Tacrolimus (FK506) treatment protects allergen‐, IL‐5‐ and IL‐13‐induced mucosal eosinophilia

Hemanth Kumar Kandikattu; Sathisha Upparahalli Venkateshaiah; Alok Kumar Verma; Anil Mishra

doi:10.1111/imm.13314

. 2021 Feb 28;163(2):220–235. doi: 10.1111/imm.13314

Tacrolimus (FK506) treatment protects allergen‐, IL‐5‐ and IL‐13‐induced mucosal eosinophilia

Hemanth Kumar Kandikattu ¹, Sathisha Upparahalli Venkateshaiah ¹, Alok Kumar Verma ¹, Anil Mishra ^1,^✉

PMCID: PMC8114213 PMID: 33512727

Summary

Eosinophils are a common clinical feature associated with chronic allergic diseases, and elemental diets, systemic steroids, anti‐IL‐5 and anti‐IL‐13 treatment have shown some therapeutic promise. Herein, we present evidence that pre‐ and post‐intraperitoneal administration of tacrolimus (FK506) is very effective in reducing CCR3/Siglec‐F⁺ eosinophils in Aspergillus‐challenged asthma and EoE, CD2‐IL‐5 induced global eosinophilia, and DOX regulated IL‐13‐induced asthma. We used flow cytometry and anti‐major basic protein (MBP) immunostaining to examine eosinophils in the spleen, bone marrow, BALF, lung, oesophagus and intestine. Additionally, we also performed ELISA and Western blot analyses to show that tacrolimus treatment also reduces the levels of eosinophil‐specific cytokines IL‐4, IL‐5, IL‐13 and TGF‐β, eosinophil‐specific chemokines Eotaxin‐1 and Eotaxin‐2, and progenitors of target RCAN1 mRNA and protein levels. Additionally, the current investigations also show that the TGF‐β‐mediated oesophageal and lung fibrosis is also reduced in Aspergillus‐challenged, CD2‐IL‐5 transgenic and DOX‐responsive IL‐13 mice. Mechanistically, we show that tacrolimus in vitro treatment inhibited bone marrow‐derived eosinophil proliferation and viability by promoting eosinophil apoptosis that may be associated with downregulation of RCAN1. Taken together, we provide in vivo and in vitro evidence that tacrolimus ameliorates eosinophil levels and associated pathogenesis in allergen‐, IL‐5‐ and IL‐13‐induced EoE, EG and asthma pathogenesis. Considering tacrolimus side‐effects and reactivity to several other drugs, we propose the topical use of tacrolimus for paediatric and low‐dose oral for adult patients as a novel therapeutic strategy for the clinical trial to reduce mucosal eosinophilia first in steroid‐refractory or elemental diet non‐responsive adult EoE, EG and asthma patients.

Keywords: asthma, EG, EOE, fibrosis; tacrolimus, RCAN1

Summarized schematic representation of mechanistic pathway operational in tacrolimus (FK506) treatment in protecting the allergen‐, IL‐5‐ and IL‐13‐induced blood and tissue eosinophilia by inhibiting the regulator of calcineurin (RCAN)1 in experimental models. RCAN1 is a novel contributor involved in the development of eosinophil‐mediated allergic diseases through the regulation of eosinophil progenitor production.

graphic file with name IMM-163-220-g007.jpg

Abbreviations

α‐SMA: alpha‐smooth muscle actin
A. fumigatus: Aspergillus fumigatus
B220: B‐cell isoform of 220 kDa
BALF: bronchoalveolar lavage fluid
CCR3: C‐C motif chemokine receptor 3
CD: cluster of differentiation
DOX: doxycycline
EC: eosinophilic colitis
EoE: eosinophilic oesophagitis
EG: eosinophilic gastroenteritis
IL: interleukin
MBP: major basic protein
RCAN1: regulator of calcineurin 1
Siglec‐F: sialic acid‐binding Ig‐like lectin‐F
TGF‐β: transforming growth factor‐beta

Introduction

Eosinophils are associated with a variety of allergic diseases including asthma, eosinophilic oesophagitis (EoE), eosinophilic gastroenteritis (EG) and eosinophilic colitis (EC). ¹ , ² , ³ , ⁴ Several cytokines are implicated in promoting blood and mucosal eosinophilia in allergic diseases, but among the most critical cytokines implicated in disease pathogenesis are IL‐5 ⁵ and IL‐13 ⁶ . IL‐5 is a differentiation, growth and survival factor for eosinophils, and IL‐5 regulates IL‐13 to further enhance disease pathogenesis. ⁷ , ⁸ , ⁹

Current therapies involve elemental diet, systemic and topical corticosteroids, and humanized anti‐IL‐5 and IL‐13 monoclonal antibody; ¹⁰ , ¹¹ however, these therapies are yet not proven to reduce tissue eosinophilia in lung‐ or eosinophil‐associated gastrointestinal disorders. An elimination diet that excludes several foods such as milk, wheat, egg, soy, peanuts, tree nuts, fish and shellfish, and includes amino acids is sometimes used for management of EoE, EG and EC. ¹² However, these elimination diets are difficult to manage for a patient’s entire lifetime. Anti‐IL‐5 and anti‐IL‐13 therapy show some effectiveness in reducing eosinophilic asthma, but yet not proven its effectiveness in EoE and EG patients. ¹³ , ¹⁴ As anti‐IL‐5 reduces global eosinophils, it is possible that patients are prone to parasite infection and compromised innate immunity due to the absence of residing eosinophils. ¹⁵

Tacrolimus is the most common allograft rejection drug used in kidney, liver and heart transplantations and possesses immunomodulatory and anti‐inflammatory properties; ¹⁶ but has some side‐effects such as constipation, nausea, loss of appetite and headache along with immune suppression and reactions with several immune cells. ¹⁷ , ¹⁸ Mechanistically, tacrolimus is an inhibitor of the regulator of calcineurin (RCAN), which is involved in the proliferation of myeloid cell precursors. ¹⁹ RCAN1 also represents a novel contributor to the development of eosinophil‐mediated allergic diseases through the regulation of eosinophil progenitor production. ²⁰ Therefore, we hypothesized that tacrolimus may be useful in the treatment of chronic mucosal eosinophils associated with allergic diseases. Herein, we present data indicating that indeed tacrolimus pre‐ and post‐treatment significantly reduces allergen‐, IL‐5‐ and IL‐13‐induced bone marrow, spleen, BALF and tissue eosinophilia in a murine model of allergic diseases. Accordingly, we propose that tacrolimus should be considered for the treatment of patients on elemental diets, anti‐cytokine non‐responsive therapy and steroid‐refractory therapy; therefore, based on current study we propose double‐blind clinical trial to be conducted to prove the efficacy of tacrolimus as a novel treatment strategy for adult asthma, EoE and EG.

Materials and methods

Mice

CD2‐IL‐5 transgenic mice and CC10‐IL‐13 bitransgenic mice were provided by Marc Rothenberg, MD, PhD (Cincinnati Children’s Hospital Medical Center, Cincinnati OH), and the mice were bred in our facility. Specific pathogen‐free wild‐type BALB/c mice (8–10 weeks old) were obtained from the Jackson Laboratory (Bar Harbor, ME). Tacrolimus was given i.p. at 1 mg/kg body weight dose as shown in schematics in Figs 1a, 5a, 6a and 7a. The Tulane Institutional Animal Care and Use Committee approved the animal protocols that were used in accordance with the National Institute of Health guidelines. These transgenic mouse lines have all been used previously in our laboratory and are housed at our facility.

Tacrolimus pretreatment inhibits *Aspergillus fumigatus* challenge‐induced lung and oesophageal eosinophilia. (A) The *A. fumigatus* challenge and tacrolimus treatment protocol is presented by the schematic diagram. (B) Gating strategy and analysis of BALF, bone marrow and spleen eosinophils. (B–E) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ eosinophils analysed by flow cytometry. (B‐i) BALF cell population on SSC and FSC. (B‐ii) Live cells were selected and gated. (B‐iii) CCR3 and Siglec‐F⁺ BALF eosinophils were analysed based on isotype‐matched anti‐IgG controls. (B‐iv) CCR3 and Siglec‐F⁺ BALF eosinophils. (C‐i) CCR3 and Siglec‐F⁺ double‐positive BALF eosinophils in *A. fumigatus‐*challenged mice. (C‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ BALF eosinophils. (C‐iii) BALF CCR3 and Siglec‐F⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment. (D‐i) *A. fumigatus* challenge induces CCR3 and Siglec‐F⁺ eosinophils in bone marrow. (D‐ii) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced CCR3 and Siglec‐F⁺ eosinophils in the bone marrow. (D‐iii) Bone marrow CCR3 and Siglec‐F⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment. (E‐i) *A. fumigatus* challenge induces CCR3 and Siglec‐F⁺ eosinophils in spleen. (E‐ii) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced CCR3 and Siglec‐F⁺ eosinophils in the spleen. (E‐iii) Spleen CCR3 and Siglec‐F⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment. (F‐i) Oesophageal MBP⁺ eosinophils in vehicle‐challenged BALB/c mice. (F‐ii) *A. fumigatus* challenge induces MBP⁺ eosinophils in the oesophagus of BALB/c mice. (F‐iii) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced MBP⁺ eosinophils in the oesophagus of BALB/c mice. (F‐iv) Oesophageal MBP⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment in BALB/c mice. Arrows indicated anti‐MBP+ eosinophils. The data represent the means ± SD, n = 8 mice/group. (G) Tacrolimus treatment inhibits *A. fumigatus ‐*induced RCAN1 protein expression in BALB/c mouse lung tissues. (H) RCAN1 fold change normalized to GAPDH analysed by NIH ImageJ software. Data are expressed as mean ± SD. n = 3–8 mice/group. *P < 0·05, **P < 0·001 *** or ###P < 0·0001. Symbols # represent *A. fumigatus* versus vehicle and * tacrolimus + *A. fumigatus* versus *A. fumigatus*. All photomicrographs are 400 × of original magnification.

Spleen, bone marrow and BALF cell isolation for flow cytometry analysis

Mouse spleen was excised and thoroughly rinsed with phosphate‐buffered saline (PBS), pH 7·2. Single cells were isolated and filtered through a 70‐µm cell strainer (BD Falcon, Mississauga, Canada). Similarly, bone marrow cells were also isolated from the mouse femur. The cells were centrifuged, and red blood cells were removed from the cell pellet using RBC lysis buffer (Sigma, St. Louis, MO). Bronchoalveolar lavage cells were collected as described earlier. ²¹ , ²²

Antibodies and flow cytometry analysis

The total population of the isolated spleen, BALF and bone marrow cells were stained with cell surface‐specific antibodies for eosinophils, macrophages, T cells and B cells by flow cytometry analysis. The following antibodies were used for specific antigen analysis: anti‐CCR3, and anti‐Siglec‐F, anti‐F4/80, anti‐CD3, anti‐CD4, anti‐CD8 and anti‐B220 with their respective isotype controls, obtained from eBioscience. The cells were incubated for the specific antigens with the required combination of antibodies at 4°C for 45 min followed by two washes. Flow cytometry analysis was performed using a LSRII (BD Biosciences), Novocyte (ACEA Biosciences) and data was analyzed using FlowJo software (Ashland, OR Systems, Minneapolis, MN).

Tissue eosinophil analysis

Mouse oesophageal, lung and intestine tissues were fixed with 4% paraformaldehyde and embedded in paraffin using standard techniques and cut into 5‐μm sections. The oesophagus, lung and intestine were immunostained with antiserum against mouse anti‐major basic protein (MBP), as previously described. ⁴ , ²³ The anti‐MBP was purchased from Dr. Lee’s laboratory, Mayo Clinic, Scottsdale, AZ, USA.

Quantification of eosinophils

Eosinophils were quantified by counting the anti‐MBP‐positive cells in the oesophageal, lung and intestinal tissues. Eosinophil numbers and area of tissue section were measured and calculated with the assistance of digital morphometric analysis (Lumenera Corporation, Infinity Analyze 6·1.0). The tissue sections were taken from the same position in each set of mice, and at least four random sections per mouse were analysed for eosinophil levels, expressed as eosinophils/mm² as described earlier. ²¹ , ²⁴

Tissue mast cell analysis

The 5‐μm sections of paraffin‐embedded oesophageal tissues were deparaffinized and stained with chloroacetate esterase staining (Sigma‐Aldrich) and detected by light microscopy. A total of four to five high‐power fields in each oesophagus were measured for the pink‐stained mast cells and calculated with the assistance of digital morphometric analysis (Luminera Corporation, Infinity Analyze 6·1.0), and expressed as mast cells/mm² as described previously. ²⁵

Cytokine analyses

IL‐5, IL‐13 and TGF‐β protein concentrations in the lung homogenates of mice were quantified by using a DuoSet Enzyme‐Linked Immunosorbent Assay (ELISA) Development Kit (eBioscience).

Tissue collagen analysis

Collagen staining was performed on tissue sections using Masson's trichrome staining method (Polyscientific Research, Bay Shore, NY) for the detection of collagen fibres according to the manufacturer's recommendations. ²⁶ , ²⁷

RNA isolation and quantitative transcript analysis by polymerase chain reaction (qPCR)

RNA was isolated from the lung tissues by the TRIZOL method. RNA samples (500 ng) were subjected to reverse transcription using Bioscript reverse transcriptase (Bio‐Rad, Hercules, CA, USA) according to the manufacturer's instructions. IL‐4, IL‐5, IL‐13, Eotaxin‐1 and Eotaxin‐2 levels were quantified using gene‐specific primers and real‐time PCR (IQ5, Bio‐Rad). The primers used in the study were as follows: IL‐4—F 5′‐CCTCACAGCAACGAAGA ACA‐3′, R 5′‐ATCGAAAAGCCCGAAAGAGT‐3′; IL‐5—F 5′‐TCCCATGAGCACAGTGGTGAAAG‐3′, R 5′‐CACAGTACCCCCACGGACAGTTT‐3′; IL‐13—F 5′‐CATGGCGCTCTGGGTGACTG‐3′, R 5′‐CGGCCAGGTCCACACTCCATAC‐3′; Eotaxin‐1—F 5′‐GGCTCACCCAGGCTCCATCC‐3′, R 5′‐TTTGGTCCAGGTGCTTTGTGG‐3′; and Eotaxin‐2—F 5′‐GTGATGAAGATGACCCCTGCCTT‐3′, R 5′‐CTCCTTCTCCTGGTAGC CTGC‐3′. All gene expression data were normalized to 18S amplified from the same cDNA mix and expressed as relative gene expression as described earlier. ²¹

Immunoblot analysis

Lung tissue homogenates were electrophoresed in 4–12% SDS–polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose membrane. To reduce non‐specific binding, membranes were blocked with 5% non‐fat dry milk in Tris‐buffered saline with 0·1% Tween‐20 (TBST). Immunoblotting was performed using a specific anti‐RCAN1 antibody (Millipore Sigma) followed by an anti‐rabbit secondary antibody conjugated with horseradish peroxides (Cell Signaling Technology). The signal was developed using Clarity Max ECL Substrate (Bio‐Rad) according to the manufacturer’s instructions. Equal loading was further verified by immunoblotting the same membrane with GAPDH (Cell Signaling Technology) using a similar protocol following stripping with Restore Western Blot Stripping Buffer (Thermo Fisher Scientific). The band intensity was measured using NIH ImageJ software. ²²

Immunofluorescence analysis

The oesophagus and lung sections were incubated with anti‐collagen Iα1 antibody (Santa Cruz Biotechnology) (1 h, RT) and washed (PBST, 4×, 5 min each/PBS, 1×, 5 min), and then incubated with biotinylated anti‐mouse IgG (Vector Laboratories, CA, USA), washed (PBST, 4×, 5 min each/PBS, 1×, 5 min) and incubated with Streptavidin, Alexa Fluor 594 (1 h, RT). The sections were also incubated with anti‐collagen IIIα1 antibody (Abcam) and α‐SMA antibody (Santa Cruz Biotechnology) (1 h, RT) and washed (PBST, 4×, 5 min each/PBS, 1×, 5 min), and then incubated with donkey anti‐rabbit IgG, Alexa Fluor™ 488 conjugate (1 h, RT), washed (PBST, 4×, 5 min each/PBS, 1×, 5 min) and mounted with ProLong™ Gold Antifade Mountant with DAPI (Thermo Fisher Scientific).

In vitro bone marrow eosinophil precursors for the development and proliferation analysis

Bone marrow cells were collected from the femurs and tibiae of BALB/c mice by flushing the cut opened bones with IMDM (Invitrogen) as described earlier. ²¹ RBCs were lysed using an RBC lysing buffer (Sigma‐Aldrich). The RBCs' lysed bone marrow cells were washed with PBS containing 0·1% BSA, and low‐density eosinophil bone marrow (LDEBM) cell precursors obtained via Percoll density gradient were cultured at 10⁶/ml in a medium containing RPMI‐1640 (Invitrogen) with 20% FBS (R&D systems), 100 IU/ml penicillin and 10 µg/ml streptomycin, 2 mM glutamine, 25 mM HEPES and 1 × non‐essential amino acids and 1 mM sodium pyruvate (Life Technologies), and 50 µ β‐ME (Sigma‐Aldrich) supplemented with 100 ng/ml stem cell factor (SCF; PeproTech) and 100 ng/ml FLT3 ligand (FLT3‐L; PeproTech) from days 0 to 4. On day 4, the medium containing SCF and FLT3‐L was replaced with a medium containing 10 ng/ml mouse rIL‐5 (R&D Systems) as per the method described earlier. ²⁸ On day 7, all non‐adherent cells were removed and supplemented with 10 ng/ml rIL‐5. The medium with rIL‐5 was replaced on the 3rd day, and the cells were treated with or without tacrolimus at (10 ng/ml) for 4 days. A flow cytometry using 5 × 10⁵ cells was performed for eosinophil analysis following staining the cells with a combination of anti‐CCR3 and anti‐Siglec‐F for measuring the tacrolimus‐induced proliferation.

Analysis of tacrolimus‐induced eosinophil size, shape change and apoptosis

Splenocytes were collected from the CD2IL‐5 Tg mice, and RBCs were lysed using an RBC lysing buffer (Sigma‐Aldrich). The RBCs' lysed splenocytes were washed with RPMI medium, and the cells were cultured in a medium containing RPMI‐1640 (Invitrogen) with 10% FBS, 100 IU/ml penicillin and 10 µg/ml streptomycin, at 10⁶/ml. On the 2nd day, the cells were treated with or without tacrolimus at (10 ng/ml) for 24 h. A flow cytometry using 5 × 10⁵ cells was performed for eosinophil analysis following the staining of the cells with a combination of anti‐CCR3 and anti‐Siglec‐F antibodies and the apoptosis was analysed using the Annexin‐V kit (eBioscience).

Statistical analysis

All data were analysed using the GraphPad Prism 5·0 software (GraphPad, San Diego, CA). A two‐tailed unpaired t‐test was used for calculating the statistically significant differences between the means of two independent groups. One‐way analysis of variance (ANOVA) followed by Tukey's post hoc test was used for calculating the statistically significant differences between the means of three or more independent groups.

Results

Analysis of bone marrow, spleen, BALF and tissue eosinophilia in tacrolimus (FK506)‐treated A. fumigatus‐challenged mice

A. fumigatus‐challenged mice are known to develop eosinophilic asthma and EoE; ⁴ therefore, we tested the hypothesis whether tacrolimus treatment protects A. fumigatus‐induced eosinophilia in mice. Accordingly, we examined the levels of CCR3⁺Siglec‐F⁺ eosinophils in bone marrow, spleen and bronchoalveolar lavage fluid (BALF) of tacrolimus‐treated and untreated A. fumigatus‐challenged mice by performing flow cytometry analysis using anti‐CCR3 and anti‐Siglec‐F antibodies. The A. fumigatus challenge and treatment protocol is presented in Fig. 1A. We show that tacrolimus treatment inhibits A. fumigatus‐induced CCR3 and Siglec‐F double‐positive eosinophils in BALF, bone marrow and spleen of mice. Flow cytometry analysis following the strategy of selecting first the live cells from the total cells and then analysing CCR3⁺Siglec‐F⁺ eosinophils was based on anti‐IgG isotype‐matched respective controls (Fig. 1B i–iv). A significantly decreased number of CCR3 + Siglec‐F⁺ eosinophils were observed in the BALF (Fig. 1C i–iii), bone marrow (Fig. 1D i–iii) and spleen (Fig. 1D i–iii) of A. fumigatus‐challenged and tacrolimus‐treated mice compared with A. fumigatus alone‐challenged mice. Data are presented mean ± SD, n = 8.

Further, we performed anti‐MBP tissue immunostaining to analyse the oesophageal and lung eosinophilia in both A. fumigatus alone‐challenged and A. fumigatus‐challenged tacrolimus‐treated mice. Significantly reduced eosinophil levels were also observed in oesophageal (Fig. 1F i‐iv) and lung (Fig. S1A i–iv) tissue sections in the A. fumigatus‐challenged and tacrolimus‐treated mice compared with A. fumigatus alone‐challenged mice. Additionally, tacrolimus is an inhibitor of the regulator of calcineurin (RCAN) and is involved in the maintenance and proliferation of myeloid cells including eosinophil precursors. ²⁰ Therefore, we next examine whether A. fumigatus‐induced eosinophilia regulated RCAN1 activation. Accordingly, a Western blot analysis was performed to examine the RCAN1 protein levels in A. fumigatus with vehicle challenge and A. fumigatus challenge with tacrolimus‐treated mice. The analysis detected induced RCAN1 protein expression in A. fumigatus with vehicle‐challenged lung tissue samples, whereas A. fumigatus challenged with tacrolimus‐treated lung samples showed downregulated RCAN1 protein expression (Fig. 1G). The expression of RCAN1 normalized to GAPDH showed a significant reduction in the protein expression levels of RCAN1 in tacrolimus‐treated mice compared with A. fumigatus with vehicle‐treated mice (Fig. 1h).

