TEXT
The SARS-CoV-2 pandemic has been associated with the occurrence of several viral variants with a mutated spike glycoprotein (S). Those currently of greatest concern carry the N501Y substitution within the spike receptor binding domain. Indeed, they have become predominant in England (20I/501Y.V1) [1] and were detected in South Africa (20H/501Y.V2) [2] and Brazil (20 J/501Y.V3) [3]. The 20I/501Y.V1 variant has started to spread worldwide including in France [4]. It has been reported as 50–74% more transmissible than preexisting strains, suspected to evade anti-spike antibodies [1], and it caused a reinfection [5]. Its real-time detection is critical to manage patients appropriately, monitor and assess its epidemiological and clinical features, and survey cases of immune escape post-infection or vaccination. Sequencing is a detection strategy that is difficult to implement exhaustively considering the very large number of SARS-CoV-2 cases.
We implemented an in-house one-step real-time reverse transcription-PCR (qPCR) assay that specifically detects SARS-CoV-2 N501Y variants by targeting nucleotide position 23,063 within S gene where A>U leads to N501Y. SARS-CoV-2 genomes from the GISAID database with or without N501Y were used to design primers and a hydrolysis probe (Table 1 ). Ten cDNA samples, one for each of the 10 Marseille variants [6,7], including Nextclades 20A.EU2 and 20E, identified in our institute by genome next-generation sequencing, and three nasopharyngeal samples of the Marseille-4 variant/Nextclade 20A.EU2 that predominated locally [8] tested negative. Then we tested SARS-CoV-2 positive nasopharyngeal samples (cycle threshold value of qPCR diagnosis test= 10.2–32.9) collected in January 2021 from 161 patients and for which the viral genotype was determined by next-generation sequencing, as previously described [8]. All 112 and 26 samples from patients infected with a SARS-CoV-2 20I/501Y.V1 and a 20H/501Y.V2 variant, respectively, were positive with the N501Y-specific qPCR, while all 23 samples from patients infected with a N501Y-negative SARS-CoV-2 (Marseille-2/Nextclade 20E (n = 20); Marseille-8 (n = 2); Marseille-4/Nextclade 20A.EU2 (n = 1)) tested negative with our N501Y-specific qPCR.
Table 1.
Primers, probe and qPCR conditions.
Name | Sequence (5′−3′) | Positions* |
---|---|---|
Primers: | ||
Pri_IHU_N501Y_F1 | ATCAGGCCGGTAGCACAC | 22,980–22,997 |
Pri_IHU_N501Y_R1 | AAACAGTTGCTGGTGCATGT | 23,135–23,116 |
Probe (6FAM-labelled): | ||
Pro_IHU_C_GB_1_MBP | CCACTTATGGTGTTGGTTACCAA | 23,058–23,080 |
The qPCR was performed by adding 5 μL of extracted viral RNA to 15 μL of reaction mixture containing 5 μL of 4X TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific, Grand Island, NY, USA), 0.5 μL of forward primer (10 pmol/µL), 0.5 μL of reverse primer (10 pmol/µL), 0.4 μL of probe (10 pmol/µL), and 8.6 μL of water. PCR conditions are as follows: reverse transcription at 50 °C for 10 min, then a hold at 95 °C for 20 s followed by 40 cycles comprising a step at 95 °C for 15 s and a step at 60 °C for 60 s. This qPCR was run on a LC480 thermocycler (Roche Diagnostics, Mannheim, Germany).
*in reference to SARS-CoV-2 genome GenBank Accession no. NC_045512.2 (Wuhan-Hu-1 isolate). The nucleotide carrying the mutation is covered by the probe and underlined.
Our in-house qPCR system was found reliable to detect the N501Y substitution. It allowed estimating the 20I/501Y.V1 variant prevalence among SARS-CoV-2 diagnoses to be 18.0% overall between January 1st and February 28th, 2021, and to increase from 3.4% (57/1683) during the two first weeks of January 2021 to 47.3% (745/1572) during the two last weeks of February 2021. A commercialized RT-PCR diagnosis assay (TaqPath RT-QPCR test) allows the indirect identification of the 20I/501Y.V1 variant by detecting its ORF1a and N genes but not its S gene due to a deletion at positions 21,766-21,772 [4]. However this deletion is also present in strains devoid of the N501Y substitution and was reported in 0.6% of recent SARS-CoV-2 diagnoses in France [4]. Moreover, it is absent from the 20H/501Y.V2 and 20 J/501Y.V3 N501Y variants, which prevents their identification. Finally, our in-house qPCR test can be widely and easily deployed in laboratories as it can potentially run on any open qPCR microplate platform, does not require technical workers’ training, and is as cheap as other in-house qPCR assays. Such approach should allow adapting continuously diagnosis strategies for new SARS-CoV-2 variants.
CRediT authorship contribution statement
Marielle Bedotto: Methodology, Investigation, Formal analysis, Writing - review & editing. Pierre-Edouard Fournier: Methodology, Investigation, Formal analysis. Linda Houhamdi: Methodology, Investigation. Philippe Colson: Conceptualization, Supervision, Methodology, Investigation, Formal analysis, Writing - review & editing. Didier Raoult: Conceptualization, Supervision, Formal analysis, Writing - review & editing.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding sources had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation, review, or approval of the manuscript.
Acknowledgments
Ethics
This study has been approved by our institution's ethics committee (N°2020-029).
Acknowledgments
This work was supported by the French Government under the “Investments for the Future” program managed by the National Agency for Research (ANR), Méditerranée-Infection 10-IAHU-03 and was also supported by Région Provence Alpes Côte d'Azur and European funding FEDER PRIMMI (Fonds Européen de Développement Régional-Plateformes de Recherche et d'Innovation Mutualisées Méditerranée Infection), FEDER PA 0000320 PRIMMI.
References
- 1.Leung K., Shum M.H., Leung G.M., Lam T.T., Wu J.T. Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom, October to November 2020. Euro. Surveill. 2021;26:2002106. doi: 10.2807/1560-7917.ES.2020.26.1.2002106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Tegally H., Wilkinson E., Giovanetti M., Iranzadeh A., Fonseca V., Giandhari J., et al. Detection of a SARS-CoV-2 variant of concern in South Africa. Nature. 2021;592:438–443. doi: 10.1038/s41586-021-03402-9. [DOI] [PubMed] [Google Scholar]
- 3.N.R. Faria, I.M. Claro, D. Candido, L.A. Moyses Franco, P.S. Andrade, T.M. Coletti, et al. Genomic characterisation of an emergent SARS-CoV-2 lineage in Manaus: preliminary findings, Virological.org (2021) https://virological.org/t/genomic-characterisation-of-an-emergent-sars-cov-2-lineage-in-manaus-preliminary-findings/586.
- 4.Bal A., Destras G., Gaymard A., Stefic K., Marlet J., Eymieux S.A., et al. Two-step strategy for the identification of SARS-CoV-2 variant of concern 202012/01 and other variants with spike deletion H69-V70, France, August to December 2020. Euro. Surveill. 2021;26 doi: 10.2807/1560-7917.ES.2021.26.3.2100008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Harrington D., Kele B., Pereira S., Couto-Parada X., Riddell A., Forbes S., et al. Confirmed reinfection with SARS-CoV-2 variant VOC-202012/01. Clin. Infect. Dis. 2021 doi: 10.1093/cid/ciab014. ciab014 Online ahead of print. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Colson P., Levasseur A., Delerce J., Chaudet H., Bossi V., Ben Kheder M., et al. IHU preprint; 2020. Dramatic Increase in the SARS-CoV-2 Mutation Rate and Low Mortality Rate During the Second Epidemic in Summer in Marseille. [DOI] [Google Scholar]
- 7.Fournier P.E., Colson P., Levasseur A., Gautret P., Bedotto M., Filosa V., et al., Genome sequence analysis enabled deciphering the atypical evolution of COVID-19 epidemics in Marseille, France, IHU preprint (2021), doi: 10.35088/kmct-tj43. [DOI]
- 8.Fournier P.E., Colson P., Levasseur A., Devaux C.A., Gautret P., Bedotto M., et al. Emergence and outcome of the SARS-CoV-2 "Marseille-4" variant. Int. J. Infect. Dis. 2021;S1201-9712(21) doi: 10.1016/j.ijid.2021.03.068. 00286–00281. [DOI] [PMC free article] [PubMed] [Google Scholar]