Skip to main content
Nature Communications logoLink to Nature Communications
. 2021 May 13;12:2958. doi: 10.1038/s41467-021-23515-z

Author Correction: HIV-1 diversity considerations in the application of the Intact Proviral DNA Assay (IPDA)

Natalie N Kinloch 1,2,#, Yanqin Ren 3,#, Winiffer D Conce Alberto 3, Winnie Dong 2, Pragya Khadka 3, Szu Han Huang 3, Talia M Mota 3, Andrew Wilson 4, Aniqa Shahid 1,2, Don Kirkby 2, Marianne Harris 2,5, Colin Kovacs 6, Erika Benko 6, Mario A Ostrowski 7, Perla M Del Rio Estrada 8, Avery Wimpelberg 9, Christopher Cannon 9, W David Hardy 9, Lynsay MacLaren 9, Harris Goldstein 10, Chanson J Brumme 2,5, Guinevere Q Lee 3, Rebecca M Lynch 4, Zabrina L Brumme 1,2,, R Brad Jones 3,4,
PMCID: PMC8119429  PMID: 33986282

Correction to: Nature Communications 10.1038/s41467-020-20442-3, published online 08 January 2021.

The original version of this Article contained an error for the ‘RPP30-Shear Forward Primer sequence’ provided in the ‘Intact Proviral DNA Assay (IPDA)’ section of the Methods, which incorrectly read ‘CCAATTTGCTGCTCCTTGGG’. The correct sequence of the ‘RPP30-Shear Forward Primer’ is ‘CCATTTGCTGCTCCTTGGG’. This has been corrected in both the PDF and HTML versions of the Article.

Contributor Information

Zabrina L. Brumme, Email: zbrumme@sfu.ca

R. Brad Jones, Email: rbjones@med.cornell.edu.


Articles from Nature Communications are provided here courtesy of Nature Publishing Group

RESOURCES