Analysis of other immune cells in the spleen, BALF and tissues in tacrolimus (FK506)‐treated A. fumigatus‐challenged asthmatic mice

To analyse the effect of tacrolimus on other immune cell populations, we performed chloroacetate esterase analysis for oesophageal mast cells, and flow cytometry analysis for BALF macrophages, and T and B cells in the spleen of allergen‐challenged mice. Oesophageal tissue analysis showed reduced mast cell number in tacrolimus‐treated and A. fumigatus‐challenged mice compared with only A. fumigatus‐challenged mice; however, no to very few mast cells were detected in saline‐treated mice (Fig. 2A i–v). Similarly, we also observed that tacrolimus treatment also inhibits F4/80⁺ macrophages in BALF of A. fumigatus‐challenged mice (Fig. 2B i–iii). These reduced numbers of macrophages directly affect the capability of Th2 cytokine production in the lungs of A. fumigatus‐challenged mice. Macrophages are the antigen‐presenting cells that activate Th2 cells and reduce macrophages that affect Th2 cell activation and production of Th2 cytokines. Further, a number of anti‐CD3⁺ T cells and anti‐B220⁺ B cells were observed comparable in the spleen of allergen challenge and tacrolimus‐treated allergen‐challenged mice (Fig. 2C i–iii). Notably, T‐cell number is not changed but its capability of producing Th2 cytokines is affected because of the reduced number of lung macrophages in tacrolimus‐treated mice.

Tacrolimus treatment affects the number of several other immune cells. (A) Tacrolimus treatment inhibits oesophageal mast cells analysed by chloroacetate esterase staining. (A‐i) Mast cells in the oesophagus of vehicle‐treated mice. (A‐ii) Induced mast cells in *A. fumigatus ‐*treated mice. (A‐iii) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced mast cells in the oesophagus. (A‐iv) Oesophageal mast cells number with *A. fumigatus* alone and *A. fumigatus* and Tacrolimus treatment. Arrows indicated mast cells. (B) Tacrolimus treatment inhibits Siglec‐F/F4/80⁺ BALF‐activated macrophages analysed by flow cytometry. (B‐i) *A. fumigatus* challenge induces Siglec‐F/F4/80⁺ macrophages in BALF. (B‐ii) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced Siglec‐F/F4/80⁺ macrophages in BALF. (B‐iii) BALF F4/80⁺ macrophages number with *A. fumigatus* alone and *A. fumigatus* and Tacrolimus treatment. (C) No change in CD3, B220 cell number in the spleen of *A. fumigatus* alone (C‐i) and *A. fumigatus* and tacrolimus treatment (C‐ii). (C‐iii) Spleen CD3⁺ T and B220⁺ B cells number with *A. fumigatus* alone and *A. fumigatus* and Tacrolimus treatment. The data represent the means ± SD, n = 8 mice/group. *P < 0·05 *** or ### P < 0·0001. Symbols # represent *A. fumigatus* versus vehicle and * tacrolimus + *A. fumigatus* versus *A. fumigatus* + Vehicle.

Analysis of eosinophil‐associated pro‐inflammatory and profibrotic cytokines in A. fumigatus‐challenged and tacrolimus‐treated mice

The pro‐inflammatory Th2 cytokines IL‐5 and IL‐13, profibrotic TGF‐β and chemokines Eotaxin‐1 and Eotaxin‐2 are the most critical molecules that are implicated in promoting eosinophil‐associated asthma and EoE pathogenesis. ²⁹ , ³⁰ Therefore, we further examined whether tacrolimus inhibits the function of Th2 cells. Accordingly, we first examined the transcript levels of IL‐4, IL‐5, IL‐13 and eosinophil‐specific chemokine Eotaxin‐1 and Eotaxin‐2 by performing the real‐time PCR analysis in the lung samples. An induced mRNA level of IL‐4, IL‐5, IL‐13, Eotaxin‐1 and Eotaxin‐2 in the lung of allergen‐challenged mice was significantly reduced in the samples of tacrolimus‐treated and A. fumigatus‐challenged mice (Fig. 3A). Further, we also examine the protein levels of IL‐5, IL‐13 and TGF‐β by performing the ELISA analysis. We found that A. fumigatus with vehicle challenge induced IL‐5, IL‐13 and TGF‐β protein levels in the lung, which was further reduced in the samples of tacrolimus‐treated and A. fumigatus‐challenged mice (Fig. 3B,C).

Tacrolimus treatment alters transcripts and protein levels of IL‐4, IL‐5, IL‐13 and TGF‐β levels in *A. fumigatus* ‐challenged BALB/c mouse lung tissues. (A) Tacrolimus treatment inhibits *A. fumigatus* ‐induced Th2 cytokine and Eotaxin‐1 and Eotaxin‐2 levels in BALB/c mouse lung tissues. (B) Tacrolimus treatment inhibits *A. fumigatus ‐*induced IL‐5 and IL‐13 cytokine levels in BALB/c mouse lung tissues analysed by ELISA. (C) Tacrolimus treatment inhibits *A. fumigatus*‐induced TGF‐β cytokine levels in BALB/c mouse lung tissues. n = 8 mice/group. The data represent the means ± SD* or #P < 0·05, ** or ## P < 0·001, *** or ### P < 0·0001. Symbols # represent *A. fumigatus* versus vehicle and * tacrolimus + *A. fumigatus* versus *A. fumigatus*. (D) Tacrolimus treatment inhibits IL‐5‐induced bone marrow precursor eosinophil proliferation and viability analysed by flow cytometry. (D‐i) rIL‐5 differentiated CCR3 and Siglec‐F⁺ bone marrow eosinophils with vehicle treatment. (D‐ii) rIL‐5 differentiated CCR3 and Siglec‐F⁺ bone marrow eosinophils with tacrolimus treatment. (D‐iii) Bone marrow CCR3 and Siglec‐F⁺ eosinophils number with vehicle alone or tacrolimus treatment. (E and F) Eosinophils obtained from CD2‐IL‐5 Tg mice were examined for eosinophil shape change and apoptosis following *in vitro* tacrolimus (10 ng/ml) treatment for 24 hrs. The data indicate tacrolimus‐treated eosinophils show low MFI compared with vehicle‐treated eosinophils (E), which is further confirmed by staining the eosinophils with apoptosis marker Annexin‐V that showed a similar low MFI in Annexin‐V‐stained tacrolimus‐treated eosinophils (F). The data represent the means ± SD, n = 4. * P < 0·05. Symbol * represents tacrolimus + rIL‐5 versus rIL‐5 + vehicle.

Tacrolimus inhibits IL‐5‐responsive bone marrow eosinophil proliferation and viability

Tacrolimus treatment inhibits rIL‐5‐induced generation of bone marrow precursor to eosinophil generation, proliferation and viability (Fig. 3D). The flow cytometry analysis shows that rIL‐5‐differentiated CCR3⁺Siglec‐F⁺ eosinophil number decreases in rIL‐5‐differentiated bone marrow eosinophils treated with 10 ng/ml tacrolimus (Fig. 3D i‐ii). The data indicate that tacrolimus treatment inhibits both proliferation and viability of eosinophils (Fig. 3D iii).

Tacrolimus treatment promotes eosinophil apoptosis by the process of reducing eosinophil shape and size

Eosinophils obtained from CD2‐IL‐5Tg mice were examined for size and shape change following in vitro tacrolimus (10 ng/ml) treatment for 24 h. The flow cytometry analysis of tacrolimus‐treated eosinophils shows a reduced mean fluorescence intensity (Δ MFI) of eosinophils compared with non‐treated eosinophils (Fig. 3E), indicating tacrolimus treatment reduces the size and shape of eosinophils. This prompted us to examine whether tacrolimus treatment provides a signal to the eosinophils for apoptosis. Therefore, we next stained the eosinophils with apoptosis marker Annexin‐V. A similar reduced Δ MFI was observed in Annexin‐V‐stained tacrolimus‐treated eosinophils compared with non‐treated eosinophils (Fig. 3F). The analysis is consistent with the change in shape and size that is associated with the ongoing process in eosinophil apoptosis in response to tacrolimus treatment.

Analysis of tissue collagen accumulation in A. fumigatus‐challenged and tacrolimus‐treated mice

Eosinophils are the source of TGF‐β that stimulates collagen synthesis, and induced collagen accumulation is reported in eosinophilic asthma and EoE pathogenesis. ³¹ Therefore, we next examined whether tacrolimus treatment inhibits eosinophil‐induced TGF‐β‐mediated collagen accumulation in tacrolimus‐treated mice. Accordingly, we examined the levels of collagen accumulation in the oesophagus and lung of A. fumigatus‐challenged and tacrolimus‐treated mice. The analysis showed significantly induced oesophageal collagen between vehicle and A. fumigatus‐challenged tacrolimus‐treated mice, whereas reduced collagen accumulation was observed in the oesophagus of A. fumigatus‐challenged and tacrolimus‐treated mice compared with the A. fumigatus with vehicle‐challenged mice by performing Masson’s trichrome staining analysis (Fig. 4A i–iii). A similar trend in the reduction of collagen Iα1 (Fig. 4B i–iii), collagen IIIα1 (Fig. 4C i–iii) and α‐SMA (Fig. 4D i‐iii) was observed following antibody immunofluorescence staining of oesophageal tissues in the tacrolimus‐treated A. fumigatus‐challenged mice compared with vehicle‐treated A. fumigatus‐challenged mice. (All photomicrographs are × 400 of original magnification, n = 8.) Further, we examined collagen accumulation and the induction of collagen Iα1, collagen IIIα1 and α‐SMA in the experimental A. fumigatus‐induced mouse model of asthma in the lung following similar analyses. Lungs of A. fumigatus‐challenged tacrolimus‐treated mice showed significantly reduced collagen accumulation (Fig. S1B i–iii), collagen Iα1 (Fig. S1C i–iii), collagen IIIα1 (Fig. S1D i–iii) and α‐SMA (Fig. S1E i–iii) in the lung tissue sections compared with vehicle‐treated A. fumigatus‐challenged mice. (All photomicrographs are × 100 and × 400 of original magnification, n = 8.)

Analysis of fibrosis in oesophageal tissues of *A. fumigatus*‐challenged BALB/c mice. (A) Tacrolimus treatment inhibits *A. fumigatus* ‐induced collagen levels in BALB/c mouse (i, ii, iii) oesophageal tissues analysed by Masson trichrome staining. (B) Tacrolimus treatment inhibits *A. fumigatus*‐induced ColIα1 protein expression in BALB/c mouse oesophageal tissues analysed by immunofluorescence. (i, ii, iii). (C) Tacrolimus treatment inhibits *A. fumigatus*‐induced ColIIIα1 protein expression in BALB/c mouse oesophageal tissues analysed by immunofluorescence (i, ii, iii). (D) Tacrolimus treatment inhibits *A. fumigatus*‐induced α‐SMA protein expression in BALB/c mouse oesophageal tissues analysed by immunofluorescence (i, ii, iii). n = 8 mice/group. All photomicrographs are 400 × of original magnification.

Analysis of bone marrow, BALF and spleen T cells and B cells in A. fumigatus‐challenged post‐tacrolimus‐treated mice

To assess the clinical significance of tacrolimus effect in asthmatic mice, we further examined the tacrolimus post‐treatment effect on A. fumigatus challenge‐induced bone marrow, BALF and tissue eosinophilia. The analysis indicated tacrolimus similar inhibitory effect in A. fumigatus challenge‐induced eosinophils in bone marrow (Fig. 5B ii–iii) and BALF (Fig. 5C ii–iii). The number of CCR3⁺Siglec‐F⁺ eosinophils significantly reduced in A. fumigatus‐challenged and post‐tacrolimus‐treated mice compared with only A. fumigatus‐challenged mice in bone marrow (Fig. 5B iv) and BALF (Fig. 5C iv). A similar effect was observed in tissue eosinophilia in A. fumigatus‐ and tacrolimus‐treated mice. Tacrolimus post‐treatment significantly inhibits A. fumigatus challenge‐induced anti‐MBP⁺ eosinophils in the oesophagus (Fig. 5D i–v) and lung (Fig. 5E i–v) compared with vehicle‐ and tacrolimus‐treated mice.

*A. fumigatus*‐induced bone marrow, lung and oesophageal eosinophils are protected by post‐tacrolimus treatment. (A) The *A. fumigatus* challenge and tacrolimus post‐treatment protocol is presented by the schematic diagram. (B–E) Tacrolimus post‐treatment inhibits CCR3 and Siglec‐F⁺ bone marrow, and BALF eosinophils were analysed by flow cytometry, and MBP‐positive oesophageal and lung eosinophils were analysed by immunohistochemistry. (B‐i) Isotype anti‐IgG‐matched control. (B‐ii) *A. fumigatus* challenge induces CCR3 and Siglec‐F⁺ eosinophils in bone marrow. (B‐iii) Tacrolimus post‐treatment inhibits *A. fumigatus* challenge‐induced CCR3 and Siglec‐F⁺ eosinophils in the bone marrow. (B‐iv) Bone marrow CCR3 and Siglec‐F⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and Tacrolimus post‐treatment. (C‐i) Isotype anti‐IgG‐matched control. (C‐ii) *A. fumigatus* challenge induces CCR3 and Siglec‐F⁺ eosinophils in BALF. (C‐iii) Tacrolimus post‐treatment inhibits *A. fumigatus* challenge‐induced CCR3 and Siglec‐F⁺ eosinophils in BALF. (C‐iv) BALF CCR3 and Siglec‐F⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment. (D‐i) Oesophageal MBP⁺ eosinophils in vehicle‐challenged BALB/c mice. (D‐ii) Oesophageal MBP⁺ eosinophils in tacrolimus‐treated BALB/c mice. (D‐iii) *A. fumigatus* challenge induces MBP⁺ eosinophils in the oesophagus of BALB/c mice. (D‐iv) Tacrolimus treatment inhibits *A. fumigatus* c‐hallenge‐induced MBP⁺ eosinophils in the oesophagus of BALB/c mice. (D‐v) Oesophageal MBP⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment in BALB/c mice. (E‐i) Lung MBP⁺ eosinophils in vehicle‐challenged BALB/c mice. (E‐ii) Lung MBP⁺ eosinophils in tacrolimus‐treated BALB/c mice. (E‐iii) *A. fumigatus* challenge induces MBP⁺ eosinophils in lung of BALB/c mice. (E‐iv) Tacrolimus treatment inhibits *A. fumigatus* challenge‐induced MBP⁺ eosinophils in lung of BALB/c mice. (E‐v) Lung MBP⁺ eosinophils number with *A. fumigatus* alone and *A. fumigatus* and tacrolimus treatment in BALB/c mice. Arrows indicated MBP+ eosinophils. The data represent the means ± SD, n = 8 mice/group. * P < 0·05, *** or ### P < 0·0001. Symbols # represent *A. fumigatus* versus vehicle and * tacrolimus + *A. fumigatus* versus *A. fumigatus*. All photomicrographs are 100 × and 400 × of original magnification.

Further, the effect of tacrolimus was analysed in anti‐CD4 + and anti‐CD8⁺ T cells and B220⁺ B cells in A. fumigatus‐challenged mice with or without tacrolimus post‐treatment in the spleen. Tacrolimus treatment showed a comparable number in anti‐CD4⁺, anti‐CD8⁺ T cells (Fig. S2A ii‐iv) and anti‐B220⁺ B cells (Fig. S2B ii‐iv) in the spleen of A. fumigatus‐challenged and post‐tacrolimus‐treated mice.

Analysis of tacrolimus effect on IL‐5‐induced global eosinophilia in CD2‐IL‐5 transgenic mouse condition similar to human hypereosinophilic eosinophilia

We showed that A. fumigatus‐induced IL‐5 levels and tissue eosinophilia are inhibited by tacrolimus treatment in mice. Therefore, we further examined bone marrow, spleen, oesophageal, and intestinal and lung eosinophilia following tacrolimus treatment in CD2 promoter‐driven IL‐5‐overexpressed mice. CD2‐IL‐5 transgenic mice have globally induced eosinophilia. ²⁷ The CCR3⁺Siglec‐F⁺ eosinophils in the bone marrow and spleen of tacrolimus‐treated and vehicle‐treated CD2‐IL‐5 mice were analysed by performing flow cytometry. We show tacrolimus treatment significantly reduces CCR3⁺Siglec‐F⁺eosinophils both in bone marrow (Fig. 6B i–iii) and in spleen (Fig. 6C i–iii) in CD2‐IL‐5 transgenic mice compared with the vehicle‐treated CD2‐IL‐5 transgenic mice.

Tacrolimus treatment inhibits global eosinophilia in CD2‐IL‐5 transgenic mice. (A) The tacrolimus treatment protocol is presented by the schematic diagram. (B‐F) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ bone marrow and spleen eosinophils analysed by flow cytometry and MBP‐positive tissue eosinophils analysed by immunohistochemistry. (B‐i) CCR3 and Siglec‐F⁺ eosinophils in the bone marrow of CD2‐IL‐5Tg mice. (B‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ bone marrow eosinophils in CD2‐IL‐5Tg mice. (B‐iii) Bone marrow CCR3 and Siglec‐F⁺ eosinophils number with vehicle or tacrolimus treatment. (C‐i) CCR3 and Siglec‐F⁺ spleen eosinophils in CD2‐IL‐5Tg mice. (C‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ spleen eosinophils in CD2‐IL‐5Tg mice. (C‐iii) Spleen CCR3 and Siglec‐F⁺ eosinophils number with vehicle alone or tacrolimus treatment. (D‐i) MBP⁺ eosinophils in the oesophagus of vehicle‐challenged CD2‐IL‐5Tg mice. (D‐ii) Tacrolimus treatment inhibits MBP⁺ eosinophils in the oesophagus of CD2‐IL‐5Tg mice. (D‐iii) Oesophageal MBP⁺ eosinophils number with vehicle alone or tacrolimus treatment in CD2‐IL‐5Tg mice. (E‐i) MBP⁺ eosinophils in lung of vehicle‐challenged CD2‐IL‐5Tg mice. (E‐ii) Tacrolimus treatment inhibits MBP⁺ eosinophils in the lung of CD2‐IL‐5Tg mice. (E‐iii) Lung MBP⁺ eosinophils number with vehicle alone or tacrolimus treatment in CD2‐IL‐5Tg mice. (F‐i) MBP⁺ eosinophils in the intestine of vehicle‐challenged CD2‐IL‐5Tg mice. (F‐ii) Tacrolimus treatment inhibits MBP⁺ eosinophils in the intestine of CD2‐IL‐5Tg mice. (F‐iii) Intestine MBP⁺ eosinophils number with vehicle alone or tacrolimus treatment in CD2‐IL‐5 Tg mice. Arrows indicated MBP+ eosinophils. The data represent the means ± SD, n = 8 mice/group. * P < 0·05. Symbol * represents CD2‐IL‐5Tg + tacrolimus versus CD2‐IL‐5Tg vehicle. All photomicrographs are 100 × and 400 × of original magnification.

We also observed a significant reduction in the oesophageal, lung and intestinal eosinophilia in tacrolimus‐treated CD2‐IL‐5 transgenic mice compared with vehicle‐treated CD2‐IL‐5 transgenic mice following anti‐MBP tissue immunostaining and morphometric quantification analysis. The representative analysis is shown for oesophageal eosinophils (Fig. 6D i–iii), lung eosinophils (Fig. 6E i–iii) and intestinal eosinophils (Fig. 6F i–iii). (All photomicrographs are x 100 × 400 of original magnification; data are expressed as mean ± SD, n = 8). In addition, we examined the levels of collagen accumulation in the oesophagus and lung of CD2‐IL‐5 transgenic mice, with or without tacrolimus treatment. Masson’s trichrome analysis showed collagen accumulation in CD2‐IL‐5 transgenic mice compared with the vehicle‐treated wild‐type mice, whereas significantly reduced collagen accumulation was observed in the oesophagus of tacrolimus‐treated CD2‐IL‐5 transgenic mice compared with vehicle‐treated CD2‐IL‐5 transgenic mice (Fig. S3A i–iii). A similar trend in the reduction of collagen Iα1 (Fig. S3B i–iii ), collagen IIIα1 (Fig. S3C i–iii) and α‐SMA (Fig. S3D i–iii) was observed following antibody immunofluorescence staining of oesophageal tissues in the tacrolimus‐treated CD2‐IL‐5 transgenic mice compared with vehicle‐treated CD2‐IL‐5 transgenic mice (Fig. S3B–D i‐iii). (All photomicrographs are × 400 of original magnification, n = 8.). The induced lung TGF‐β levels in CD2‐IL‐5 transgenic mice were significantly inhibited in tacrolimus‐treated CD2‐IL‐5 transgenic mice (Fig. S4A). Further, we also examined lung collagen accumulation and the induction of collagen Iα1, collagen IIIα1 and α‐SMA in the CD2‐IL‐5 transgenic mice following similar analyses. The lungs of CD2‐IL‐5 mice showed significantly reduced collagen accumulation (Fig. S4B i–iii) and reduced expression of collagen Iα1 (Fig. S4C i–iii), collagen IIIα1 (Fig. S4D i–iii) and α‐SMA (Fig. S4E i–iii) in lung tissue sections compared with vehicle‐treated CD2‐IL‐5 transgenic mice. The data indicate that tacrolimus treatment reduces global eosinophilia in mice (All photomicrographs are x400 of original magnification, n = 8).

Analysis of post‐tacrolimus treatment mucosal eosinophilia in DOX‐exposed lung‐specific CC‐10‐IL‐13 transgenic mice

Earlier, the overexpression of IL‐13 was implicated for promoting experimental asthma and EoE; ²⁴ therefore, we lastly examined whether tacrolimus pretreatment also protected overexpressed IL‐13‐induced experimental EoE and asthma. Accordingly, we examined DOX‐regulated CC10‐IL‐13 transgenic mice following the protocol shown in Fig. 7A . The CCR3⁺Siglec‐F⁺ eosinophils in the bone marrow, spleen and BALF of tacrolimus‐treated or vehicle‐treated DOX food‐exposed CC‐10‐IL‐13 mice were analysed by performing flow cytometry. Tacrolimus treatment significantly reduced CCR3⁺Siglec‐F⁺ eosinophils in the bone marrow (Fig. 7B i–iii), spleen (Fig. 7C i–iii) and BALF (Fig. 7D i–iii) in DOX‐exposed CC10‐IL‐13 mice compared with the vehicle‐treated DOX‐exposed CC10‐IL‐13 mice.

DOX‐regulated lung‐specific IL‐13 overexpression‐induced eosinophilia is restricted by post‐tacrolimus treatment. (A) The tacrolimus treatment protocol is presented by the schematic diagram. (B‐E) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ bone marrow, spleen, BALF and oesophageal eosinophils analysed by flow cytometry and immunohistochemistry. (B‐i) CCR3 and Siglec‐F⁺ bone marrow eosinophils in CC‐10‐IL‐13 mice. (B‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ bone marrow eosinophils in CC‐10‐IL‐13 mice. (B‐iii) Bone marrow CCR3 and Siglec‐F⁺ eosinophils number with vehicle or tacrolimus treatment. (C‐i) CCR3 and Siglec‐F⁺ spleen eosinophils in CC‐10‐IL‐13 mice. (C‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ spleen eosinophils in CC‐10‐IL‐13 mice. (C‐iii) Spleen CCR3 and Siglec‐F⁺ eosinophils number with vehicle or tacrolimus treatment. (D‐i) CCR3 and Siglec‐F⁺ BALF eosinophils in CC‐10‐IL‐13 mice. (D‐ii) Tacrolimus treatment inhibits CCR3 and Siglec‐F⁺ BALF eosinophils in CC‐10‐IL‐13 mice. (D‐iii) BALF CCR3 and Siglec‐F⁺ eosinophils number with vehicle or tacrolimus treatment. (E i–iv). Tacrolimus treatment inhibits MBP⁺ eosinophils in the oesophagus of CC‐10‐IL‐13 mice. (E‐v) Oesophageal MBP⁺ eosinophils number with vehicle alone or tacrolimus treatment with or without DOX food in CC‐10‐IL‐13 Tg mice. Arrows indicated MBP+ eosinophils. ± SD. n = 8 mice/group. The data represent the means ± SD, n = 8 mice/group. * P < 0·05, ** P < 0·001, *** or ### P < 0·0001. Symbols # represent CC10 IL‐13 Tg versus CC10 IL‐13 Tg no‐Dox vehicle and CC10 IL‐13 Tg no‐Dox tacrolimus, and * CC10 IL‐13 Tg + tacrolimus versus CC10 IL‐13 Tg vehicle. All photomicrographs are 100 × and 400 × of original magnification.

We also observed a significant reduction in the oesophageal and lung eosinophilia in tacrolimus‐treated CC10‐IL‐13 mice compared with vehicle‐treated CC10‐IL‐13 mice following anti‐MBP tissue immunostaining and morphometric quantification analyses. The representative analysis is shown for oesophageal eosinophils (Fig. 7E i–v) and lung eosinophils (Fig. S6A i–iv). (All photomicrographs are × 400 of original magnification; data are expressed as mean ± SD, n = 8). Further, we examined the levels of collagen accumulation in the oesophagus and lung of vehicle‐treated DOX‐regulated CC10‐IL‐13 transgenic mice and tacrolimus‐treated DOX‐regulated CC10‐IL‐13 transgenic mice compared with the vehicle‐treated no‐DOX‐given CC10‐IL‐13 transgenic mice. Masson’s trichrome analysis showed collagen accumulation in the oesophagus sections of vehicle‐treated DOX‐regulated CC10‐IL‐13 transgenic mice compared with vehicle‐treated no‐DOX‐given CC10‐IL‐13 transgenic mice (Fig. S5 A i–iii). However, significantly reduced collagen accumulation was observed in the oesophagus of tacrolimus‐treated DOX‐regulated CC10‐IL‐13 transgenic mice compared with the vehicle‐treated DOX‐regulated CC10‐IL‐13 transgenic mice (Fig. S5A i–iii). A similar trend in the reduction of collagen Iα1 (Fig. S5B i–iii), collagen IIIα1 (Fig. S5C i–iii) and α‐SMA (Fig. S5D i–iii) was observed following antibody immunofluorescence staining of oesophageal tissues in tacrolimus‐treated DOX‐regulated CC10‐IL‐13 transgenic mice compared with vehicle‐treated DOX‐regulated CC10‐IL‐13 transgenic mice. (All photomicrographs are × 400 of original magnification, n = 8.) We also examined collagen accumulation and the induction of collagen Iα1, collagen IIIα1 and α‐SMA in the lung tissues of DOX‐regulated CC10‐IL‐13 transgenic mice following similar analyses. Lungs of DOX‐regulated CC10‐IL‐13 transgenic mice showed significantly reduced collagen accumulation (Fig. S6B i–iii), and reduced expression of collagen Iα1 (Fig. S6C i–iii), collagen IIIα1 (Fig. S6D i–iii) and α‐SMA (Fig. S6E i–iii) compared with vehicle‐treated DOX‐regulated CC10‐IL‐13 transgenic mice. The data indicate that tacrolimus treatment reduces IL‐13 overexpression‐induced lung‐specific eosinophilia (All photomicrographs are × 400 of original magnification, n = 8).

Discussion

Recently, basic and clinical studies provided sufficient progress in our understanding to the mechanism operational in eosinophil recruitment to the epithelial, subepithelial and muscular mucosa, ³² , ³³ , ³⁴ , ³⁵ and associated tissue remodelling, including fibrosis. ³⁶ However, there remains a great need for a better mechanistic and therapeutic understanding of the pathobiology of eosinophil‐associated allergic diseases such as asthma, EoE and EG. ³ , ⁴ , ³⁷ To date, the main therapies for EoE, asthma or EG are elemental (amino acid‐based) diets, glucocorticoids and, most recently, anti‐IL‐5 immunotherapy. ³⁸ , ³⁹ , ⁴⁰ , ⁴¹ , ⁴² Although these therapies appear to be effective, not all patients are responsive to treatment. Our current studies show an additional treatment strategy for chronic EoE, EG and asthma using tacrolimus, which is widely used in organ transplant patients and has also been shown effective in some allergic diseases such as conjunctivitis and dermatitis. ⁴³ A report shows that tacrolimus mechanistically reduces disease pathogenesis by suppressing Th1/Th2 activation, mast cell granulation, itching and scratching behaviour in atopic dermatitis. ⁴³ Another report indicated that tacrolimus decreases serum IgE and IL‐5 levels in ovalbumin‐sensitized mice. ⁴⁴ These reports are consistent with our presented data that allergen‐induced eosinophil active pro‐inflammatory, profibrotic cytokines IL‐4, IL‐5, IL‐13 and TGF‐β, and eosinophil‐associated chemokines Eotaxin‐1 and Eotaxin‐2 are reduced following tacrolimus treatment in an experimental model of asthma and EoE. We also show that tacrolimus not only reduces allergen‐induced pro‐inflammatory, profibrotic cytokines and chemokines, but also protects experimental asthma, EoE and EG induced by the overexpression of IL‐4, IL‐5 and IL‐13 in mice. We show that eosinophil levels in the bone marrow, spleen, BALF, lung, oesophagus and intestine are significantly reduced following the treatment of tacrolimus in A. fumigatus‐challenged mice, CD2‐IL‐5 transgenic mice and DOX‐regulated CC10‐IL‐13 transgenic mice. However, upon tacrolimus administration, a significant downregulation in anti‐MBP‐positive eosinophils and collagen accumulation (including profibrotic cytokine TGF‐β) was also observed in the oesophageal, lung and intestinal tissue sections of A. fumigatus‐challenged mice, CD2‐IL‐5 transgenic mice and DOX‐regulated CC10‐IL‐13 transgenic mice. ²⁷ , ⁴⁵ The oesophageal and airway remodelling has previously been associated with high eosinophil accumulation in asthma, EoE and EG pathogenesis. ⁴⁶ , ⁴⁷ Herein, we show that apart from eosinophils, tacrolimus treatment also inhibits A. fumigatus challenge‐induced mast cells, F4/80⁺ macrophages, but not T and B cells. Even though the number of T cells is not changed, our analysis indicates that the function of immune cells is affected by the tacrolimus treatment, as we observed reduced Th2 and Th3 (TGF‐β) cytokine levels in lung homogenates following tacrolimus treatment.

Furthermore, to establish the tacrolimus clinical relevance we also examined tacrolimus post‐treatment effect in A. fumigatus‐challenged mice and analysed the bone marrow, spleen, BALF and tissue eosinophilia and spleen T cells and B cells. Tacrolimus post‐treatment inhibits A. fumigatus challenge‐induced CCR3 and Siglec‐F⁺ eosinophils in the bone marrow and BALF, and oesophageal and lung MBP⁺ eosinophils. Earlier, in vitro tacrolimus treatment showed that it inhibits TGF‐β‐induced collagen synthesis and suppressed the expression of TGF‐β type I receptor in TIG‐3‐20 cells. ⁴⁸ Our current in vivo findings add to previous literature on tacrolimus effectiveness in inhibiting the disease pathogenesis by restricting the tissue eosinophilia accumulation and TGF‐β‐induced collagen synthesis. ⁴⁹ Tacrolimus is an inhibitor of the regulator of calcineurin (RCAN), and RCAN1 is a novel contributor in the development of eosinophilia in allergic asthma via regulation of eosinophil progenitor production. ²⁰ In this report, we show downregulation of RCAN1 in an A. fumigatus experimental model of asthma and EoE that provides a mechanistic understanding of the downregulation of eosinophil levels in experimental models of EoE, EG and asthma. Tacrolimus‐inhibited RCAN1 leads to reduced production of eosinophil progenitor cells, resulting in reduced eosinophilia in bone marrow, spleen, BALF oesophageal, intestinal and lung tissues. Thus, the tacrolimus‐associated RCAN1 regulation is mechanistically different from the currently available therapies, including elemental diet or anti‐cytokine therapies. The anti‐IL‐5 or anti‐IL‐13 therapies downregulate eosinophils by blocking eosinophil growth and survival factors. Therefore, regulation of RCAN1 may serve as a potential target for the treatment of EoE and EG.

Taken together with the observed marked improvements in EoE and EG (histological features) after tacrolimus treatment in experimental models, we propose that tacrolimus may be a promising therapy for EoE and EG. However, tacrolimus downregulates the innate immune system, and several side‐effects have been noted with long‐term use, some of them are also observed in the experimental model (Table S1). Therefore, based on experimental EoE and EG presented data, we propose that tacrolimus optimal dose should be established by clinical trial and then considered first on the treatment of steroid‐refractory adult EoE or non‐responsive cytokine therapy EG patients or steroid non‐responsive asthmatic patients. We have some limitations on the use of tacrolimus; therefore, we recommend a double‐blind low‐dose oral tacrolimus clinical trial to select a correct dose for adult patients for EoE and EG; and further topical application for paediatric EoE patients. Lastly, to better understand the mechanistic pathway operational in the allergen‐, IL‐5‐ and IL‐13‐induced eosinophilia and tacrolimus treatment, we included a prospective summarized schematic representation in Fig. 8.

Summarized schematic representation of mechanistic pathway operational in Tacrolimus‐treated allergen‐induced eosinophilia, IL‐5 overexpression‐induced global eosinophilia and IL‐13 overexpression‐induced tissue‐specific eosinophilia in experimental models.

Funding information

Dr. Mishra is the Endowed Schlieder Chair. All authors would like to thank Edward G. Schlieder Educational Foundation for the major support. The work is also partially supported by the NIHR01 AI080581 grant (AM).

Conflict of interest

The authors declare no commercial or financial conflict of interest.

Supporting information

Figure S1. (A i) Lung MBP+ eosinophils in vehicle challenged BALB/c mice. (A ii) A. fumigatus challenge induces MBP+ eosinophils in lung of BALB/c mice. (A iii) Tacrolimus treatment inhibits A. fumigatus challenge induced MBP+ eosinophils in lung of BALB/c mice. (A iv) Lung MBP+ eosinophils number with A. fumigatus alone and A. fumigatus and Tacrolimus treatment in BALB/c mice. Arrows indicated MBP+ eosinophils. (B‐E) Analysis of fibrosis in lung tissues in BALB/c mice. (B i‐iii) Tacrolimus treatment inhibits A. fumigatus induced collagen levels in BALB/c mice lung tissues analyzed by Masson trichrome staining. (C i‐iii) Tacrolimus treatment inhibits A. fumigatus induced ColIα1 protein expression in BALB/c mice lung tissues analyzed by immunofluorescence. (D i‐iii) Tacrolimus treatment inhibits A. fumigatus induced ColIIIα1 protein expression in BALB/c mice lung tissues analyzed by immunofluorescence. (E i‐iii) Tacrolimus treatment inhibits A. fumigatus induced α‐SMA protein expression in BALB/c mice lung tissues analyzed by immunofluorescence. The data represent the means ± SD, n = 8 mice/group. *** or ### P < 0.0001. Symbols represented as # A. fumigatus vs vehicle and, * Tacrolimus + A. fumigatus vs A. fumigatus. All photomicrographs are 100x and 400x of original magnification.

Figure S2. (A‐B) CD4⁺, CD8⁺ T cells and B220⁺ B cells in A. fumigatuschallenge with or without Tacrolimus treatment in spleen. (A i) Isotype matched anti‐IgG control. (A ii) anti‐CD4⁺, anti‐CD8⁺ T cells in spleen of A. fumigatuschallenged mice (A iii) anti‐CD4⁺, anti‐CD8⁺ T cells in spleen of A. fumigatuschallenged mice with Tacrolimus treatment. (A iv) Spleen CD4⁺, CD8⁺ T cells number with A. fumigatusalone and A. fumigatusand Tacrolimus treatment. (B i) Isotype matched anti‐IgG control. (B ii) anti‐B220⁺ B cells in spleen of A. fumigatuschallenged mice (B iii) anti‐B220⁺ B cells in spleen of A. fumigatuschallenged mice with Tacrolimus treatment. (B iv) Spleen anti‐B220⁺ B cells number with A. fumigatusalone and A. fumigatusand Tacrolimus treatment. Data is expressed as mean ± SD. n = 8 mice/group.

Figure S3. Analysis of fibrosis in esophagus tissues of CD2‐IL‐5 Tg mice. (A i‐iii) Tacrolimus treatment inhibits collagen levels in CD2‐IL‐5 Tg mice esophagus tissues analyzed by Masson trichrome staining. (B i‐iii) Tacrolimus treatment inhibits ColIα1 protein expression in CD2‐IL‐5 Tg mice esophagus tissues analyzed by immunofluorescence. (C i‐iii) Tacrolimus treatment inhibits ColIIIα1 protein expression in CD2 IL‐5 Tg mice esophagus tissues analyzed by immunofluorescence. (D i‐iii) Tacrolimus treatment inhibits α‐SMA protein expression in CD2 IL‐5 Tg mice esophagus tissues analyzed by immunofluorescence. n = 8 mice/group. All photomicrographs are 400x of original magnification.

Figure S4. (A‐E) Analysis of fibrosis in lung tissues in CD2‐IL‐5 Tg mice. (A). Tacrolimus treatment inhibits TGF‐β cytokine levels in CD2‐IL‐5 Tg mice lung tissues. (B i‐iii) Tacrolimus treatment inhibits collagen levels in CD2‐IL‐5 Tg mice lung tissues analyzed by Masson trichrome staining. (C i‐iii) Tacrolimus treatment inhibits ColIα1 protein expression in CD2‐IL‐5 Tg mice lung tissues analyzed by immunofluorescence. (D i‐iii) Tacrolimus treatment inhibits ColIIIα1 protein expression in CD2‐IL‐5 Tg mice lung tissues analyzed by immunofluorescence. (E i‐iii) Tacrolimus treatment inhibits α‐SMA protein expression in CD2 IL‐5 Tg mice lung tissues analyzed by immunofluorescence. The data represent the means ± SD, n = 8 mice/group. * or # P < 0·05. Symbols represented as # CD2‐IL5Tg vehicle vs BALB/c and, * CD2‐IL5Tg + Tacrolimus vs CD2‐IL5Tg vehicle. All photomicrographs are 100x and 400x of original magnification.

Figure S5. Analysis of fibrosis in esophagus tissues in CC10‐IL‐13 Tg mice.

Figure S6. (A i‐iii) Tacrolimus treatment inhibits MBP+ eosinophils in lung of CC‐10‐IL13 mice. (A iv) Lung MBP+ eosinophils number with vehicle alone or Tacrolimus treatment with Dox food in CC‐10‐IL13 Tg mice compared with vehicle treated CC‐10‐IL13 Tg mice without DOX food. ± SD. n = 8 mice/group. (B‐E) Analysis of fibrosis in lung tissues in CC10‐IL‐13 Tg mice. (B i‐iii) Tacrolimus treatment inhibits collagen levels in CC10‐IL‐13 Tg mice lung tissues analyzed by Masson trichrome staining. (C i‐iii) Tacrolimus treatment inhibits ColIα1 protein expression in CC10‐IL‐13 Tg mice lung tissues analyzed by immunofluorescence. (D i‐iii) Tacrolimus treatment inhibits ColIIIα1 protein expression in CC10‐IL‐13 Tg mice lung tissues analyzed by immunofluorescence. (E i‐iii) Tacrolimus treatment inhibits α‐SMA protein expression in CC10/IL13 Tg mice lung tissues analyzed by immunofluorescence. Tacrolimus only treated photomicrographs not shown. Arrows indicated anti‐MBP+ eosinophils. The data represent the means ± SD, n = 8 mice/group. *** or ### P < 0.0001. Symbols represented as # CC10 IL13 Tg vs CC10 IL 13 Tg no Dox vehicle or Tacrolimus treatment and, * CC10 IL13 Tg + Tacrolimus vs CC10 IL13 Tg vehicle. All photomicrographs are 100x and 400x of original magnification.

Click here for additional data file.^{(2.2MB, docx)}

Table S1. Side effects of Tacrolimus in mice compared to human.

Click here for additional data file.^{(13.7KB, docx)}

Senior author: Anil Mishra.

Data availability statement

The corresponding author can provide the data that support the findings of this study upon reasonable request.

References

1. Kandikattu HK, Venkateshaiah SU, Mishra A. Synergy of Interleukin (IL)‐5 and IL‐18 in eosinophil mediated pathogenesis of allergic diseases. Cytokine Growth Factor Rev 2019; 47:83–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Mishra A, Rothenberg ME. Intratracheal IL‐13 induces eosinophilic esophagitis by an IL‐5, eotaxin‐1, and STAT6‐dependent mechanism. Gastroenterology 2003; 125:1419–27. [DOI] [PubMed] [Google Scholar]
3. Mishra A, Hogan SP, Brandt EB, Wagner N, Crossman MW, Foster PS, et al. Enterocyte expression of the eotaxin and interleukin‐5 transgenes induces compartmentalized dysregulation of eosinophil trafficking. J Biol Chem 2002; 277:4406–12. [DOI] [PubMed] [Google Scholar]
4. Mishra A, Hogan SP, Brandt EB, Rothenberg ME. An etiological role for aeroallergens and eosinophils in experimental esophagitis. J Clin Investig 2001; 107:83–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Mishra A, Hogan SP, Brandt EB, Rothenberg ME. IL‐5 promotes eosinophil trafficking to the esophagus. J Immunol 2002; 168:2464–9. [DOI] [PubMed] [Google Scholar]
6. Agache I, Strasser D, Klenk A, Agache C, Farine H, Ciobanu C, et al. Serum IL‐5 and IL‐13 consistently serve as the best predictors for the blood eosinophilia phenotype in adult asthmatics. Allergy 2016; 71:1192–202. [DOI] [PubMed] [Google Scholar]
7. Nagase H, Ueki S, Fujieda S. The roles of IL‐5 and anti‐IL‐5 treatment in eosinophilic diseases: asthma, eosinophilic granulomatosis with polyangiitis, and eosinophilic chronic rhinosinusitis. Allergol Int 2020; 69:178–86. [DOI] [PubMed] [Google Scholar]
8. Yang M, Hogan SP, Mahalingam S, Pope SM, Zimmermann N, Fulkerson P, et al. Eotaxin‐2 and IL‐5 cooperate in the lung to regulate IL‐13 production and airway eosinophilia and hyperreactivity. J Allergy Clin Immunol 2003; 112:935–43. [DOI] [PubMed] [Google Scholar]
9. Pope SM, Brandt EB, Mishra A, Hogan SP, Zimmermann N, Matthaei KI, et al. IL‐13 induces eosinophil recruitment into the lung by an IL‐5–and eotaxin‐dependent mechanism. J Allergy Clin Immunol 2001; 108:594–601. [DOI] [PubMed] [Google Scholar]
10. Eskian M, Khorasanizadeh M, Assa’ad AH, Rezaei N. Monoclonal antibodies for treatment of eosinophilic esophagitis. Clin Rev Allergy Immunol 2018; 55:88–98. [DOI] [PubMed] [Google Scholar]
11. De Boever EH, Ashman C, Cahn AP, Locantore NW, Overend P, Pouliquen IJ, et al. Efficacy and safety of an anti–IL‐13 mAb in patients with severe asthma: a randomized trial. J Allergy Clin Immunol 2014; 133: 989–96.e4. [DOI] [PubMed] [Google Scholar]
12. Molina‐Infante J, Arias A, Barrio J, Rodríguez‐Sánchez J, Sanchez‐Cazalilla M, Lucendo AJ. Four‐food group elimination diet for adult eosinophilic esophagitis: a prospective multicenter study. J Allergy Clin Immunol 2014; 134:1093–9.e1. [DOI] [PubMed] [Google Scholar]
13. Stein ML, Villanueva JM, Buckmeier BK, Yamada Y, Filipovich AH, Assa'ad AH, et al. Anti–IL‐5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL‐5 and IL‐5 receptor levels. J Allergy Clin Immunol 2008; 121:1473–83.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Yang G, Volk A, Petley T, Emmell E, Giles‐Komar J, Shang X, et al. Anti‐IL‐13 monoclonal antibody inhibits airway hyperresponsiveness, inflammation and airway remodeling. Cytokine 2004; 28:224–32. [DOI] [PubMed] [Google Scholar]
15. Mishra A, Hogan SP, Lee JJ, Foster PS, Rothenberg ME. Fundamental signals that regulate eosinophil homing to the gastrointestinal tract. J Clin Invest 1999; 103:1719–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Tang J‐T, Andrews L, van Gelder T, Shi Y, Van Schaik R, Wang L, et al. Pharmacogenetic aspects of the use of tacrolimus in renal transplantation: recent developments and ethnic considerations. Expert Opin Drug Metab Toxicol 2016; 12:555–65. [DOI] [PubMed] [Google Scholar]
17. Rallis E, Korfitis C, Gregoriou S, Rigopoulos D. Assigning new roles to topical tacrolimus. Expert Opin Investig Drugs 2007; 16:1267–76. [DOI] [PubMed] [Google Scholar]
18. Kandikattu HK, Mishra A. Immunomodulatory effects of tacrolimus (FK506) for the treatment of allergic diseases. Int J Cell Biol Physiol 2018; 1:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Armstrong‐James D, de Boer L, Bercusson A, Shah A. From phagocytosis to metaforosis: calcineurin’s deadly role in innate processing of fungi. PLoS Pathog 2018; 14:e1006627. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Yang YJ, MacNeil AJ, Junkins R, Carrigan SO, Tang J‐T, Forward N, et al. Regulator of calcineurin 1 (Rcan1) is required for the development of pulmonary eosinophilia in allergic inflammation in mice. Am J Pathol 2011; 179:1199–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Venkateshaiah SU, Mishra A, Manohar M, Verma AK, Rajavelu P, Niranjan R, et al. A critical role for IL‐18 in transformation and maturation of naive eosinophils to pathogenic eosinophils. J Allergy Clin Immunol 2018; 142:301–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Venkateshaiah SU, Zhu X, Rajavelu P, Niranjan R, Manohar M, Verma AK, et al. Regulatory effects of IL‐15 on allergen‐induced airway obstruction. J Allergy Clin Immunol 2018; 141:906–917.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Dutt P, Shukla JS, Ventateshaiah SU, Mariswamy SJ, Mattner J, Shukla A, et al. Allergen‐induced interleukin‐18 promotes experimental eosinophilic oesophagitis in mice. Immunol Cell Biol 2015; 93:849–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Venkateshaiah SU, Kandikattu HK, Mishra A. Significance of interleukin (IL)‐15 in IgE associated eosinophilic esophagitis (EoE). Int J Basic Clin Immunol 2019; 2:1. [PMC free article] [PubMed] [Google Scholar]
25. Mussarat A, Manohar M, Verma AK, Upparahalli Venkateshaiah S, Zaidi A, Sanders NL, et al. Intestinal overexpression of interleukin (IL)‐15 promotes tissue eosinophilia and goblet cell hyperplasia. Immunol Cell Biol 2018; 96:273–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Manohar M, Kandikattu HK, Verma AK, Mishra A. IL‐15 regulates fibrosis and inflammation in a mouse model of chronic pancreatitis. Am J Physiol‐Gastrointest Liver Physiol 2018; 315:G954–G965. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Mishra A, Wang M, Pemmaraju VR, Collins MH, Fulkerson PC, Abonia JP, et al. Esophageal remodeling develops as a consequence of tissue specific IL‐5‐induced eosinophilia. Gastroenterology 2008; 134:204–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Dyer KD, Moser JM, Czapiga M, Siegel SJ, Percopo CM, Rosenberg HF. Functionally competent eosinophils differentiated ex vivo in high purity from normal mouse bone marrow. J Immunol 2008; 181:4004–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. O’Shea KM, Aceves SS, Dellon ES, Gupta SK, Spergel JM, Furuta GT, et al. Pathophysiology of eosinophilic esophagitis. Gastroenterology 2018; 154:333–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Cheng E, Souza RF, Spechler SJ. Tissue remodeling in eosinophilic esophagitis. Am J Physiol‐Gastrointest Liver Physiol 2012; 303:G1175–G1187. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Kagalwalla AF, Akhtar N, Woodruff SA, Rea BA, Masterson JC, Mukkada V, et al. Eosinophilic esophagitis: epithelial mesenchymal transition contributes to esophageal remodeling and reverses with treatment. J Allergy Clin Immunol 2012; 129:1387–96.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Mavi P, Rajavelu P, Rayapudi M, Paul RJ, Mishra A. Esophageal functional impairments in experimental eosinophilic esophagitis. Am J Physiol‐Gastrointest Liver Physiol 2012; 302:G1347–G1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Verma AK, Manohar M, Venkateshaiah SU, Mishra A. Neuroendocrine cells derived chemokine vasoactive intestinal polypeptide (VIP) in allergic diseases. Cytokine Growth Factor Rev 2017; 38:37–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Verma AK, Manohar M, Venkateshaiah SU, Blecker U, Collins MH, Mishra A. Role of vasoactive intestinal peptide in promoting the pathogenesis of eosinophilic esophagitis (EoE). Cell Mol Gastroenterol Hepatol 2018; 5:99. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Verma AK, Kandikattu HK, Manohar M, Shukla A, Upparahalli Venkateshaiah S, Zhu X, et al. Intestinal overexpression of IL‐18 promotes eosinophils‐mediated allergic disorders. Immunology 2019; 157:110–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Muir AB, Wang JX, Nakagawa H. Epithelial‐stromal crosstalk and fibrosis in eosinophilic esophagitis. J Gastroenterol 2019; 54:10–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Mishra A, Weaver TE, Beck DC, Rothenberg ME. Interleukin‐5‐mediated allergic airway inflammation inhibits the human surfactant protein C promoter in transgenic mice. J Biol Chem 2001; 276:8453–9. [DOI] [PubMed] [Google Scholar]
38. Cianferoni A, Spergel JM. Immunotherapeutic approaches for the treatment of eosinophilic esophagitis. Immunotherapy 2014; 6:321–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Corren J. Inhibition of interleukin‐5 for the treatment of eosinophilic diseases. Discov Med 2012; 13:305–12. [PubMed] [Google Scholar]
40. Groetch M, Venter C, Skypala I, Vlieg‐Boerstra B, Grimshaw K, Durban R, et al. Dietary therapy and nutrition management of eosinophilic esophagitis: a work group report of the American Academy of Allergy, Asthma, and Immunology. J Allergy Clin Immunol In Pract 2017; 5:312–24.e29. [DOI] [PubMed] [Google Scholar]
41. Warners M, Vlieg‐Boerstra B, Bredenoord A. Elimination and elemental diet therapy in eosinophilic oesophagitis. Best Pract Res Clin Gastroenterol 2015; 29:793–803. [DOI] [PubMed] [Google Scholar]
42. Rayapudi M, Rajavelu P, Zhu X, Kaul A, Niranjan R, Dynda S, et al. Invariant natural killer T‐cell neutralization is a possible novel therapy for human eosinophilic esophagitis. Clin Transl Immunology 2014; 3:e9. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Nakahara T, Morimoto H, Murakami N, Furue M. Mechanistic insights into topical tacrolimus for the treatment of atopic dermatitis. Pediatr Allergy Immunol 2018; 29:233–8. [DOI] [PubMed] [Google Scholar]
44. Shin J‐H, Park HR, Kim SW, Park C‐S, Cho J‐H, Park Y‐J, et al. The effect of topical FK506 (tacrolimus) in a mouse model of allergic rhinitis. Am J Rhinol Allergy 2012; 26:e71–e75. [DOI] [PubMed] [Google Scholar]
45. Upparahalli Venkateshaiah S, Niranjan R, Manohar M, Verma AK, Kandikattu HK, Lasky JA, et al. Attenuation of allergen, IL‐13‐ and TGF‐alpha‐induced lung fibrosis following the treatment of IL‐15 in mice. Am J Respir Cell Mol Biol 2019; 61: 97–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Minshall EM, Leung DY, Martin RJ, Song YL, Cameron L, Ernst P, et al. Eosinophil‐associated TGF‐β1 mRNA expression and airways fibrosis in bronchial asthma. Am J Respir Cell Mol Biol 1997; 17:326–33. [DOI] [PubMed] [Google Scholar]
47. Aceves SS, Ackerman SJ. Relationships between eosinophilic inflammation, tissue remodeling, and fibrosis in eosinophilic esophagitis. Immunol Allergy Clin N Am 2009; 29:197–211. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Nagano J, Iyonaga K, Kawamura K, Yamashita A, Ichiyasu H, Okamoto T, et al. Use of tacrolimus, a potent antifibrotic agent, in bleomycin‐induced lung fibrosis. Eur Respir J 2006; 27:460–9. [DOI] [PubMed] [Google Scholar]
49. Shukla A, Mishra A, Venkateshaiah SU, Manohar M, Mahadevappa CP, Mishra A. Elements Involved In Promoting Eosinophilic Gastrointestinal Disorders. J Genet Syndr Gene Ther 2015; 6. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S5. Analysis of fibrosis in esophagus tissues in CC10‐IL‐13 Tg mice.

Click here for additional data file.^{(2.2MB, docx)}

Table S1. Side effects of Tacrolimus in mice compared to human.

Click here for additional data file.^{(13.7KB, docx)}

Data Availability Statement

The corresponding author can provide the data that support the findings of this study upon reasonable request.

[imm13314-bib-0001] 1. Kandikattu HK, Venkateshaiah SU, Mishra A. Synergy of Interleukin (IL)‐5 and IL‐18 in eosinophil mediated pathogenesis of allergic diseases. Cytokine Growth Factor Rev 2019; 47:83–98. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0002] 2. Mishra A, Rothenberg ME. Intratracheal IL‐13 induces eosinophilic esophagitis by an IL‐5, eotaxin‐1, and STAT6‐dependent mechanism. Gastroenterology 2003; 125:1419–27. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0003] 3. Mishra A, Hogan SP, Brandt EB, Wagner N, Crossman MW, Foster PS, et al. Enterocyte expression of the eotaxin and interleukin‐5 transgenes induces compartmentalized dysregulation of eosinophil trafficking. J Biol Chem 2002; 277:4406–12. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0004] 4. Mishra A, Hogan SP, Brandt EB, Rothenberg ME. An etiological role for aeroallergens and eosinophils in experimental esophagitis. J Clin Investig 2001; 107:83–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0005] 5. Mishra A, Hogan SP, Brandt EB, Rothenberg ME. IL‐5 promotes eosinophil trafficking to the esophagus. J Immunol 2002; 168:2464–9. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0006] 6. Agache I, Strasser D, Klenk A, Agache C, Farine H, Ciobanu C, et al. Serum IL‐5 and IL‐13 consistently serve as the best predictors for the blood eosinophilia phenotype in adult asthmatics. Allergy 2016; 71:1192–202. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0007] 7. Nagase H, Ueki S, Fujieda S. The roles of IL‐5 and anti‐IL‐5 treatment in eosinophilic diseases: asthma, eosinophilic granulomatosis with polyangiitis, and eosinophilic chronic rhinosinusitis. Allergol Int 2020; 69:178–86. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0008] 8. Yang M, Hogan SP, Mahalingam S, Pope SM, Zimmermann N, Fulkerson P, et al. Eotaxin‐2 and IL‐5 cooperate in the lung to regulate IL‐13 production and airway eosinophilia and hyperreactivity. J Allergy Clin Immunol 2003; 112:935–43. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0009] 9. Pope SM, Brandt EB, Mishra A, Hogan SP, Zimmermann N, Matthaei KI, et al. IL‐13 induces eosinophil recruitment into the lung by an IL‐5–and eotaxin‐dependent mechanism. J Allergy Clin Immunol 2001; 108:594–601. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0010] 10. Eskian M, Khorasanizadeh M, Assa’ad AH, Rezaei N. Monoclonal antibodies for treatment of eosinophilic esophagitis. Clin Rev Allergy Immunol 2018; 55:88–98. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0011] 11. De Boever EH, Ashman C, Cahn AP, Locantore NW, Overend P, Pouliquen IJ, et al. Efficacy and safety of an anti–IL‐13 mAb in patients with severe asthma: a randomized trial. J Allergy Clin Immunol 2014; 133: 989–96.e4. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0012] 12. Molina‐Infante J, Arias A, Barrio J, Rodríguez‐Sánchez J, Sanchez‐Cazalilla M, Lucendo AJ. Four‐food group elimination diet for adult eosinophilic esophagitis: a prospective multicenter study. J Allergy Clin Immunol 2014; 134:1093–9.e1. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0013] 13. Stein ML, Villanueva JM, Buckmeier BK, Yamada Y, Filipovich AH, Assa'ad AH, et al. Anti–IL‐5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL‐5 and IL‐5 receptor levels. J Allergy Clin Immunol 2008; 121:1473–83.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0014] 14. Yang G, Volk A, Petley T, Emmell E, Giles‐Komar J, Shang X, et al. Anti‐IL‐13 monoclonal antibody inhibits airway hyperresponsiveness, inflammation and airway remodeling. Cytokine 2004; 28:224–32. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0015] 15. Mishra A, Hogan SP, Lee JJ, Foster PS, Rothenberg ME. Fundamental signals that regulate eosinophil homing to the gastrointestinal tract. J Clin Invest 1999; 103:1719–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0016] 16. Tang J‐T, Andrews L, van Gelder T, Shi Y, Van Schaik R, Wang L, et al. Pharmacogenetic aspects of the use of tacrolimus in renal transplantation: recent developments and ethnic considerations. Expert Opin Drug Metab Toxicol 2016; 12:555–65. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0017] 17. Rallis E, Korfitis C, Gregoriou S, Rigopoulos D. Assigning new roles to topical tacrolimus. Expert Opin Investig Drugs 2007; 16:1267–76. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0018] 18. Kandikattu HK, Mishra A. Immunomodulatory effects of tacrolimus (FK506) for the treatment of allergic diseases. Int J Cell Biol Physiol 2018; 1:5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0019] 19. Armstrong‐James D, de Boer L, Bercusson A, Shah A. From phagocytosis to metaforosis: calcineurin’s deadly role in innate processing of fungi. PLoS Pathog 2018; 14:e1006627. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0020] 20. Yang YJ, MacNeil AJ, Junkins R, Carrigan SO, Tang J‐T, Forward N, et al. Regulator of calcineurin 1 (Rcan1) is required for the development of pulmonary eosinophilia in allergic inflammation in mice. Am J Pathol 2011; 179:1199–210. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0021] 21. Venkateshaiah SU, Mishra A, Manohar M, Verma AK, Rajavelu P, Niranjan R, et al. A critical role for IL‐18 in transformation and maturation of naive eosinophils to pathogenic eosinophils. J Allergy Clin Immunol 2018; 142:301–5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0022] 22. Venkateshaiah SU, Zhu X, Rajavelu P, Niranjan R, Manohar M, Verma AK, et al. Regulatory effects of IL‐15 on allergen‐induced airway obstruction. J Allergy Clin Immunol 2018; 141:906–917.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0023] 23. Dutt P, Shukla JS, Ventateshaiah SU, Mariswamy SJ, Mattner J, Shukla A, et al. Allergen‐induced interleukin‐18 promotes experimental eosinophilic oesophagitis in mice. Immunol Cell Biol 2015; 93:849–57. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0024] 24. Venkateshaiah SU, Kandikattu HK, Mishra A. Significance of interleukin (IL)‐15 in IgE associated eosinophilic esophagitis (EoE). Int J Basic Clin Immunol 2019; 2:1. [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0025] 25. Mussarat A, Manohar M, Verma AK, Upparahalli Venkateshaiah S, Zaidi A, Sanders NL, et al. Intestinal overexpression of interleukin (IL)‐15 promotes tissue eosinophilia and goblet cell hyperplasia. Immunol Cell Biol 2018; 96:273–83. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0026] 26. Manohar M, Kandikattu HK, Verma AK, Mishra A. IL‐15 regulates fibrosis and inflammation in a mouse model of chronic pancreatitis. Am J Physiol‐Gastrointest Liver Physiol 2018; 315:G954–G965. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0027] 27. Mishra A, Wang M, Pemmaraju VR, Collins MH, Fulkerson PC, Abonia JP, et al. Esophageal remodeling develops as a consequence of tissue specific IL‐5‐induced eosinophilia. Gastroenterology 2008; 134:204–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0028] 28. Dyer KD, Moser JM, Czapiga M, Siegel SJ, Percopo CM, Rosenberg HF. Functionally competent eosinophils differentiated ex vivo in high purity from normal mouse bone marrow. J Immunol 2008; 181:4004–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0029] 29. O’Shea KM, Aceves SS, Dellon ES, Gupta SK, Spergel JM, Furuta GT, et al. Pathophysiology of eosinophilic esophagitis. Gastroenterology 2018; 154:333–45. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0030] 30. Cheng E, Souza RF, Spechler SJ. Tissue remodeling in eosinophilic esophagitis. Am J Physiol‐Gastrointest Liver Physiol 2012; 303:G1175–G1187. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0031] 31. Kagalwalla AF, Akhtar N, Woodruff SA, Rea BA, Masterson JC, Mukkada V, et al. Eosinophilic esophagitis: epithelial mesenchymal transition contributes to esophageal remodeling and reverses with treatment. J Allergy Clin Immunol 2012; 129:1387–96.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0032] 32. Mavi P, Rajavelu P, Rayapudi M, Paul RJ, Mishra A. Esophageal functional impairments in experimental eosinophilic esophagitis. Am J Physiol‐Gastrointest Liver Physiol 2012; 302:G1347–G1355. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0033] 33. Verma AK, Manohar M, Venkateshaiah SU, Mishra A. Neuroendocrine cells derived chemokine vasoactive intestinal polypeptide (VIP) in allergic diseases. Cytokine Growth Factor Rev 2017; 38:37–48. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0034] 34. Verma AK, Manohar M, Venkateshaiah SU, Blecker U, Collins MH, Mishra A. Role of vasoactive intestinal peptide in promoting the pathogenesis of eosinophilic esophagitis (EoE). Cell Mol Gastroenterol Hepatol 2018; 5:99. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0035] 35. Verma AK, Kandikattu HK, Manohar M, Shukla A, Upparahalli Venkateshaiah S, Zhu X, et al. Intestinal overexpression of IL‐18 promotes eosinophils‐mediated allergic disorders. Immunology 2019; 157:110–21. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0036] 36. Muir AB, Wang JX, Nakagawa H. Epithelial‐stromal crosstalk and fibrosis in eosinophilic esophagitis. J Gastroenterol 2019; 54:10–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0037] 37. Mishra A, Weaver TE, Beck DC, Rothenberg ME. Interleukin‐5‐mediated allergic airway inflammation inhibits the human surfactant protein C promoter in transgenic mice. J Biol Chem 2001; 276:8453–9. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0038] 38. Cianferoni A, Spergel JM. Immunotherapeutic approaches for the treatment of eosinophilic esophagitis. Immunotherapy 2014; 6:321–31. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0039] 39. Corren J. Inhibition of interleukin‐5 for the treatment of eosinophilic diseases. Discov Med 2012; 13:305–12. [PubMed] [Google Scholar]

[imm13314-bib-0040] 40. Groetch M, Venter C, Skypala I, Vlieg‐Boerstra B, Grimshaw K, Durban R, et al. Dietary therapy and nutrition management of eosinophilic esophagitis: a work group report of the American Academy of Allergy, Asthma, and Immunology. J Allergy Clin Immunol In Pract 2017; 5:312–24.e29. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0041] 41. Warners M, Vlieg‐Boerstra B, Bredenoord A. Elimination and elemental diet therapy in eosinophilic oesophagitis. Best Pract Res Clin Gastroenterol 2015; 29:793–803. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0042] 42. Rayapudi M, Rajavelu P, Zhu X, Kaul A, Niranjan R, Dynda S, et al. Invariant natural killer T‐cell neutralization is a possible novel therapy for human eosinophilic esophagitis. Clin Transl Immunology 2014; 3:e9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0043] 43. Nakahara T, Morimoto H, Murakami N, Furue M. Mechanistic insights into topical tacrolimus for the treatment of atopic dermatitis. Pediatr Allergy Immunol 2018; 29:233–8. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0044] 44. Shin J‐H, Park HR, Kim SW, Park C‐S, Cho J‐H, Park Y‐J, et al. The effect of topical FK506 (tacrolimus) in a mouse model of allergic rhinitis. Am J Rhinol Allergy 2012; 26:e71–e75. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0045] 45. Upparahalli Venkateshaiah S, Niranjan R, Manohar M, Verma AK, Kandikattu HK, Lasky JA, et al. Attenuation of allergen, IL‐13‐ and TGF‐alpha‐induced lung fibrosis following the treatment of IL‐15 in mice. Am J Respir Cell Mol Biol 2019; 61: 97–109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0046] 46. Minshall EM, Leung DY, Martin RJ, Song YL, Cameron L, Ernst P, et al. Eosinophil‐associated TGF‐β1 mRNA expression and airways fibrosis in bronchial asthma. Am J Respir Cell Mol Biol 1997; 17:326–33. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0047] 47. Aceves SS, Ackerman SJ. Relationships between eosinophilic inflammation, tissue remodeling, and fibrosis in eosinophilic esophagitis. Immunol Allergy Clin N Am 2009; 29:197–211. [DOI] [PMC free article] [PubMed] [Google Scholar]

[imm13314-bib-0048] 48. Nagano J, Iyonaga K, Kawamura K, Yamashita A, Ichiyasu H, Okamoto T, et al. Use of tacrolimus, a potent antifibrotic agent, in bleomycin‐induced lung fibrosis. Eur Respir J 2006; 27:460–9. [DOI] [PubMed] [Google Scholar]

[imm13314-bib-0049] 49. Shukla A, Mishra A, Venkateshaiah SU, Manohar M, Mahadevappa CP, Mishra A. Elements Involved In Promoting Eosinophilic Gastrointestinal Disorders. J Genet Syndr Gene Ther 2015; 6. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Tacrolimus (FK506) treatment protects allergen‐, IL‐5‐ and IL‐13‐induced mucosal eosinophilia

Hemanth Kumar Kandikattu

Sathisha Upparahalli Venkateshaiah

Alok Kumar Verma

Anil Mishra

Summary

Abbreviations

Introduction

Materials and methods

Mice

Figure 1.

Spleen, bone marrow and BALF cell isolation for flow cytometry analysis

Antibodies and flow cytometry analysis

Tissue eosinophil analysis

Quantification of eosinophils

Tissue mast cell analysis

Cytokine analyses

Tissue collagen analysis

RNA isolation and quantitative transcript analysis by polymerase chain reaction (qPCR)

Immunoblot analysis

Immunofluorescence analysis

In vitro bone marrow eosinophil precursors for the development and proliferation analysis

Analysis of tacrolimus‐induced eosinophil size, shape change and apoptosis

Statistical analysis

Results

Analysis of bone marrow, spleen, BALF and tissue eosinophilia in tacrolimus (FK506)‐treated A. fumigatus‐challenged mice

Analysis of other immune cells in the spleen, BALF and tissues in tacrolimus (FK506)‐treated A. fumigatus‐challenged asthmatic mice

Figure 2.

Analysis of eosinophil‐associated pro‐inflammatory and profibrotic cytokines in A. fumigatus‐challenged and tacrolimus‐treated mice

Figure 3.

Tacrolimus inhibits IL‐5‐responsive bone marrow eosinophil proliferation and viability

Tacrolimus treatment promotes eosinophil apoptosis by the process of reducing eosinophil shape and size

Analysis of tissue collagen accumulation in A. fumigatus‐challenged and tacrolimus‐treated mice

Figure 4.

Analysis of bone marrow, BALF and spleen T cells and B cells in A. fumigatus‐challenged post‐tacrolimus‐treated mice

Figure 5.

Analysis of tacrolimus effect on IL‐5‐induced global eosinophilia in CD2‐IL‐5 transgenic mouse condition similar to human hypereosinophilic eosinophilia

Figure 6.

Analysis of post‐tacrolimus treatment mucosal eosinophilia in DOX‐exposed lung‐specific CC‐10‐IL‐13 transgenic mice

Figure 7.

Discussion

Figure 8.

Funding information

Conflict of interest

Supporting information

Data availability statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases