Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jul 1.
Published in final edited form as: Methods Mol Biol. 2021;2262:281–302. doi: 10.1007/978-1-0716-1190-6_17

Probing RAS function with Monobodies

Imran Khan 1,2, John P O’Bryan 1,2,+
PMCID: PMC8121162  NIHMSID: NIHMS1605483  PMID: 33977484

ii. Summary/Abstract

RAS is frequently mutated in human cancers with nearly 27% of all cancers harboring mutations in one of three RAS isoforms (KRAS, HRAS or NRAS). Furthermore, RAS proteins are critical oncogenic drivers of tumorigenesis. As such, RAS has been a prime focus for development of targeted cancer therapeutics. Although RAS is viewed by many as undruggable, the recent development of allele-specific covalent inhibitors to KRAS(G12C) has provided significant hope for the eventual pharmacological inhibition of RAS (1-5). Indeed, these (G12C)-specific inhibitors have elicited promising responses in early phase clinical trials (4,5). Despite this success in pharmacologically targeting KRAS(G12C), the remaining RAS mutants lack readily tractable chemistries for development of covalent inhibitors. Thus, alternative approaches are needed to develop broadly efficacious RAS inhibitors. We have utilized Monobody (Mb) technology to identify vulnerabilities in RAS that can potentially be exploited for development of novel RAS inhibitors. Here, we describe the methods used to isolate RAS-specific Mbs and to define their inhibitory activity.

Keywords: Transfection, PEI, RAS, Monobody, HEK293, NIH/3T3, RAS foci, cell signaling, tumorigenesis, soft agar assays, xenograft tumor assays

1. Introduction

Monobodies (Mbs) are single-domain, molecularly engineered binding proteins that achieve levels of affinity and selectivity comparable to antibodies (6). In contrast to antibodies, however, Mbs remain fully functional in the reducing environment of the cytosol thus enabling their use as genetically encoded intracellular reagents. Furthermore, Mbs frequently bind regions in their target that are critical for function (6). Thus, Mbs often serve as highly specific inhibitors. Indeed, we recently described the isolation and characterization of NS1 Mb that selectively binds HRAS and KRAS with high affinity but does not interact with NRAS or other RAS-related proteins (7). NS1 hAS provided unique insight into RAS function, revealing the importance of the α4-α5 interface of RAS for dimerization, RAS-mediated signaling and oncogenic transformation (7). Indeed, NS1 represents the first experimental reagent that allows for modulation of RAS dimerization (7-10). Given the success of NS1, we have applied Mb technology to the discovery of additional functionally critical regions of RAS. Here, we describe methods to isolate and characterize RAS-specific Mbs (Figure 1).

Figure 1. Monobody analysis strategy.

Figure 1.

Open in a new tab

Outline of strategy to isolate RAS-specific Mbs using phage display selection followed by affinity maturation in yeast display format. Isolated RAS Mbs are then subcloned into mammalian expression vectors for transient and stable expression as well as chemically regulated expression in various human tumor lines. The described analyses are not meant to be exhaustive but rather a standard approach for initial characterization of RAS-specific Mb clones. Additional analyses may be performed to further define the mechanism of action of a particular Mb.

2. Materials:

2.1. Reagents and cell lines

HA-tagged RAS expression vectors (pCGN-based) – available by request from authors, AddGene and other sources.

pECFP-NS1 (Catalog number: 85739; AddGene, USA)

pCW5.1-CFP-NS1: available by request.

pMD2.G (VSV-G envelope) (Catalog number: 12259; AddGene, USA)

pCMVR8.74 (packaging vector) (Catalog number: 22036; AddGene, USA)

Dulbecco's Modified Eagle Medium (DMEM media) (Corning, USA)

Opti-MEM (Gibco, USA)

Fetal bovine serum (FBS)

Calf serum (CS)

Polyethylenimine (PEI) linear, MW 25,000 (Polysciences, Inc. https://www.polysciences.com)

CellTiter-Glo® 2.0 Cell Viability Assay (Catalog number: G9241;Promega, USA)

Gibson Assembly® Cloning Kit (Catalog number: E5510S; NewEngland BioLabs, USA)

Collagenase, Type 4 (Worthington Biochemical Corporation, USA)

Elastase (Worthington Biochemical Corporation, USA)

Penicillin-Streptomycin (Gibco, USA)

Human tumor cell lines of interest:

ATCC or other distributors.

Athymic nude mice:

Crl:NU(NCr)-Foxn1nu (homozygotes). Available from Charles River Laboratories or Taconic Biosciences, Inc.

Antibodies:

Anti-HA monoclonal (Clone 16B12, Biolegend #90154), anti-HA polyclonal (Poly9023, Biolegend #923502), anti-FLAG monoclonal (Clone M2, Sigma #F1804), anti-FLAG polyclonal (Sigma #F7425), anti-MYC (Clone A46, Millipore-Sigma #05-724), anti-phospho-ERK (Thr202/Tyr204, CST #9101), anti-total ERK (CST #9102), anti-phospho-AKT (Ser473, CST #9271), anti-AKT (Thr308, CST #4056), anti-CRAF (BD #610152), anti-BRAF (Santa Cruz #sc-9002), anti-phospho-MEK (Ser217/221, CST#9121), total MEK (CST #9126). Protein A agarose beads (Thermo Fischer Scientific #15918014), Protein G agarose beads (Santa Cruz # sc-2002)

Kinase-dead MEK

kindly provided by Dr. Deborah Morrision (11)

Solutions and buffers:
PEI (1mg/ml):

Dissolve 10 mg of PEI in 3 ml of ethanol. Warm the solution to 37°C. Add 7 ml of sterile distilled water, so that final ethanol concentration is not more than 30%. Store at −80°C in small aliquots (Note 1)

Fixative Solution:

30% methanol, 10% acetic acid.

Crystal Violet stain:

0.1% crystal violet solution (made in 25% methanol and stored at room temperature)

PLC Lysis Buffer:

(50 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1 mM EGTA, 1.5 mM MgCl2, 100 mM sodium fluoride). Supplement with 1 mM vanadate, 10 μg/ml leupeptin and 10 μg/ml aprotinin immediately prior to use.

in vitro Kinase Buffer:

20 mM Tris (pH 7.4), 20 mM NaCl, 1 mM DTT, 10 mM MgCl2, 1 mM MnCl2 and 20 μM ATP.

2xHBSS:

280 mM NaCl, 1.5 mM Na2HPO4, 12 mM Dextrose, 50 mM HEPES, (pH to 7.05).

2.5 M CaCl2:

Dissolve 5.55 g of calcium chloride in 20 ml of deionized water, filter sterile and store at RT.

Polybrene (Hexadimethrine bromide) (Sigma USA):

Make stock solutions of 8 mg/ml in deionized, autoclaved water. We recommend a working concentration of 8 μg/ml. Polybrene can be toxic to some cells and should be tested prior to use.

Soft Agar stock:

Mix 2.5 g of DIFCO Noble agar (Detroit, MI) in 50 ml distilled water and then autoclave to dissolve and sterilize. Aliquots can be stored at RT until needed.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltretrazolium bromide (MTT) solution:

Dissolve 20 mg in 10 ml distilled, deionized water and filter sterilize. Store at −20°C in container protected from light.

Matrigel:

(Corning, USA)

Stock doxycycline (DOX) solution:

Dissolve 50 mg DOX/ml in 50% ethanol. Store at −20°C in container protected from light.

DOX drinking water:

Mix 18 ml of stock DOX solution with 410 mls of autoclaved water and 22.5 mls of 20% sucrose solution. Add 125 mls to bottles for mice. Cover bottles with aluminum foil to protect from light.

3. Method:

3.1. Isolation of RAS-specific Mb.

Previous methods have been published on the isolation and affinity maturation of Mbs to a protein of interest (12,13). These methods have been adapted to screen for RAS-specific Mbs using bacterially expressed RAS proteins encompassing the RAS G-domain (amino acids 1-166 or 1-174) [(7), and data not shown]. The in vitro specificity and affinity of individual Mb clones toward bacterially expressed RAS proteins is then determined using yeast display technology as previously described (14) (Figure 1).

Once a RAS-specific Mb has been isolated and characterized in vitro, the next step is to determine the in cellulo and in vivo selectivity toward the different RAS isoforms and oncogenic variants (Figure 1). As a general approach, Mb cDNAs are cloned into a mammalian expression construct encoding a fluorescent protein [e.g., pECFP-C1 (Clontech)] along with a FLAG epitope (DYKDDDDK) (15) thereby allowing for microscopic visualization and analysis by immunoprecipitation and Western blotting. A control Mb in which the amino acids in the BC and FG loops are changed to Ser resulting in a non-functional binder [Mb(Neg) (16)] is used as a negative control along with CFP-FLAG alone. RAS proteins are expressed from mammalian expression vectors that provide for a complementary epitope tag such as HA or MYC. Our typical approach is to use HA-epitope [YPYDVPDYA]-tagged RAS constructs; however, alternative epitope tags are also available (17). Mbs are tested for their inhibitory effects on RAS-mediated signaling, RAS effector interaction and biological transformation. Finally, chemically regulated Mb expression constructs are utilized to examine their efficacy at inhibiting biological transformation in vivo.

3.2. Subcloning Mb sequences

  1. Mb cDNA sequence are PCR amplified from a bacterial expression vector or yeast display vector using a high-fidelity polymerase and the following primers: 5'GibsonMb: GACGATGACGACAAGGGATCCGTTTCTTCTGTTCC; 3'GibsonMb: TCAGTTATCTAGATCCGGTGGATCCCTAGGTACGGTAGTTAATCGAGATTGG (Note 2).

  2. Digest CFP-NS1 (AddGene Catalog Number: 85739) with BamHI to release the NS1 Mb sequence from the vector (pECFP with a FLAG epitope). The vector band is gel purified for use in subcloning.

  3. The Mb PCR fragment is cloned into CFP-FLAG using the Gibson Assembly Cloning Kit (Note 3) according to the manufacturer’s instructions.

  4. The resulting bacterial colonies are screened by colony PCR using the following PCR primers: 5’ GFP: 5’ CATGGTCCTGCTGGAGTTCGTG; 3’ Mb: 5’ GGTACGGTA GTTAATCGAGATT (Note 4). DNA from positive clones is then isolated and sequence verified to confirm the integrity of the Mb sequence.

  5. To generate the tet-regulated Mb expression lentiviral vectors, use the sequence verified pCFP-Mb construct from step #4 as template and PCR amplify the Mb cDNA sequence with the following primers: 5’GibsonMb (see step #1 above): 3’GibsonMbpCW5: GGCGCAACCCCAACCCCGGCCTAGGTACGGTAGTTAATCG AGATTGG.

  6. Digest pCW5.1-CFP-NS1 with BamHI to release the NS1 Mb sequence. The vector band is gel purified for use in subcloning.

  7. The Mb PCR fragment from Step #4 is cloned into pCW5.1-CFP using the Gibson Assembly Cloning Kit (Note 3) according to the manufacturer’s instructions.

  8. The resulting bacterial colonies are then screened by PCR as in step #4 above. Positive colonies are sequence verified to confirm the integrity of the Mb sequence.

  9. DNAs for each of the Mb expression constructs are then purified for transfections.

3.3. Transfection

To determine the in cellulo specificity of Mbs for different RAS isoforms and mutants, Mb expression constructs are transiently expressed in HEK293 cells along with different RAS isoforms/mutants. FLAG-tagged CFP or CFP-Mb(Neg) is used as a negative control. While various commercially available lipid-based transfection reagents are available, most are costly. Here, we provide a detailed, cost effective alternative transfection method using polyethylenimine (PEI) to achieve similar levels of transfection efficiency in a wide range of cell lines (18,19). Prior to performing any analysis, it is necessary to empirically determine the ratio of DNAs for RAS and Mbs needed to achieve uniform expression of the proteins across samples. Once uniform expression is achieved, cell lysates are used for the experimental analyses detailed below.

  1. One day before transfection, seed 1x106 cells per 60 mm2 dish and then place in 37°C incubator with 5% CO2 (Note 5).

  2. On the following day, replace media with fresh DMEM to clear metabolites and incubate at least 2 hrs with fresh media before proceeding with transfection. Transfections should be done in the absence of antibiotics.

  3. Add 200 μl Opti-MEM to 1.5 ml centrifuge tube followed by PEI. The volume of PEI is dependent on the amount of DNA to be transfected. Typically, 3 μl of 1 mg/ml PEI stock is used for each μg of DNA. Incubate 10 minutes at room temperature (Notes 6 and 7).

  4. Add DNA to Opti-MEM:PEI cocktail and incubate at least for 20 minutes at room temperature.

  5. Next, remove cells from incubator and gently wash once with serum-free DMEM.

  6. Add 2ml serum-free DMEM to 60 mm2 dish then gently pipette the Opti-MEM:PEI:DNA solution on to cells so as not to disrupt the adherent monolayer.

  7. Return dishes to the 37°C incubator and incubate for three hours (Note 8).

  8. Remove media with transfection mixture and replace with fresh medium containing serum and return to incubator for 48-72 hrs.

  9. Remove cells from incubator and gently wash cells 1x with PBS.

  10. Lyse cells in 500 ul cold PLC lysis buffer and transfer lysate to microfuge tube on ice.

  11. Incubate lysate for 30 min on nutator at 4°C.

  12. Spin lysates at 4°C in microfuge at 14,000 RPM for 10 min to pellet insoluble debris.

  13. Transfer lysates to fresh microfuge tubes.

  14. Measure protein concentrations of samples.

  15. Samples are then analyzed by SDS-PAGE and Western blot analysis for the expression of the HA-RAS and FLAG-Mb constructs. Equal amounts of protein from each sample are fractionated on SDS-PAGE gels and then transferred to PVDF membranes for Western blot analysis with anti-HA and anti-FLAG antibodies.

3.4. Co-immunoprecipitation (co-IP) analysis of Mbs with RAS

  1. Once the concentrations of DNAs have been determined such that RAS expression is equivalent between samples with different Mbs and controls, repeat transfections as described in Section 3.3.

  2. Aspirate the media from culture plates and wash cells once with PBS.

  3. Add PLC lysis buffer to the plates (Note 9) and scrape the cells in lysis buffer.

  4. Transfer samples to 1.5 ml microfuge tubes and nutate at 4°C for 30 minutes.

  5. Centrifuge the samples at 14,000 RPM for 10 minutes at 4°C.

  6. Transfer the cleared cell lysates to fresh microfuge tubes (Note 10).

  7. Determine protein concentrations of lysates. Aliquot 500-1000 μg of protein for each sample to tubes and bring to equivalent volumes with PLC buffer.

  8. Add 2-4 μg of 1° antibody (e.g., anti-FLAG) for IP and incubate for 1 hr at 4°C on nutator.

  9. Add 30 μl of 50% slurry per 1000 μg of lysate of either Protein A or Protein G beads and incubate for 1 hr at 4°C on nutator (Note 11).

  10. Pellet complexes in microfuge at 3500-4000 RPM at 4°C for 3 minutes then aspirate the supernatant and wash immunocomplexes with 500 μl PLC buffer. Repeat wash steps at least 3x (Note 12).

  11. Resuspend beads in 50 μl of 2X Sample Buffer, heat at 70°C for 10-15 minutes, and then analyze a portion by Western blot to determine levels of immunoprecipitated Mbs (anti-FLAG).

  12. Once uniform immunoprecipitation of Mbs is confirmed, the association of Mbs with RAS isoforms/mutants is determined by anti-HA Western blot analysis of the anti-FLAG IP (Figure 2).

Figure 2. Analysis of Mb binding to RAS.

Figure 2.

Open in a new tab

HEK293 cells were transiently transfected with expression constructs encoding the indicated HRAS mutants along with Mb expression constructs encoding NS1 or a novel RAS-specific Mb, Mb-A. Samples were processed as described in Section 3.3.

3.5. Inhibition of RAS-mediated signaling

The RAF-MEK-MAPK pathway is arguably the most important RAS effector pathway. To evaluate the inhibitory effects of Mbs on RAS signaling, we determine the efficacy of Mbs at inhibiting ERK-MAPK activation following growth factor stimulation or expression of oncogenic RAS. As controls for off-target effects, we examine the ability of Mbs to inhibit signaling from activated forms of RAF or MEK kinases that function downstream of RAS and therefore, should be refractory to inhibition by RAS-specific Mbs.

3.5.1. Analysis of Mb effects on EGF-stimulated ERK activation

  1. Co-transfect HEK293 cells as in Section 3.3 with constructs encoding MYC-ERK (see Note 13) and CFP-Mbs. CFP-FLAG or CFP-Mb(Neg) is used as a negative control. The transfection procedure is same as described in Section 3.3.

  2. Forty-eight hours after transfection, cells are serum starved overnight and then treated with EGF (10-100 ng/ml, 10 min at 37°C).

  3. Following EGF stimulation, cell lysates are harvested as above and then analyzed by Western blot for expression of CFP-Mbs and MYC-ERK using anti-FLAG and anti-MYC antibodies, respectively.

  4. Once uniform expression of constructs is confirmed, MYC-ERK is immunoprecipitated from 250-500 μg of lysate essentially as described in Section 3.4.

  5. A portion of the IPs is analyzed by Western blot using antibodies to pERK and total ERK.

  6. These methods can also be adapted to analyze the effects of RAS-specific Mbs in RASless MEFs (Note 14).

3.5.2. Analysis of Mb effects on oncogenic RAS activation of ERK

  1. Co-transfect HEK293 cells as in Section 3.3 with constructs encoding MYC-ERK, CFP-Mb and the various RAS mutants of interest. CFP-FLAG or CFP-Mb(Neg) is used as a negative control (Note 15).

  2. Forty-eight hours after transfection, cells are serum starved overnight.

  3. Cell lysates are harvested and probed for expression of Mbs (anti-FLAG), RAS (anti-HA), and ERK (anti-MYC). MYC-ERK is immunoprecipitated and analyzed as described in Section 3.5.1.

  4. As specificity controls, we also examine the effects of Mbs on signaling from kinases downstream of RAS such as oncogenic BRAF(V600E) and oncogenic MEK(DD). Experiments are performed as described above but substituting BRAF or MEK constructs in place of RAS in the transfections. RAS-specific Mbs should ideally have no or minimal effects on MAPK activation by oncogenic BRAF or MEK (Figure 3).

Figure 3. Cell Signaling Assays.

Figure 3.

Open in a new tab

Mb expression constructs were co-transfected with oncogenic HRAS(Q61L) or oncogenic MEK(DD) along with MYC-tagged ERK. Samples were processed as described in Section 3.4b. CFP-NS1 inhibited ERK activation by oncogenic HRAS(Q61L) but not MEK(DD).

3.6. Inhibition of RAS: effector interaction

3.6.1. RAS: RAF interaction

RAS interacts with numerous downstream effectors including RAF, PI3K, RALGDS, etc. (20-22). Here, we describe a method to evaluate the effects of Mbs on RAS:RAF association and RAS-induced CRAF:BRAF heterodimerization which is essential for RAF activation (7,11,23). These procedures can be adapted to study effects of Mbs on RAS interaction with additional effectors such as PI3K and RALGDS.

  1. Co-transfect HEK293 with HA-tagged oncogenic RAS mutants and Mbs essentially as described in Section 3.3. CFP or CFP-Mb(Neg) is used as a negative control.

  2. Forty-eight hours after transfection, cells are serum starved overnight.

  3. Once the uniform expression is confirmed, lysates are evaluated for active pERK and total ERK to confirm that Mb expression levels are sufficient to inhibit RAS signaling (Note 15).

  4. Approximately 1mg of cell lysate is used for immunoprecipitation with anti-HA antibodies as described in Section 3.4.

  5. Immunoprecipitates are then analyzed by Western blot for co-precipitation of CRAF and BRAF with HA-tagged RAS.

3.6.2. RAS-induced RAF dimerization

  1. HEK293 cells are co-transfected with expression constructs encoding HA-tagged oncogenic RAS and Mbs as described in Section 3.3. CFP or CFP-Mb(Neg) is used as a negative control. An additional negative control consists of cells that have not been transfected with oncogenic RAS. This sample will serve as the baseline for levels of CRAF:BRAF heterodimers.

  2. Forty-eight hours after transfection, cells are serum starved overnight.

  3. Approximately 2 mg of cell lysate is used for immunoprecipitation of CRAF essentially as described in Section 3.4.

  4. The CRAF IPs are analyzed by Western blot with both CRAF and BRAF antibodies to determine the effect of Mbs on oncogenic RAS-mediated CRAF:BRAF heterodimerization.

3.6.3. RAF activation

RAF proteins (ARAF, BRAF, and CRAF) are serine-threonine kinases that phosphorylate MEK (7,24) Thus, RAS inhibitory Mbs should inhibit RAS-stimulated activation of RAF kinase activity as measured by the ability of RAF to phosphorylate MEK.

  1. HEK293 cells are co-transfected with expression constructs encoding HA-tagged oncogenic RAS and Mbs as described in Section 3.3. CFP or CFP-Mb(Neg) is used as a negative control.

  2. Forty-eight hours after transfection, cells are serum starved overnight.

  3. Approximately 2 mg of cell lysate is used for immunoprecipitation of CRAF as described in Section 3.6.2.

  4. Wash immunoprecipitates 2-3x with 1 ml PLC lysis buffer. After the last wash carefully aspirate remaining buffer and resuspend in 40 μl kinase buffer.

  5. Add 2μl of purified, kinase dead MEK1 and incubate for 30 minutes at 30°C with constant shaking.

  6. Terminate reactions by addition of 15 μl of sample buffer heated to 70°C.

  7. A portion of each kinase reaction is analyzed by Western blot using antibodies to phospho-specific MEK, total MEK and C-RAF.

  8. To determine effect of Mb on RAF activity, level of reactivity to each antibody is quantified using image analysis software (Note 16).

  9. Next, determine the ratio of pMEK/total MEK/CRAF for each sample and divide these values by the ratio for the control sample, either CFP or CFP-Mb(Neg).

3.7. NIH/3T3 Focus Formation Assay

NIH/3T3 cells normally proliferate until they reach a confluent monolayer. However, expression of oncogenic RAS alters the proliferative capacity and morphological architecture of cells resulting in their loss of contact inhibition and continued growth leading to the formation of multilayered, dense foci that are easily visualized and quantified. This assay is based on the focus formation assay developed by Howard Temin for calculating the titrating units of retroviruses in chicken embryonic fibroblasts and has been widely used to measure the transforming activity of many cellular oncogenes (25,26). Thus, this assay serves as an efficient tool for assessing the qualitative and quantitative effect of Mbs on RAS transforming activity. The procedure for transfecting NIH/3T3 cells is essentially as described for HEK293 cells with slight modifications.

  1. NIH/3T3 cells must be revived fresh, passaged no more than 2-3x after thawing from liquid nitrogen and passaged when they reach 60-70% confluence to avoid spontaneous transformation and appearance of background foci.

  2. One day before transfection, seed 2.5x105 cells per 60 mm2 dish and place in the 37°C incubator, 5% CO2 O/N.

  3. Aliquot 10 μl of 1 μg/μl PEI stock for each μg of DNA for NIH/3T3 transfections. Add 20 ng DNA of HRAS or NRAS mutant and 50 ng of KRAS mutant per 60 mm2 dish for transformation assays.

  4. Incubate cells with transfection mixtures up to five hours (Note 17) then remove media and replace with serum-containing media.

  5. Change the media every 2-3 days for up to 3 weeks. For oncogenic RAS, foci begin to emerge approximately 10 days post-transfection. Assays are usually terminated by 3 weeks due to the size and number of foci.

  6. Fix cells in 30% methanol/10% acetic acid once foci reach sufficient size for counting (Note 18).

  7. Stain cells with 0.1% crystal violet stain. Add sufficient stain to completely cover plate and incubate for at least 10-15 min. Remove stain and rinse plates in water to de-stain (Figure 4).

  8. Count the foci. Foci smaller than observed in non-transfected controls are not considered.

  9. Experiments are performed in triplicate and repeated at least three times. Results are presented as total foci numbers per plate. Alternatively, we normalize the foci number with vector controls and represent results as the ratio of foci number in presence of CFP-Mb vs CFP alone. As controls for specificity toward RAS, we include oncogenes downstream of RAS (e.g., oncogenic BRAF or MEK) which should be unaffected by RAS-specific Mbs. In addition, CFP-Mb(Neg) serves as a negative control for inhibition of RAS.

Figure 4. NIH/3T3 focus formation assay.

Figure 4.

Open in a new tab

NIH/3T3 cells were transfected with oncogenic HRAS(Q61L) or BRAF(V600E) along with CFP, CFP-NS1 of CFP-Mb-A. Cells were stained to visualize foci as described in Section 3.6.

3.8. Chemically regulated Mb expression in human tumor cells

For generating human tumor cell lines with regulated Mb expression, CFP-tagged Mbs are subcloned into a tetracycline-regulated expression constructs that allow for chemically regulated expression of Mbs following treatment with the tetracycline analog, doxycycline (DOX) (7,9). We utilize lentiviral-based constructs (e.g., pCW57-MCS1-2A-MCS2 or pTRIPz) that allow for infection of a wide range of human and mouse cell lines.

3.8.1. Calcium phosphate transfections for lentivirus production:

  1. One day prior to transfection, plate HEK293T cells at the density of 2x106 per 100 cm2 dish.

  2. Prepare the following DNAs: 5 μg of pMD2.G, 15 μg of pCMVdR8.74, 20 μg of transfer plasmid (pCW5.1-CFP-Mb) in total volume of 450 μl with autoclaved nuclease-free water.

  3. Add 50 μl of 2.5 M CaCl2 dropwise to the DNA mix.

  4. Transfer this DNA-mixture to 500 μl of 2xHBSS drop wise with gentle mixing.

  5. Gently blow bubbles into the solution with a pipette tip several times while mixing.

  6. Incubate at room temperature for 40-60 minutes.

  7. Pipette DNA precipitate several times to mix and then gently add to cells. Incubate O/N in tissue culture incubator.

  8. On the following morning, remove media from cells and replace with 10 ml of fresh complete media.

  9. To generate virus conditioned media, remove media from cells at end of day and replace with 6 mls fresh media (Note 19).

  10. On the following morning, harvest conditioned media containing virus and filter through 0.45-micron syringe filter to remove cell debris. Filtered supernatant can be used directly to infect cells or stored at −80°C.

  11. Add an additional 6 mls of media to cells and incubate 4-8 hrs.

  12. Remove virus-containing media, filter through 0.45-micron syringe filter to remove cell debris, and then store at −80°C.

3.8.2. Generation of stable human cell lines with regulated Mb expression:

  1. Plate cell line of interest at a density of 2x105 cells per well in a 6-well plate.

  2. For infection, add viral supernatant supplemented with 8 μg/ml of polybrene. The amount of virus needed should be determined empirically.

  3. Incubate cells O/N in tissue culture incubator.

  4. Remove media, replace with fresh complete media, and incubate at least six hours to allow cells to recover.

  5. Add drug for selection of stably infected cells at required concentration. A plate of cells not receiving viral supernatant is used as a control for selection.

  6. Replace media every 2-3 days until all cells on uninfected control plate have died. Cells infected with virus should have established colonies of selected cells in approximately 2 weeks.

  7. Colonies can be clonally selected and passaged. Alternatively, colonies are pooled to generate a polyclonal line in which Mb expression is induced upon treatment with DOX.

  8. To test for DOX-regulated Mb expression, plate selected cells at 2x105 per well in a 6-well plate and let recover O/N.

  9. Add varying concentrations of DOX (e.g., 0.5-8 μg/ml) to all but one well of the 6-well plate then return plate to incubator.

  10. Mb expression is assessed by fluorescence after 1-2 days of DOX treatment. In addition, cells are lysed and examined by Western blot to determine levels of Mb expression and its effects on ERK activation by Western blot of cell lysates using anti-phosphoERK and anti-total ERK antibodies (Figure 5A).

Figure 5. Analysis of RAS-specific Mb effects in human tumor cells.

Figure 5.

Open in a new tab

The pancreatic cancer cell line CFPAC-1 was infected with a DOX-inducible expression construct encoding CFP-NS1 and then stable selected in antibiotic-containing media to generate a polyclonal cell line, CFPAC-1NS1. (A) CFPAC-1NS1 cells were plated in duplicate wells and then treated with DOX for 72 hrs. Lysates were then analyzed by Western blot for Mb expression (top panel) and ERK activation (bottom 4 panels). Vinculin was used as a normalization control on blots for pERK or total ERK. (B) CFPAC-1NS1 cells were plated in soft agar as described in Section 3.9

3.9. Effects of Mb on proliferation of RAS mutant oncogenic lines

There are various commercially available methods to measure cell proliferation. We utilize CellTiterGlo luminescent cell viability assay that quantifies the levels of ATP as an indicator of the number of metabolically active cells (27,28).

  1. Seed 1-2 x103 cells per well in a 24-well clear tissue culture plate in 400 μl media. We typically measure cell number on days 1, 3, 5, 7 and 9. For each time point, cells are plated in triplicate for both ±DOX treatment.

  2. On the following day, add DOX to wells assigned for DOX treatment. We typically use 1-2 μg/ml of DOX for induction of Mb. Replace the media and add fresh DOX every 48 hours.

  3. To measure cell number, remove media and replace with 100 μl of serum-free media.

  4. Incubate for 20 min at 37°C, 5% CO2.

  5. Add 100 μl of CellTiterGlo (Promega) reagent to each well on 24-well dish, scrape with the pipette tip and transfer all 200 μl to a well of a white opaque 96-well plate.

  6. Repeat the process for all wells/conditions.

  7. Include triplicates of 100 μl media + 100 μl reagent, as blank.

  8. As a control to normalize results between days, include triplicates of 100 μl of ATP (1 μM) + 100 μl reagent.

  9. Record luminescence (Note 20).

  10. Repeat steps 5-8 for measurement of each time point.

  11. Sample values (minus blank control) between days are normalized to the ATP reference standard and plotted to generate growth curves.

3.10. Effects of Mbs on anchorage-independent growth

One hallmark of RAS-mutant tumor cells is their ability to grow under anchorage-independent conditions. To assess the ability of Mbs to inhibit RAS, polyclonal Mb expressing cells generated above are plated in soft agar and monitored for growth in the absence (-DOX) and presence (+DOX) of Mb expression (9,29).

  1. Melt agar and then cool to 45°C in water bath (Note 21).

  2. To prepare bottom layer, mix 1 part 5% agar and 9 parts media (with selection) to generate 0.5% agar bottom layer. For samples with Mb expression, DOX is added to the bottom layer.

  3. Add 2 mls per each well of a 6-well plate.

  4. Let agar solidify in tissue culture hood at RT for >15 minutes.

  5. Prepare cells for top agar layer (Note 22).

  6. Warm cell suspension briefly to 45°C (2 minutes).

  7. Add twice the volume of 0.5% agar/medium solution at 45°C (final agar 0.33%) to each tube of cells.

  8. Carefully layer 3 ml agar/cell suspension onto bottom agar layer.

  9. Let plates set at room temperature in tissue culture hood for at least 30 min prior to returning to 37°C incubator, 5% CO2.

  10. Feed cells 1-2 times per week by careful drop wise addition of growth media to top layer. Remove old media prior to subsequent feedings. Let cells grow for approximately 3 weeks until visible colonies emerge.

  11. Colonies are quantified following staining with MTT. Overlay soft agar plates with 100 μl solution of MTT (2 mg/ml water) and incubate at 37°C for 4 hours (Figure 5B).

  12. Colonies are quantified using NIH Image J software. Briefly, open a digital image (TIFF) of each plate with ImageJ and use the line tool to draw a line across the width of a well. Go to image settings> adjust> set the threshold. This results in a black and white binary image where the colonies are shown as black dots on a white background. Use the circle tool to draw around the well you want to measure. Next select “Analyze” > “Measure Particles”. Set the scale to measure colonies in the range of 0-infinity and circularity 0.00-1.00 then select “Show” then “Outlines”. Check the Display Results box, and then select “OK”. This will measure the number of colonies in the well. Simply move your circle to the next well and repeat.

3.11. Xenograft tumor assays:

Nude mouse tumor assays represent a robust biological assay to assess the efficacy of anti-RAS therapies. In this assay, human cancer cells are injected subcutaneously into the flanks of immunocompromised mice, and the response of emergent tumors to therapeutic regimes is evaluated. To determine the anti-tumor effects of Mbs, human cancer lines generated in Section 3.8.2 are injected into athymic nude mice and assessed for their ability to form tumors in the absence or presence of Mb expression following DOX administration.

  1. Grow the requisite number of cells in 150 mm2 dishes (Note 23).

  2. Wash cells with PBS (10 ml per plate) then harvest by trypsinization.

  3. Combine cells and wash thoroughly with complete media to remove residual trypsin.

  4. Aspirate media and combine pellets in 30 ml serum-free media.

  5. Resuspend cells, dilute 10μl of cells suspension in 490 μl media (1:50 dilution) and count.

  6. Aliquot 7.5X107 cells to a tube, centrifuge at 1,500 RPM for 8 min, resuspend cell pellet in 900 μl media, and cool on ice for 5 minutes (number of cells assumes 5X106 cells injected per mouse)

  7. Thaw Matrigel O/N at 4°C and aliquot to individual pre-cooled tubes on ice. Add 60μl of cell suspension to each 60μl aliquot of Matrigel tube and place on ice.

  8. Pre-cool 1 ml syringes and 26-gauge needles to ensure that the Matrigel does not begin to solidify prior to injecting mice.

  9. Transfer cell suspensions to ice, along with needles and syringes.

  10. Draw 120 μl cell suspension into syringe.

  11. Insert needle, bevel side up, under mouse skin. Gently lift needle and continue to insert about 1 cm under the skin with point slightly angled towards the body of the mouse being careful that needle remains under skin.

  12. Carefully inject the entire cell suspension then gradually withdraw the needle (Note 24).

  13. To induce Mb expression, a cohort of animals are provided 150 mls DOX water (2mg/ml DOX) 24 hrs. following cell injections. Drinking bottles are changed every 2-3 days (Note 25).

  14. To assess whether Mbs promote tumor regression, mice are provided DOX water once tumors reach 50-200 mm3 volume.

  15. Mice are observed 2x per week until tumors begin to emerge and then tumor volumes are measured every other day until human endpoints are reached (Note 26).

  16. Upon reaching experimental endpoints, tumors are harvested from animals (Note 27).

3.12. Tumor cell line generation:

  1. Euthanize mouse and spray with 70% Ethanol

  2. Harvest a small amount of tumor (~0.5-1 mm) and transfer tumor fragments into 60 mm2 dishes with 10 ml enzyme solution (Collagenase c.f 1 mg/ml, Elastase c.f ~0.744 units/ml, Pen/Strep c.f 1%) in HBSS buffer. (c.f : final concentration).

  3. Use sterile scalpel or scissors to cut tumors into fine fragments and let the tumor fragments incubate in enzyme solution at 5% CO2, 37°C for 2-3 hours. Mix the tumor fragment solution several times during the incubation period with a sterile 5 ml pipette to further aid in cell dissociation.

  4. Centrifuge the enzyme solution at 1500 rpm for 6 min to pellet dissociated cells.

  5. Remove supernatant and then resuspend pellet with fresh 25 ml culture medium. Centrifuge at 1500 rpm for 6 minutes to pellet cells.

  6. Aspirate media and then resuspend cell pellet in 10 ml of desired culture media.

  7. Transfer to 100 mm2 dishes with fungizone (1 ug/ml) and antibiotic selection for Mb expression construct (e.g. puromycin). This selection will also eliminate any murine cells.

  8. Let cells seed O/N. On the following day, wash with PBS and add culture media with fungizone and antibiotic selection (Note 28). Normally cell should be ready to passage in a couple of days. However, we typically culture for about a week with fungizone to prevent fungal growth and then remove from routine culturing of cells.

  9. Tumor cell lines can then be frozen after about 2 weeks in antibiotic selection for later analysis (Note 29).

Acknowledgements

This work was supported in part by a Merit Review Award (1I01BX002095) from the United States (US) Department of Veterans Affairs Biomedical Laboratory Research and Development Service, NIH awards (CA212608 and CA138313), and start-up funds from the Hollings Cancer Center at MUSC to JPO. The contents of this article do not represent the views of the US. Department of Veterans Affairs or the United States Government.

Footnotes

1.

PEI stored at −80°C can be used at least two times after freeze thaw without a decrease in efficacy.

2.

The PCR product should be verified on an agarose gel.

3.

Alternative approaches to subcloning can be used. We have observed greater than 90% success rate in isolating clones with inserts using this approach.

4.

We typically use a small volume PCR reaction (20-25 ul/per colony) with a low-cost thermostable polymerase such as Taq polymerase. To select a colony, use a sterile pipette tip to gently touch the bacterial colony and then transfer a small portion to the PCR reaction. Reactions are subjected to the following cycling parameter: 1 cycle-94°C, 5 min, 50°C, 30sec, 72°C, 1 min; 30 cycles-94°C, 30sec, 50°C, 30sec, 72°C 1 min; 1 cycle 94°C, 30sec, 72°C 10 min; soak at 4°C. Approximately 5-7 ul of the reaction is analyzed on an 0.8% agarose gel in 1xTAE buffer. Clones with inserts will result in an ~390 bp fragment, depending on the Mb. Given the success rate of the Gibson Assembly Kit, we screen between 12-24 colonies for inserts.

5.

Cells are passaged at least once after thawing from liquid nitrogen, adapted to the media, and free of any mycoplasma contamination.

6.

Opti-MEM and cell growth media are warmed to 37°C prior to use. The volume of Opti-MEM used is 1/10 the final volume of serum-free media added to cells.

7.

Amount of RAS expression vectors to be transfected depends on the RAS isoform being studied. Equivalent μg amounts of HRAS and NRAS express equally while KRAS expression is typically lower. To achieve equal expression among various isoforms, we normally use two-fold more KRAS vs H/NRAS.

8.

Avoid incubating HEK293 cells with PEI-transfection mixture for more than three hours to reduce cell toxicity and death.

9.

Amount of PLC depends on the size of tissue culture plate. We usually use 500 μl for 35 cm2 plate, 750 μl for 60 cm2 plate and 1 ml for 100 cm2 plate.

10.

Lysates can be used directly for protein estimation and analysis or stored at −80°C for later use.

11.

Choice of Protein A vs Protein G beads is dependent on the immunoglobulin subtype and the species in which the antibody was generated. Protein A agarose beads work optimally for antibodies raised in rabbits whereas Protein G agarose beads are optimal for antibodies raised in mice.

12.

When aspirating the supernatant, it is best to leave a small volume of buffer (~ 50 μl) in each tube to avoid aspirating beads which will result in uneven results. After the last wash, carefully remove as much supernatant as possible leaving equivalent amounts in all tubes.

13.

MYC-ERK is co-transfected to measure the effects of Mbs on ERK activation only in transfected cells. Activation of endogenous ERK can be measured by Western blot analysis of cell lysates directly with anti-pERK and total ERK antibodies. However, this approach may underestimate the effects of the Mbs on RAS-mediated signaling. To assess the effects of Mbs on RAS-mediated activation of PI3K-AKT pathway, experiments are performed essentially as described for analysis of ERK except HA-AKT is substituted for MYC-ERK in the co-transfections. HA immunoprecipitates are then analyzed for total AKT and pAKT with activation specific antibodies to Ser473 and Thr308 of AKT.

14.

RASless MEFs are genetically modified mouse embryonic fibroblasts that lack all three RAS genes (30). However, these cells can be engineered to express only a single RAS isoform or a constitutively activated BRAF(V600E). Thus, a RAS-specific Mb should inhibit MAPK activity only in cells expressing the RAS isoform targeted by the Mb but not cells expressing BRAF(V600E).

15.

For optimal inhibition of RAS signaling, Mb expression needs to be >2.5 times RAS expression (8). This is determined by co-transfection of RAS and Mb constructs with the same epitope tags. Careful titration of Mb expression levels can then be assessed by Western blot analysis of transfected cells to determine the ratio of Mb to RAS for optimal inhibition.

16.

We use Image Studio Lite (v5.2.5, LI-COR Biosciences, USA) to quantify images obtained on a BioRad Gel Doc Image station. However, alternative approaches can be used to quantify gel bands include Image J or other imaging software.

17.

Longer incubations of NIH/3T3 cells in serum-free media leads to cell death due to serum deprivation. Incubation times should be determined empirically to maximize transfection efficiency while minimizing cell loss.

18.

Assays should be stopped before foci grow too large and begin to merge with one another.

19.

To obtain optimal infection of recipient cells, replace media with the same media used to culture cells that will be infected with virus.

20.

Instrument settings depend on the manufacturer.

21.

It is critical that all components are warmed to 45°C so that the agar does not begin to solidify before plating.

22.

The number of cells plated in top layer of soft agar is dependent on the specific growth kinetics of the cell line being assayed. Several concentrations of cells are plated to determine optimal number. We typically seed 5-10 x103 cells per well. As an example, for cell line A where 5x103 cells per well is used, dilute 17.5x103 of cells (for 3 wells) without DOX in 3.5ml media without DOX. Prepare an identical sample with DOX.

23.

The number of cells injected depends on the growth kinetics of the cell line. We typically use 5x106 to 1x107 cells per injection site per animal. A power analysis should be used to determine the number of animals needed. We typically use 6 animals per condition.

24.

A small bolus of cell suspension will remain under the skin. This lump will gradually dissipate in a few days.

25.

Alternatively, mice can be fed commercially prepared chow containing DOX.

26.

Tumor size are measured by recording length and width of the tumor using digital caliper and volumes are calculated using the formula: length × width2 × 0.52.

27.

Tumors may be used for the generation of cell lines, lysates for biochemical analyses and sectioned for pathological and immunohistochemical analysis. Mb expression is typically confirmed by Western blot analysis of tumor lysates or by immunofluorescence using anti-FLAG or anti-GFP antibodies.

28.

Cell lines generated from mice treated with DOX to induce Mb expression should normally be positive for fluorescence on the day after plating. However, this fluorescence will dissipate over time if DOX is not added to cell culture media.

29.

Tumors that emerge in the RAS Mb-expressing cohort may have acquired resistance to RAS inhibition. These tumor lines can serve as useful tools in the identification of potential resistance mechanisms.

REFERENCES:

  • 1.Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nature. 2013. November;503(7477):548–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Patricelli MP, Janes MR, Li L-S, Hansen R, Peters U, Kessler LV, et al. Selective Inhibition of Oncogenic KRAS Output with Small Molecules Targeting the Inactive State. Cancer Discov. 2016. March;6(3):316–29. [DOI] [PubMed] [Google Scholar]
  • 3.Janes MR, Zhang J, Li L-S, Hansen R, Peters U, Guo X, et al. Targeting KRAS Mutant Cancers with a Covalent G12C-Specific Inhibitor. Cell. 2018. January 25;172(3):578–589.e17. [DOI] [PubMed] [Google Scholar]
  • 4.Canon J, Rex K, Saiki AY, Mohr C, Cooke K, Bagal D, et al. The clinical KRAS(G12C) inhibitor AMG 510 drives anti-tumour immunity. Nature. 2019. November;575(7781):217–23. [DOI] [PubMed] [Google Scholar]
  • 5.Hallin J, Engstrom LD, Hargis L, Calinisan A, Aranda R, Briere DM, et al. The KRASG12C Inhibitor MRTX849 Provides Insight toward Therapeutic Susceptibility of KRAS-Mutant Cancers in Mouse Models and Patients. Cancer Discov. 2020. January;10(1):54–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sha F, Salzman G, Gupta A, Koide S. Monobodies and other synthetic binding proteins for expanding protein science. Protein Sci. 2017. ;26(5):910–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Spencer-Smith R, Koide A, Zhou Y, Eguchi RR, Sha F, Gajwani P, et al. Inhibition of RAS function through targeting an allosteric regulatory site. Nat Chem Biol. 2017. January;13(1):62–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Spencer-Smith R, Li L, Prasad S, Koide A, Koide S, O’Bryan JP. Targeting the α4-α5 interface of RAS results in multiple levels of inhibition. Small GTPases. 2017. July 10;1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Khan I, Spencer-Smith R, O’Bryan JP. Targeting the α4-α5 dimerization interface of K-RAS inhibits tumor formation in vivo. Oncogene. 2019;38(16):2984–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lee K-Y, Fang Z, Enomoto M, Seabrook GG, Zheng L, Koide S, et al. Two Distinct Structures of Membrane-associated Homodimers of GTP- and GDP-bound KRAS4B Revealed by Paramagnetic Relaxation Enhancement. Angew Chem Int Ed Engl. 2020. March 29; [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Freeman AK, Ritt DA, Morrison DK. Effects of Raf dimerization and its inhibition on normal and disease associated Raf signaling. Mol Cell. 2013. February 21;49(4):751–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Koide A, Koide S. Monobodies. In: Arndt KM, Müller KM, editors. Protein Engineering Protocols [Internet]. Totowa, NJ: Humana Press; 2007. p. 95–109. (Methods in Molecular Biology™). [Google Scholar]
  • 13.Koide S, Koide A, Lipovšek D. Target-binding proteins based on the 10th human fibronectin type III domain (10Fn3). Methods Enzymol. 2012; 503:135–56. [DOI] [PubMed] [Google Scholar]
  • 14.Koide A, Koide S. Affinity maturation of single-domain antibodies by yeast surface display. Methods Mol Biol Clifton NJ. 2012; 911:431–43. [DOI] [PubMed] [Google Scholar]
  • 15.Hopp TP, Prickett KS, Price VL, Libby RT, March CJ, Pat Cerretti D, et al. A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. Bio/Technology.1988. October;6(10):1204–10 [Google Scholar]
  • 16.Koide A, Wojcik J, Gilbreth RN, Hoey RJ, Koide S. Teaching an old scaffold new tricks: monobodies constructed using alternative surfaces of the FN3 scaffold. J Mol Biol. 2012. January 13;415(2):393–405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Clark SG, McGrath JP, Levinson AD. Expression of normal and activated human Ha-ras cDNAs in Saccharomyces cerevisiae. Mol Cell Biol. 1985. October;5(10):2746–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Longo PA, Kavran JM, Kim M-S, Leahy DJ. Transient mammalian cell transfection with polyethylenimine (PEI). Methods Enzymol. 2013; 529:227–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Akinc A, Thomas M, Klibanov AM, Langer R. Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. J Gene Med. 2005. May;7(5):657–63. [DOI] [PubMed] [Google Scholar]
  • 20.Rajalingam K, Schreck R, Rapp UR, Albert S. Ras oncogenes and their downstream targets. Biochim Biophys Acta. 2007. August;1773(8):1177–95. [DOI] [PubMed] [Google Scholar]
  • 21.Spencer-Smith R, O’Bryan JP. Direct inhibition of RAS: Quest for the Holy Grail? Semin Cancer Biol. 2019. February 1; 54:138–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Khan I, Rhett JM, O’Bryan JP. Therapeutic targeting of RAS: New hope for drugging the “undruggable.” Biochim Biophys Acta Mol Cell Res. 2020;1867(2):118570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rajakulendran T, Sahmi M, Lefrançois M, Sicheri F, Therrien M. A dimerization-dependent mechanism drives RAF catalytic activation. Nature. 2009. September 24;461(7263):542–5. [DOI] [PubMed] [Google Scholar]
  • 24.Bondzi C, Grant S, Krystal GW. A novel assay for the measurement of Raf-1 kinase activity. Oncogene. 2000. October 12;19(43):5030–3. [DOI] [PubMed] [Google Scholar]
  • 25.Clark GJ, Cox AD, Graham SM, Der CJ. Biological assays for Ras transformation. Methods Enzymol. 1995; 255:395–412. [DOI] [PubMed] [Google Scholar]
  • 26.Estis LF, Temin HM. Suppression of multiplication of avian sarcoma virus by rapid spread of transformation-defective virus of the same subgroup. J Virol. 1979. August;31(2):389–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kangas L, Grönroos M, Nieminen AL. Bioluminescence of cellular ATP: a new method for evaluating cytotoxic agents in vitro. Med Biol. 1984;62(6):338–43. [PubMed] [Google Scholar]
  • 28.Crouch SP, Kozlowski R, Slater KJ, Fletcher J. The use of ATP bioluminescence as a measure of cell proliferation and cytotoxicity. J Immunol Methods. 1993. March 15;160(1):81–8. [DOI] [PubMed] [Google Scholar]
  • 29.Borowicz S, Van Scoyk M, Avasarala S, Karuppusamy Rathinam MK, Tauler J, Bikkavilli RK, et al. The soft agar colony formation assay. J Vis Exp. 2014. October 27;(92):e51998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Drosten M, Dhawahir A, Sum EYM, Urosevic J, Lechuga CG, Esteban LM, et al. Genetic analysis of Ras signalling pathways in cell proliferation, migration and survival. EMBO J. 2010. March 17;29(6):1091–104. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES