | 118(86–135) ** | 54(43.37–81.5) # | 70(50–109) | 0.001 |
| Urine (µmol/mmol Cr) | 4.3(1.6–5.7) | 2.9(1.1–4) | 3.7(1.9–6) | 0.163 | |
| Total BCAA | 1116.79 (654.92–1744.41) ** |
377.8(338–426.3) | 268(212.59–408.85) | 0.017 | |
| Tyrosine | Plasma (µmol/L) | 100(66–175) | 85(22.5–150) | 95(65–135) | 0.407 |
| Urine (µmol/mmol Cr) | 37(23.99–51)** | 18(10–32) | 22(13–42) | 0.019 | |
| Phenylalanine | Plasma (µmol/L) | 71(29–115) | 80.53(27.5–110) | 70(29.05–134) | 0.903 |
| Urine (µmol/mmol Cr) | 24.8(15.5–28.9) | 19(12.75–22.95) | 21.5(17.5–28) | 0.211 | |
| Total AAA | 143.04(126.22–0) | 257.9(163.3–336.5) | 235.69(97.1–291.5) | 0.299 | |
| BCAA/AAA | 1.4(1.14–2.36) | 1.35(1.22–2.96) | 1.65(1.33–2.75) | 0.891 | |
| Arginine | Plasma (µmol/L) | 32(23.6–44) * | 16.4(6-33.8) # | 21.2(10.8–47.6) | 0.056 |
| Urine (µmol/mmol Cr) | 10(7–11.5) ** | 4.25(1.75–8) ## | 5.5(2.75–9) $ | 0.002 | |
| Ornithine | Plasma (µmol/L) | 112(72–155) * | 57(22–99.5) # | 70.52(37–132) | 0.026 |
| Urine (µmol/mmol Cr) | 13.5(10.5–17.6) ** | 6.5(2.5–14) ## | 9(4–16) | 0.014 | |
| Glycine | Plasma (µmol/L) | 175.5(85.1–239.6) | 182.25(58.5–240) | 223.25(162–267) | 0.271 |
| Urine (µmol/mmol Cr) | 521.33(392.4–784.31) | 344.55(222–559.25) | 424.3(279.5–696.65) | 0.238 | |
| Citrulline | Plasma (µmol/L) | 27.4(9.6–31.6) | 20.4(8.4–30.9) | 19.35(11.1–34.6) | 0.740 |
| Urine (µmol/mmol Cr) | 7.35(2.85–8.95) | 5.75(2.65–8.75) | 6.15(3.85–9.15) | 0.812 | |
| Urea | Plasma (µmol/L) | 1859(1263–2745)* | 1450(925–1950) | 1756(1500–2069.31) | 0.098 |
| Urine (µmol/mmol Cr) | 1540(1460–1650)** | 1380(1300–1530) | 1430(1324–1580) | 0.022 | |
| Ammonia | Plasma | 172(141.85-217.28) | 159(134.75–193.65) | 173.3(153–201) | 0.500 |
| Urine (µmol/mmol Cr) | 74.2(56.88–85.23) | 61.6(40.6–93.1) | 65.8(49–97.3) | 0.858 | |
Abbreviations: AAA, aromatic amino acids; BCAA, branched chain amino acid; BP, blood pressure; BMI, body mass index; BUN, blood urea nitrogen; HCO3, bicarbonate; IQ, intelligence quotient; PCO 2, partial pressure of carbon dioxide; W/H, weight height ratio.
Plasma amino acid and their derivative levels by (µmol/L), urine amino acid levels and their derivatives by (µmol/mmol creatinine).
Kruskal–Wallis test, p -value: all groups, a significant statistically difference ( p < 0.05).
(*)P1: Group A vs. Group B, (#)P2: Group A vs. Group C, ($)P3: Group B vs. Group C.
Plasma amino acid profiles showed that 6% of the patients (three patients only) were diagnosed with MSUD (two male patients and one female) and 94% of patients were negative cases (non-MSUD) (Table 1). All the three MSUD diagnosed cases were presented mainly by poor sucking (all fall under group: A). All of them were offspring of consanguineous parents, 33.3% of them had a history of stillbirth.
General information, sociodemographics, and laboratory characterization of the MSUD infants are showed in Table 2 ; they presented mainly by poor sucking, poor oral feeding, then convulsion, lethargy, and persistent hypoglycemia within few days after birth. The median values of the quantitative assay of urinary and plasma amino acids are showed in ( Figs. 1 and 2 ). Branched amino acids (valine, leucine, isoleucine), total branched amino acids, and other various amino acid levels showed that there were high urinary BCAAs for those three patients who were diagnosed with MSUD. Highly significant difference in the plasma and urinary concentration of leucine ( p = 0.006, p = 0.004), isoleucine ( p = 0.006, p = 0.004), urinary levels of valine ( p = 0.004), and high total BCAAS ( p = 0.004) between the MSUD and non-MSUD groups were found that confirmed the clinical diagnosis of MSUD.
Table 2. General, sociodemographic, and laboratory characterization of the positive MSUD patients.
| Patient no. | 1 | 2 | 3 | |
|---|---|---|---|---|
| Sex | Male | Male | Female | |
| Age at diagnosis | 2 weeks | 6 months | 21 days | |
| Weight (kg) | 3.7 | 6.5 | 2.73 | |
| Height (cm) | 50 | 63 | 48 | |
| Height percentile | 18.4 | 1.8 | 1.8 | |
| Weight percentile | 42.1 | 3.6 | 1.1 | |
| BMI percentile | 75.8 | 24.2 | 3.6 | |
| W/H ratio | 31:15 | 47:21 | 35:13 | |
| Clinical presentation | Poor suckling, poor oral feeding, convulsion, lethargic and persistent hypoglycemia | Poor suckling, poor oral feeding, lethargic, and convulsion | Poor suckling, brain edema, and convulsion | |
| History of pregnancy | 5 postnatal death due to metabolic disorder | Two health brothers | Two living children, 1 death and 1 abortion | |
| Blood gases | PH = 7.27 PCO 2 = 32 HCO 3 - = 15.3 |
PH = 7.56 PCO 2 = 18 HCO 3 - = 16.4 |
PH = 7.52 PCO 2 = 34 HCO 3 - = 28.2 |
|
| Blood pressure | 70/50 | 100/60 | 75/55 | |
| Serum glucose (mg/dL) | 63 | 93 | 93 | |
| Serum creatinine (mg/dL) | 0.6 | 0.4 | 0.5 | |
| BUN (mg/dL) | 6.07 | 11.2 | 14.47 | |
| Urea (mg/dL) | 13 | 24 | 31 | |
| Valine | Urine (µmol/mmol Cr) | 216.72 | 79.38 | 86.37 |
| Plasma (µmol/L) | 421 | 86.2 | 541 | |
| Leucine | Urine (µmol/mmol Cr) | 645.74 | 144.39 | 260.76 |
| Plasma (µmol/L) | 201 | 177 | 255 | |
| Isoleucine | Urine (µmol/mmol Cr) | 133.38 | 59.48 | 138 |
| Plasma (µmol/L) | 194 | 145 | 261 | |
| Tyrosine | Urine (µmol/mmol Cr) | 92.83 | 151.15 | 23.99 |
| Plasma (µmol/L) | 52.3 | 122 | 41.1 | |
| Phenylalanine | Urine (µmol/mmol Cr) | 69.22 | 21.54 | 17.94 |
| Plasma (µmol/L) | 61.4 | 71 | 52.4 | |
| Urea | Urine (µmol/mmol Cr) | 485.34 | 14.8 | 144 |
| Ammonia | Urine (µmol/mmol Cr) | H | 30.05 | H |
| Arginine | Urine (µmol/mmol Cr) | H | 7.73 | 34.81 |
| Plasma (µmol/L) | 13.7 | 7.78 | 24.1 | |
| Ornithine | Urine (µmol/mmol Cr) | 11.05 | 125.08 | 32.14 |
| Plasma (µmol/L) | 314 | 179 | 304 | |
| Glycine | Urine (µmol/mmol Cr) | 109.07 | 82.49 | 219 |
| Plasma (µmol/L) | 254 | 291 | 32.14 | |
| Citrulline | Urine (µmol/mmol Cr) | 100.72 | 31.02 | 36.93 |
| Plasma (µmol/L) | 27.4 | 17.4 | 20.4 | |
| Response to treatment | No response | Response | Response | |
| Treatment | –Special milk formula for MSUD –Vitamins B1, B2, and B12 –L-Carnitine oral drops ½ of dropper /twice daily |
–Special milk formula for MSUD at dose of (15%w/v) –Vitamins B1, B2, and B12 –L-Carnitine oral drops ½ of dropper /twice daily |
–Special milk formula for MSUD –Vitamins B1, B2, and B12 –L-Carnitine oral drops ½ of dropper /twice daily |
|
| Clinical presentation after treatment | No response Died at the age of one month |
Respond to treatment, but has a decrease in immunity response with recurrent pneumonia and delayed physical and mental activity | Respond to treatment, but delayed physical and mental development | |
Abbreviations: BMI, body mass index; BUN, blood urea nitrogen; HCO3, bicarbonate; IQ, intelligence quotient; MSUD, maple syrup urine disease; PCO 2, partial pressure of carbon dioxide; W/H, weight height ratio.
Normal ranges in urine: leucine 3–25 µmol/mmol Cr; isoleucine, 0–6 µmol/mmol Cr; and valine, 3–26 µmol/mmol Cr*Normal ranges in plasma: leucine, 47–170 μmol/L; isoleucine, 31–140 μmol/L; and valine, 0–198 μmol/L.
Fig. 1.
Chromatogram of amino acids: ( A ) standard curve, ( B ) MUSD patient curve, showing highly elevation of BCAAs. Ala, Alanine; ASP, Aspartate; GABA, Gamma amino butyric acid; GlY, Glycine; Ile, Isoleucine; Leu, Leucine; LYS, Lysine; Met, Methionine; Orn, Ornithine; PHE, Phenylalanine; Ser, Serine; Ther, Threonine; Val, Valine.
Fig. 2.
( A ) The median concentration of individual branched-chain amino acids in plasma and urine between positive cases (patients with maple syrup urine disease [MSUD]) and normal (non-MSUD) cases (negative cases). ( B ) The median concentration of total branched-chain amino acids between positive cases (patients with MSUD) and normal (non-MSUD) cases (negative cases).
The clinical examinations done for positive cases (patients with MSUD) and negative (non-MSUD) cases and general laboratory investigations then testing the urinary and plasma profiles of various amino acid between patients with and without MSUD showed that there was no significant difference in the results of both plasma and urinary levels of arginine, glycine, individual, and total aromatic amino acids (AAA); however, there was a significant difference in the ratio of BCAA to AAA ( p = 0.025) ( Figs. 1 and 2 ). Also, a significant difference was found in the urinary concentration of citrulline and plasma ornithine ( p = 0.004). Although there were no significant differences in the results of plasma concentrations of urea and ammonia, their urinary concentrations were significantly different ( p = 0.034) ( p = 0.019).
Screening for mutations in the BCKDHA showed that all patients with MSUD showed negative results of intron-1 BCKDHA gene deletion.
Screening of missense R195Q (rs773048903) NM_000709.3 (BCKDHA):c.476G > A (p.Arg159Gln) showed SNP in the BCKADH E1. Alpha polypeptide enzyme showed that the first and third MSUD patients in the present study were GG genotyping, as showed in Fig. 3A , 3B , 3C and the second MSUD infant was homozygous variant AA genotyping; however, genotyping for the parents showed a heterozygous GA case (the mother of the second MSUD case). All the recruited 51 subjects were genotyped; the non-MSUD 48 subjects showed negative results for r195q c.476 g > a mutation (GG) genotyping.
Fig. 3.
( A and B ) Gel picture of amplification-refractory mutation system polymerase chain reaction (ARMS PCR) for R159Q in BCKDHA gene. MM master mix. Lanes1–8: Gel picture of ARMS PCR with wild type forward and reverse primer sequences. Lanes 1*–8*: Gel picture of ARMS PCR with wild type forward and mutated reverse sequence. Lane 5* was positive homozygous mutations AA as it showed amplification with mutated sequence only. Lane 7* was positive heterozygous GA mutations as it showed amplification with both wild and mutated sequences. Lanes 1*,2*,3*,4*,6*,8* show healthy individuals in which mutation was not present (GG) genotyping. ( C ) Gel picture of ARMS PCR for R159Q in BCKDHA gene. L: deoxyribonucleic acid (DNA) ladder, M: MM master mix. Lanes1–8: Gel picture of ARMS PCR with wild type forward and reverse primer sequences. Lanes 1*–8*: Gel picture of ARMS PCR with wild type forward and mutated reverse sequence. Lane 6* was positive homozygous positive heterozygous GA mutation as it showed amplification with both wild and mutated sequences. Lanes 1*,2*,3*,4*,5*,7*, 8* show healthy individual in which mutation was not present (GG) genotyping.
Discussion
MSUD is a metabolic disorder due to an enzyme defect in the catabolic pathway of the BCAAs. Accumulation of these BCAAs and their corresponding keto acids leads to encephalopathy and progressive neurological degeneration. The disease is often classified by its pattern of signs and symptoms. MSUD is initially diagnosed based on the clinical manifestation and the characteristic maple syrup odor of the urine.
In this study screening for MSUD patients throughout Upper Egypt during the study period (from March 2018 to February 2019) had been performed. Three MSUD patients were diagnosed, and their symptoms, clinical and biochemical laboratory findings, genetic studies, their treatment, and follow-up responses were described.
In the present study, MSUD cases were diagnosed early, because of the awareness among clinicians about inborn error of metabolism and their cooperation with the authors in this study.
In this study, the diagnosis was done by three mandatory steps: first by clinical features that include early feeding problems, a maple syrup odor of the urine, seizures, and coma. The disease is often classified by its pattern of signs and symptoms. The first manifestations are poor oral feeding, convulsions, hypoglycemia and then there is delayed physical and mental development. Second step confirms the diagnosis of MSUD, suspected clinically through high urinary urea and ammonia levels, as urine BCAAs analysis is obligatory for the diagnosis and differential diagnosis of other organic acidurias. The third step is plasma BCAAs analysis that is the most convenient method, especially in newborn screening. In this present study, three MSUD patients were diagnosed by both high blood and urinary BCAAs; further genetic studies were done for confirming the etiological diagnosis. Strauss et al 2010 stated that the majority of MSUD patients have the classical type of the disease; this was in accordance with the present study too, as the three patients presented with typical phenotypes of classic MSUD.
Comparing MSUD cases and non-MSUD subjects revealed that urinary concentrations of urea and ammonia, BCAA/AAA ratio, and urinary concentration of citrulline and plasma ornithine levels ( p = 0.004) were significantly different. All these results are strong indicators for the diagnosis of MSUD.
In this study, three upper Egyptian MSUD patients presented, mainly due to their parents' consanguinity. All three diagnosed as MSUD patients and their parents showed negative results for intron-1 BCKDHA-1 gene deletion as BCKDH complex, which may be encoded by BCKDHB, DBT, and DLD genes other than the common BCKDHA gene. According to recent reports, the occurrence of some mutations in the MSUD causing genes depends on ethnicities, so that targeted mutations could be suggested for individuals of certain geographic locations. 15
Screening for NM_000709.3(BCKDHA):c.476G > A (p.Arg159Gln) missense mutation in the BCKDHA in the BCKADH E1 α polypeptide was done for all the study population by ASPCR. Identification of SNP showed that two patients out of the three diagnosed with MSUD in the present study were GG genotyped; however, the third was homozygous variant (AA), for the parents genotyping showed single heterozygous case (unaffected mother). Variant forms of the MSUD disorder still involve developmental delay and other medical problems if not treated.
In this study, first patient had severe hypoglycemia and very high levels of BCAA, although he was diagnosed early with MSUD and started treatment, yet, he died after diagnosis at the age of 1 month.
The other two patients fed a special low protein diet with leucine-, valine- and isoleucine-free formula. Vitamins B1, B2, B12, and L-carnitine oral drops were also prescribed for those two children. Vitamin B1 (as TPP) enhances the oxidative decarboxylation of branched-chain α-keto acids.
Giving the detailed presentation may help pediatrician in increasing their suspicion for MSUD, helping in early diagnosis and better prognosis for affected MSUD patients in the future; those patients may have a normal outcome if diagnosed and treated at early age.
The new therapeutic approach of L-carnitine shows promising results as it acts as an antioxidant and enhances fatty acid oxidation that improves muscular activity. The use of L-carnitine regimens in our hospital (in a dose: 10 drops twice daily) is considered as adjuvant therapy in patients with MSUD. Also, considering the L-carnitine content of BCAA-free amino acid mixtures that the patients receive, some MSUD patients are amenable for possible L-carnitine deficiency. The presented two MSUD patients showed clinical improvement, including fewer seizures attacks, improved oral intake, and progress in movement response. Those two MSUD patients showed clinical and laboratory improvement that may be due to their clinical presenting manifestation that does not include fetal hypoglycemia; also it is dependent on the BCKAD residual activity.
Follow-up by continuous clinical and biochemical monitoring for BCAAs in the outpatient genetic clinic in Assiut University children hospital is undertaken, as MSUD patients require lifelong dietary restriction and strict monitoring of the BCAAs levels to avoid brain damage.
The MSUD cases have rarely been reported in the upper Egyptian population, so the findings will be highly useful for the future cases of MSUD in the Upper Egyptian population. Finally, the detection of mutations in the upper Egypt patients would facilitate prenatal identification in the at-risk family in the future.
Conclusion
This present study showed that three MSUD patients were diagnosed by both high blood and urinary BCAAs. These patients presented with typical phenotypes of classic MSUD type. Diagnosis of MSUD is initially based on the clinical manifestation and the characteristic maple syrup odor of the urine, together with high urinary and plasma BCAAs analysis. Plasma BCAAs analysis is the most convenient method for diagnosis. Further genetic studies were done for confirming the diagnosis. Early diagnosis and management are life-saving and important in preventing serious complications of the disease.
The diagnosed MSUD patients should have continuous clinical and biochemical strict monitoring of BCAAs levels. They require lifelong dietary restriction plus vitamin B complex and L-carnitine supplements to avoid neurological complications or damage.
Recommendations
The diagnosis of MSUD must be included in the Egyptian newborn screening programs. The recognition of patients at risk in the early first days of life is critical for future prognosis and quality of life for affected patients. Early diagnosis of MSUD has a valuable objective to prevent the complication of MSUD. Confirm the diagnosis of MSUD by amino acid profile in urine and plasma that is done by the amino acid analyzer. Maintenance of the level of BCAAS in the plasma and urine within a normal level is important to the patient with MSUD. This can be achieved by dietary restriction of BCAAs by avoidance of BCAAs-rich foods, using a special milk formula that is free from BCAAs. Continuous monitoring of amino acid profile in patients with MSUD is very important to avoid the serious complications of elevated BCAAS in the plasma. L-carnitine has demonstrated antioxidant activity by reducing free radicals and by enhancing enzymatic activity involved in the defense against reactive species; so it should be added to the treatment protocol. The molecular analysis of patients can provide further assistance to improve the clinical management of MSUD and molecular studies are considered a source of important epidemiological data. Counseling the parents of children who have MSUD is very important. A premarital checkup is very important especially in families with previous history of genetic and metabolic disorders and consanguineous marriages. Prenatal diagnosis of MSUD was successfully performed on the fetus by genetic analysis of the cultured amniotic membranes.
Acknowledgments
We are grateful to Assiut University Children Hospital and the Metabolic and Genetic Disorders Unit, Faculty of Medicine, Assiut University, for their beneficial support.
Funding Statement
Funding None.
Footnotes
Conflict of Interest None declared.
References
- 1.Illsinger S, Schmidt K H, Lücke T, Vaske B, Bohnhorst B, Das A M. Plasma and urine amino acid pattern in preterm infants on enteral nutrition: impact of gestational age. Amino Acids. 2010;38(03):959–972. doi: 10.1007/s00726-009-0305-0. [DOI] [PubMed] [Google Scholar]
- 2.Hou J W, Hwang T L. Different gene preferences of maple syrup urine disease in the aboriginal tribes of Taiwan. Pediatr Neonatol. 2014;55(03):213–217. doi: 10.1016/j.pedneo.2013.09.009. [DOI] [PubMed] [Google Scholar]
- 3.Nellis M M, Kasinski A, Carlson M.Relationship of causative genetic mutations in maple syrup urine disease with their clinical expression Mol Genet Metab 200380(1-2):189–195. [DOI] [PubMed] [Google Scholar]
- 4.Puffenberger E G. Genetic heritage of the Old Order Mennonites of southeastern Pennsylvania. Am J Med Genet C Semin Med Genet. 2003;121C(01):18–31. doi: 10.1002/ajmg.c.20003. [DOI] [PubMed] [Google Scholar]
- 5.Chuang D T, Chuang J L, Wynn R M. Lessons from genetic disorders of branched-chain amino acid metabolism. J Nutr. 2006;136(01):243S–249S. doi: 10.1093/jn/136.1.243S. [DOI] [PubMed] [Google Scholar]
- 6.Hassan F A, El-Mougy F, Sharaf S A. Inborn errors of metabolism detectable by tandem mass spectrometry in Egypt: the first newborn screening pilot study. J Med Screen. 2016;23(03):124–129. doi: 10.1177/0969141315618229. [DOI] [PubMed] [Google Scholar]
- 7.Wang X L, Li C J, Xing Y, Yang Y H, Jia J P. Hypervalinemia and hyperleucine-isoleucinemia caused by mutations in the branched-chain-amino-acid aminotransferase gene. J Inherit Metab Dis. 2015;38(05):855–861. doi: 10.1007/s10545-015-9814-z. [DOI] [PubMed] [Google Scholar]
- 8.Strauss K A, Wardley B, Robinson D. Classical maple syrup urine disease and brain development: principles of management and formula design. Mol Genet Metab. 2010;99(04):333–345. doi: 10.1016/j.ymgme.2009.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lang C H, Lynch C J, Vary T C. BCATm deficiency ameliorates endotoxin-induced decrease in muscle protein synthesis and improves survival in septic mice. Am J Physiol Regul Integr Comp Physiol. 2010;299(03):R935–R944. doi: 10.1152/ajpregu.00297.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Blackburn P R, Gass J M, Vairo F PE. Maple syrup urine disease: mechanisms and management. Appl Clin Genet. 2017;10:57–66. doi: 10.2147/TACG.S125962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Liu G, Ma D, Hu P. A novel whole gene deletion of BCKDHB by Alu-mediated non-allelic recombination in a Chinese patient with maple syrup urine disease. Front Genet. 2018;9:145. doi: 10.3389/fgene.2018.00145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Han B, Han B, Guo B, Liu Y, Cao Z. Two novel mutations in the BCKDHB gene that cause maple syrup urine disease. Pediatr Neonatol. 2018;59(05):515–519. doi: 10.1016/j.pedneo.2018.01.006. [DOI] [PubMed] [Google Scholar]
- 13.van Calcar S. Nutrition management of maple syrup urine disease. Nutrition Management of Inherited Metabolic Diseases J. 2015:173–183. [Google Scholar]
- 14.Knerr I, Weinhold N, Vockley J, Gibson K M. Advances and challenges in the treatment of branched-chain amino/keto acid metabolic defects. J Inherit Metab Dis. 2012;35(01):29–40. doi: 10.1007/s10545-010-9269-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Safdarian E, Galehdari H, Jafarian V. A novel mutation in the BCKDHB gene causes in an Iranian child classic maple syrup urine disease. Zahedan J Res Med Sci. 2016;18(10):e3399. doi: 10.17795/zjrms-3399. [DOI] [Google Scholar]