Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2020 Dec 23;185(2):478–490. doi: 10.1093/plphys/kiaa045

The nucellus: between cell elimination and sugar transport

Jing Lu 1,2, Rozenn Le Hir 1, Dennys-Marcela Gómez-Páez 1, Olivier Coen 1,2, Christine Péchoux 3, Sophie Jasinski 1, Enrico Magnani 1,✉
PMCID: PMC8133628  PMID: 33721907

Abstract

The architecture of the seed is shaped by the processes of tissue partitioning, which determines the volume ratio of maternal and zygotic tissues, and nutrient partitioning, which regulates nutrient distribution among tissues. In angiosperms, early seed development is characterized by antagonistic development of the nucellus maternal tissue and the endosperm fertilization product to become the main sugar sink. This process marked the evolution of angiosperms and outlines the most ancient seed architectures. In Arabidopsis, the endosperm partially eliminates the nucellus and imports sugars from the seed coat. Here, we show that the nucellus is symplasmically connected to the chalaza, the seed nutrient unloading zone, and works as both a sugar sink and source alongside the seed coat. After fertilization, the transient nucellus accumulates starch early on and releases it in the apoplasmic space during its elimination. By contrast, the persistent nucellus exports sugars toward the endosperm through the SWEET4 hexose facilitator. Finally, we analyzed sugar metabolism and transport in the transparent testa 16 mutant, which fails to undergo nucellus cell elimination, which shed light on the coordination between tissue and nutrient partitioning. Overall, this study identifies a path of sugar transport in the Arabidopsis seed and describes a link between sugar redistribution and the nucellus cell-elimination program.

A path of sugar transport through the nucellus maternal tissue of the Arabidopsis seed is coordinated with the process of nucellus cell elimination.

Introduction

Nutrient accumulation in the seed helps embryo growth and seedling establishment in adverse environmental conditions. Seeds evolved different nutrient-storage strategies alongside different seed structures. Seed nutrient and tissue partitioning are indeed deeply intertwined mechanisms. Cell elimination programs are put in place in the seed to eliminate unwanted tissues in favor of others that will accumulate and store nutrients, two processes whose sequential order is not fully understood (Ingram, 2017; Lu and Magnani, 2018). In angiosperms, the nucellus maternal tissue and the endosperm fertilization product grow antagonistically to become the main nutrient sink during early seed development (Lu and Magnani, 2018). This process defines different seed architectures (Lu and Magnani, 2018) and marked the evolution of angiosperm seeds (Magnani, 2018).

In early Arabidopsis seed development, the endosperm triggers partial elimination of the nucellus through a signaling pathway that converges on the MADS Box transcription factor TRANSPARENT TESTA 16 (TT16; Xu et al., 2016) and becomes the main sugar sink. Sucrose is transported from the placental tissue to the chalaza, the seed maternal tissue where vascularization ends, through the phloem. Green fluorescent protein (GFP) mobility assays demonstrated that chalaza and seed-coat maternal tissues are symplasmically connected, thus suggesting that sucrose diffuses from one tissue to the other via plasmodesmata (Stadler et al., 2005). Nevertheless, maternal tissues and fertilization products are symplasmically isolated (Stadler et al., 2005). The discovery of SWEET sucrose facilitators on the plasma membrane of seed-coat cells indicates that sucrose is exported to the apoplasm where it diffuses to the fertilization products (Chen et al., 2015). Finally, previous studies have shown that SWEET and SUCROSE-PROTON SYMPORTER (SUC) proteins allow the endosperm to reimport sucrose from the apoplasm (Baud et al., 2005; Chen et al., 2015).

Similar to Arabidopsis, the rice (Oryza sativa) endosperm dominates early seed development and partially eliminates the nucellus through the action of the MADS29 transcription factor, the TT16 orthologue in rice (Yang et al., 2012; Nayar et al., 2013). By contrast, the rice nucellus takes the role of the Arabidopsis seed coat in sugar transport. The nucellus cells in between endosperm and chalaza develop into the so-called nucellar projection, a tissue dedicated to sugar transport symplasmically connected to the chalaza (Krishnan and Dayanandan, 2003; Wu et al., 2016). OsSWEET11 and OsSWEET15 sucrose transporters are located on the plasma membrane of the nucellar projection and facilitate the export of sucrose to the apoplasm (Yang et al., 2018). Cell wall-bound invertases then hydrolyze part of the apoplasmic sucrose into hexoses (glucose and fructose; Wang et al., 2008). Finally, sucrose and glucose are reimported in the endosperm cells by the OsSWEET11, OsSWEET15, and OsSWEET4 sugar facilitators (Sosso et al., 2015; Yang et al., 2018).

The Arabidopsis nucellus is conveniently positioned between the nutrient unloading zone and the sink tissues (Figure 1A), which suggests a role in nutrient transport or accumulation alongside the seed coat. In line with this hypothesis, in silico analyses by Hedhly and coworkers indicate that the seed chalazal area is a hot-spot for sugar metabolism and transport during early seed development (Hedhly et al., 2016). Here, we demonstrate that chalaza and nucellus are symplasmically connected, thus suggesting that sugars can diffuse toward the nucellus. The transient nucellus is indeed an early sugar sink in Arabidopsis seeds while releasing starch granules in the apoplasmic space during its elimination. By contrast, the persistent nucellus exports sugars to the apoplasm through the SWEET4 sugar facilitator. Finally, we investigate the link between the processes of tissue and nutrient partitioning in the nucellus by analyzing tt16 seeds, which do not undergo nucellus elimination.

Figure 1.

Figure 1

Open in a new tab

The transient nucellus is a sugar sink. A, Diagrammatic representation in longitudinal sections of a wild-type ovule at stage 3-VI (Schneitz et al., 1995) (upper) and seed at pre-globular embryo stage (lower). i, integuments; c, chalaza; PN, persistent nucellus (orange); TN, transient nucellus (purple); fg, female gametophyte; e, endosperm. Bars = 50 µm. B and C, Cleared whole mounts of a Lugol-stained, wild-type ovule at stage 3-VI (B) and seed at pre-globular embryo stage (C). Orange and purple arrows indicate persistent and transient nucellus, respectively. ii, inner integuments; oi, outer integuments; c, chalaza; fg, female gametophyte; e, endosperm. Bars = 50 µm. D and E, Longitudinal mid-planes of wild-type seeds at pre-globular (D) and torpedo (E) embryo stages, imaged using the starch-mPS-PI technique. White fluorescence inside the cells indicates the presence of starch. Close-up images of the nucellus are at the right of each seed image. Orange and purple arrows indicate persistent and transient nucellus, respectively. ii1′, inner integument 1′. Bars = 50 µm. F, Transmission electron microscopy image of the nucellus of a wild-type seed at pre-globular stage. Red arrows indicate starch granules. Bar = 0.5 µm.

Results

The nucellus is an early sugar sink

In Arabidopsis, a few nucellus cell layers persist in between the chalaza, where nutrients are unloaded from the phloem, and the endosperm, a strong nutrient sink (Figure 1A;Supplemental Figure 1; Xu et al., 2016). To test if the nucellus accumulates sugars, we monitored the starch (the main storage carbohydrate) content in the nucellus across fertilization. At the end of ovule development, Lugol staining (a starch indicator) revealed starch build-up at the boundary between nucellus and chalaza, in the female gametophyte, and in proximal integument cells (Figure 1B). After fertilization, the distal cells of the nucellus (transient nucellus, undergoing cell elimination, Figure 1A), the boundary between nucellus and chalaza/proximal inner integument (ii), and the outer integument (oi) accumulated starch (Figure 1C). Furthermore, we detected fainter Lugol staining in proximal nucellus cells (persistent nucellus, not undergoing cell elimination, Figure 1A) and in distal ii cells (Figure 1C). From the globular-embryo stage of seed development on, we observed strong Lugol staining everywhere in the seed (Supplemental Figure 2), thus losing tissue resolution.

To better characterize the pattern of starch accumulation in different nucellus domains, we adapted the modified pseudo-Schiff propidium iodide imaging (mPS-PI) technique (Truernit et al., 2008; Xu et al., 2016) to the analysis of both cell wall and starch in seeds (starch-mPS-PI, see Methods section and Supplemental Figure 3). In line with Lugol staining analyses, we detected starch in the transient nucellus, but not in the persistent nucellus, at early embryogenesis (Figure 1D). Furthermore, we observed propidium iodide staining in the chalaza and ii cells surrounding the nucellus and in the oi2 (Figure 1D). Starch-mPS-PI analyses revealed that the most of the persistent nucellus does not accumulate starch even later in seed development, when most of the seed maternal tissues, with the exception of the ii1′ cell layer, appear full of starch (Figure 1E). These results indicate that the faint Lugol staining observed in the persistent nucellus is possibly due to the diffusion of stained material during the seed clearing process (see Methods section).

We further confirmed our results by transmission electron microscopy, which showed starch granules in the apoplasmic space in between nucellus and endosperm (nucellar cavity, which contains cell corpses and debris resulting from the process of cell elimination) and in transient nucellus cells but not in the persistent nucellus (Figure 1F).

Finally, we indirectly analyzed starch biosynthesis by studying transcriptional activity of the GLUCOSE-1-PHOSPHATE ADENYLYLTRANSFERASE LARGE SUBUNIT 3 (APL3) gene. APL genes encode the large subunit of the ADP-glucose pyrophosphorylase, the enzyme that catalyzes the first and limiting step in starch biosynthesis (Crevillen et al., 2005; Meng et al., 2017). The Arabidopsis genome bears four APL genes, but only APL3 is expressed in the chalaza–nucellus region according to microarray data by Belmonte and coworkers (Belmonte et al., 2013). Therefore, we fused the promoter region of the APL3 gene to the chimeric GFP-GUS reporter gene (ProAPL3:GFP-GUS). In ovules, we detected GFP fluorescence in the oi1 and ii2 cell layers and the female gametophyte (Figure 2A). After fertilization, the promoter was active in the transient nucellus, chalaza, oi1, ii2, and endosperm of pre-globular embryo stage seeds (Figure 2B). At bent cotyledon embryo stage, we detected fluorescence solely in the oi (Figure 2C). Overall, the GFP fluorescence in the nucellus recapitulated starch deposition as observed by Lugol, starch-mPS-PI, and transmission electron microscopy analyses. Altogether, these data indicate that the transient nucellus is an early sugar sink in Arabidopsis seeds.

Figure 2.

Figure 2

Open in a new tab

The expression pattern of the APL3 promoter. A to C, Propidium iodide (PI), GFP, and PI-GFP superimposed fluorescence images of ProAPL3:GFP-GUS ovule at stage 3-VI (A), and seeds at pre-globular (B) and bent cotyledons (C) embryo stages. PI staining inside the most distal cells of the nucellus indicates the occurrence of cell death. c, chalaza; e, endosperm; f, funiculus; fg, female gametophyte; ii, inner integuments; oi, outer integuments. Orange and purple arrows indicate persistent and transient nucellus, respectively. Bars = 50 µm.

The nucellus is symplasmically connected to the chalaza

The finding of starch in the nucellus prompted us to test if sugars can move symplasmically from the chalaza, the seed nutrient unloading zone, to the nucellus. To this end, we conducted GFP mobility assays by expressing GFP or GFP-sporamin translational fusion in the companion cells of the chalazal phloem under the control of the SUCROSE-PROTON SYMPORTER 2 (SUC2) promoter region. It has been previously shown that the size exclusion limit of the chalazal plasmodesmata allows GFP (27 kD), but not GFP-sporamin (47 kD), to diffuse into the neighboring seed-coat cells (Stadler et al., 2005). At 1-cell embryo stage, GFP-sporamin was confined in a few chalazal cells (Figure 3A). By contrast, we detected free GFP fluorescence in chalaza, oi, proximal ii, and nucellus cells at the same developmental stage (Figure 3B). These data demonstrate that the nucellus is symplasmically connected to the chalaza and suggest that nutrients diffuse from the chalaza to the nucellus in a symplasmic fashion.

Figure 3.

Figure 3

Open in a new tab

The nucellus is symplasmically connected to the chalaza. A and B, Propidium iodide (PI), GFP, and PI-GFP superimposed fluorescence images of ProSUC2:GFP-sporamin (A) and ProSUC2:GFP (B) seeds at pre-globular embryo stage. c, chalaza; e, endosperm; f, funiculus; ii, inner integuments; oi, outer integuments. Orange and purple arrows indicate persistent and transient nucellus, respectively. Bars = 50 µm. C, PI, esculin, and PI-esculin superimposed fluorescence images of wild-type seeds at pre-globular embryo stage. c, chalaza; e, endosperm; f, funiculus; ii, inner integuments; oi, outer integuments. Orange and purple arrows indicate persistent and transient nucellus, respectively. Bars = 50 µm.

To further study connections between nucellus and neighboring tissues, we performed esculin uptake assays (Knoblauch et al., 2015). We fed siliques with the sucrose analog esculin and then looked at its distribution in seeds (Figure 3C). We detected relatively strong esculin fluorescence in oi1, ii2, ii1, proximal cells of oi2, nucellus, and funiculus (Figure 3C). Chalaza and distal cells of oi2 were also fluorescent but with lower intensity (Figure 3C). These data indicate that sucrose can flow from the placental tissue to the nucellus.

SWEET4 sugar facilitator is expressed in the nucellus

Nutrients are supposed to reach the fertilization products via the apoplasm as maternal and zygotic tissues are not symplasmically connected (Stadler et al., 2005). In Arabidopsis, SWEET transporters in the seed coat facilitate sucrose export to the apoplasm (Chen et al., 2015). By contrast, rice grains express SWEET genes in nucellar cells (Yang et al., 2018), which play an important role in nutrient transfer to the endosperm. To verify if the Arabidopsis nucellus also plays a role in sugar apoplasmic transport, we tested if members of the SWEET gene family are expressed in such tissues. According to microarray data by Belmonte et al. (2013), the SWEET4 glucose and fructose facilitator gene (Chen et al., 2010; Liu et al., 2016; Rottmann et al., 2018) is specifically expressed in the chalazal region (including chalaza and nucellus) of Arabidopsis seeds throughout seed development (Supplemental Figure 4). To better characterize its expression pattern, we fused the SWEET4 promoter region to the chimeric GFP-GUS reporter gene. In ProSWEET4:GFP-GUS ovules and seeds, we detected GFP fluorescence in the most proximal nucellus cell layer and the first 1–3 cells of the ii (Figure 4, A–C). Our results indicate that in Arabidopsis the persistent nucellus plays a role in sugar transport.

Figure 4.

Figure 4

Open in a new tab

SWEET4 is expressed in the nucellus. A to C, Propidium iodide (PI), GFP, and PI-GFP superimposed fluorescence images of ProSWEET4:GFP-GUS ovule at stage 3-VI (A), and seeds at pre-globular (B) and globular (C) embryo stages. Orange and purple arrows indicate persistent and transient nucellus, respectively. Bars = 50 µm.

SWEET4 localizes to the plasma membrane

To test if SWEET4 facilitate transport across the plasma membrane, we studied its sub-cellular localization. The SWEET4-GFP chimeric protein has been shown to localize to the plasma membranes of protoplasts, when expressed under the control of the 35S promoter sequence (Liu et al., 2016; Rottmann et al., 2018). To test SWEET4 localization in planta, we imaged seed-coat cells of Pro35S:SWEET4-GFP seeds. We detected GFP fluorescence in the plasma membrane, in proximity to propidium iodide signal marking the cell wall, and in vesicles (Supplemental Figure 5A). GFP localization was confirmed by labeling the plasma membrane with the FM4-64 dye (Supplemental Figure 5B; Jaillais et al., 2006). In a number of cells we also detected fluorescence in the vacuole (Supplemental Figure 5C). SWEET4-GFP localization in the vacuole might be due to incorrect protein folding or overcrowding of the secretory pathway in the transgenic lines. Overall, these data indicate that SWEET4 facilitates sugar export to the apoplasm.

SWEET4 affects seed sugar content

A number of sweet mutants have been shown to transiently and locally overaccumulate sugars as a consequence of impaired sugar export, while overall negatively affecting the sugar content of the sink tissues. For example, mutations in the SWEET11, SWEET12, and SWEET15 genes lead to excessive starch accumulation in the seed coat and low starch levels in the embryo compared to the wild-type (Chen et al., 2015). In line with these data, we observed stronger Lugol staining in sweet4 mutant (see Methods section and Supplemental Figure 6) nucellus, chalaza, and seed coat compared to the wild-type (Figure 5, A–C). Nevertheless, Lugol staining assays are not quantitative and we detected a certain degree of variability among seeds sharing the same genetic background. We therefore quantified sugars content in wild-type and mutant seeds. On average, sweet4 seeds at 4 and 6 d after flowering (DAF) accumulated higher levels of glucose, fructose, total soluble sugars, and starch compared to the wild-type (Figure 5, D and E). By contrast, sweet4 dry seeds showed a slightly lower level of sucrose and soluble sugars than wild-type seeds (Figure 5F). Finally, we showed that the perturbed sugar transport in sweet4 seeds does not affect oil and protein accumulation (Figure 5G).

Figure 5.

Figure 5

Open in a new tab

The sweet4 and tt16 mutations affect nutrient accumulation in seeds. A to C, Cleared whole mounts of Lugol stained wild-type (wt) and mutant seeds at pre-globular embryo stage. Orange and purple arrows indicate persistent and transient nucellus, respectively. Bars = 50 µm. D to F, Sugars quantification in wild-type (wt) and mutant seeds at 4 (D) and 6 (E) DAF and in dry seeds (F). Asterisks indicate statistical significance between wild-type and mutant (two-tailed Student’s t test, P<0.05). Error bars indicate SD. G, Oil and protein quantification in wild-type (wt) and mutant dry seeds. Asterisks indicate statistical significance between wild-type and mutant (two-tailed Student’s t test, P<0.05). Error bars indicate SE.

When sugars are not efficiently transported from the seed coat to the fertilization products, as in the sweet11;sweet12;sweet15 triple mutant, embryo development is compromised (Chen et al., 2015). Similarly, we observed that the sweet4 mutation impaired embryo growth (Figure 6). Overall, these data support the hypothesis that SWEET4 facilitates sugar export to the apoplasm during early seed development.

Figure 6.

Figure 6

Open in a new tab

The sweet4 and tt16 mutations delay embryo development. Distribution of different embryo developmental stages (1: globular, 2: transition, 3: heart, 4: early torpedo, 5: late torpedo, 6: walking stick, 7: bent cotyledon, 8: mature embryo) in wild-type and mutant seeds at 8 and 10 DAF. n > 100. Schematic of developmental stages is shown below. Bar = 100 µm.

TT16 regulates cell elimination but not sugar export in the nucellus

We have previously shown that the B-sister MADS box transcription factor TT16 plays a role in seed tissue partitioning by promoting partial nucellus elimination in favor of endosperm growth (Xu et al., 2016). Since tissue and nutrient partitioning are known to be tightly linked mechanisms (Lu and Magnani, 2018), we investigated sugar transport and metabolism in tt16 mutant seeds, whose transient nucellus (hereafter referred to as transient nucellus*, Figure 7A) is not eliminated. Whereas starch accumulation in wild-type and tt16 ovules was indistinguishable (Figures 1B, 7B), Lugol staining and starch-mPS-PI analyses highlighted three domains in the tt16 nucellus: from proximal to distal: (1) the persistent nucellus, which did not accumulate starch, (2) the proximal cells of the transient nucellus*, which accumulated starch, and (3) the distal cells of the transient nucellus*, which did not accumulate starch (Figure 7, C and D). Nevertheless, the ProAPL3:GFP-GUS construct did not drive GFP expression in the nucellus of tt16 ovules and seeds (Figure 7, E and F). Altogether, these data show that part of the transient nucellus maintains its sugar sink force if it is not eliminated.

Figure 7.

Figure 7

Open in a new tab

tt16 nucellus accumulates starch. A, Diagrammatic representation in longitudinal sections of a tt16 ovule at stage 3-VI (upper) and seed at pre-globular embryo stage (lower). i, integuments; c, chalaza; PN, persistent nucellus (orange); TN*, transient nucellus* that is not eliminated in the tt16 mutant (purple); fg, female gametophyte; e, endosperm. Bars = 50 µm. B and C, Cleared whole mounts of a Lugol-stained tt16 ovule at stage 3-VI (B) and seed at pre-globular embryo stage (C). Orange and purple arrows indicate persistent and transient nucellus*, respectively. Bars = 50 µm. D, Longitudinal plane of a tt16 seed at pre-globular stage, imaged using the starch-mPS-PI technique. Orange and purple arrows indicate persistent and transient nucellus*, respectively. Bars = 50 µm. E and F, Propidium iodide (PI), GFP, and PI-GFP superimposed fluorescence images of ProAPL3:GFP-GUS ovule at stage 3-VI (E) and seed at pre-globular embryo stage (F). Orange and purple arrows indicate persistent and transient nucellus*, respectively. Bars = 50 µm.

Sugars quantification in tt16 seeds revealed a lower level of sucrose and soluble sugars at 4 DAF and a higher level of the same sugars in dry seeds compared to the wild-type (Figure 5, D–F). Furthermore, tt16 dry seeds contained less oil and more proteins than wild-type seeds (Figure 5G). Finally, embryo development was delayed in tt16 seeds relative to the wild-type (Figure 6).

To test if TT16 affects nutrient transport by regulating SWEET4 expression, we introgressed the ProSWEET4:GFP-GUS line in a tt16 background. The tt16 mutation did not perturb SWEET4 spatial expression pattern (Figure 8) compared to the wild-type (Figure 4). In line with these results, RT-qPCR analyses of SWEET4 expression in tt16 and wild-type seeds at 2 and 11 DAF were statistically similar (Supplemental Figure 7). Altogether, these data suggest that TT16 regulates the elimination of the nucellus and, indirectly, the release of starch in the nucellar cavity but not the apoplasmic transport of sugar through the SWEET4 facilitator.

Figure 8.

Figure 8

Open in a new tab

SWEET4 expression in the tt16 mutant. A and B, Propidium iodide (PI), GFP, and PI-GFP superimposed fluorescence images of ProSWEET4:GFP-GUS;tt16 ovule at stage 3-VI (A) and seed at pre-globular stage (B). Orange and purple arrows indicate persistent and transient nucellus*, respectively. Bars = 50 µm.

Discussion

The nucellus path of nutrient transport

In Arabidopsis, it has been shown that sugars travel from the placental tissue to the chalaza through the phloem and then diffuse symplasmically towards the seed coat (Figure 9; Stadler et al., 2005). The seed coat has been regarded as the only tissue responsible for sugar export to the apoplasm (Chen et al., 2015), a necessary step to allow sugar diffusion toward the fertilization products that are symplasmically disconnected from the maternal tissues (Stadler et al., 2005). Here, we characterized a sugar transport path through the nucellus (Figure 9). Our data indicate that the chalaza is symplasmically connected to both the seed coat and the nucellus. Therefore, we speculate that chalazal sucrose and/or hexoses, resulting from the activity of cytoplasmic sucrose synthases present in the chalaza (Fallahi et al., 2008), diffuse from cell to cell to the nucellus. The most proximal cells of the persistent nucellus express the SWEET4 glucose and fructose facilitator (Chen et al., 2010; Liu et al., 2016), indicating that part of the nucellar hexoses are exported to the apoplasmic space. We speculate that the apoplasmic glucose and fructose, provided by the nucellus, might diffuse toward the endosperm to be reimported by endosperm transporters (Baud et al., 2005; Chen et al., 2015). In line with our model, sweet4 mutant lines displayed overaccumulation of soluble sugars during early seed development. Part of the excess of hexoses observed in the sweet4 mutant might be converted into starch in the maternal tissues, as suggested by Lugol staining assays and starch quantification analyses. Later in seed development, the lower sugar content of sweet4 seeds, when compared to the wild-type, might be due to the compromised transport of sugars from the nucellus to the fertilization products, the ultimate sink tissues. A correlation between sugar and lipid content in seeds has been observed in a number of mutations that affect sugar metabolism. Nevertheless, the relationship between sugar and lipid metabolism is not comprehensively understood, as other mutations, such as sus2 and sus3, perturb starch but not lipid accumulation, similar to what is observed in sweet4 seeds (Barratt et al., 2009; Angeles-Nunez and Tiessen, 2010). Compared to the seed-coat path, which is based on sucrose transport (Chen et al., 2015), our data indicate that hexoses are mostly transported through the nucellus path. We speculate that the seed-coat is involved in relatively longer distance transport of sugars and therefore favors the more energy-efficient and less-reactive sucrose. By contrast, the nucellus offers a faster route to the endosperm, thus allowing the transport of readily available glucose and fructose. The triple sweet11;12;15 mutant, which is perturbed in the seed-coat sugar path, exhibits embryo arrest, a stronger phenotype than what is observed in sweet4 embryos. These data might suggest that the seed-coat path accounts for most of the sugar transport to the embryo. Nevertheless, we cannot exclude that other SWEET facilitators operate redundantly with SWEET4 in the nucellus.

Figure 9.

Figure 9

Open in a new tab

The nucellus path of sugar transport. Solid and dotted arrows indicate enzymatic reactions and diffusion paths, respectively. Dashed lines indicate cells undergoing cell elimination. SUS, SUCROSE SYNTHASE; Glc, glucose; Fru, fructose; Suc, sucrose.

Cell elimination as a way to recycle sugars

We demonstrated that the transient nucellus accumulates starch across fertilization. Starch is then released into the nucellar cavity, the apoplasmic space in between nucellus and endosperm, which contains cell corpses and debris resulting from the process of cell elimination (Figure 9). A similar phenomenon has been shown in cereals, which possess a larger transient nucellus that works as transient sugar sink and develops, in some species, a larger nucellar cavity in between nucellus and endosperm (Lu and Magnani, 2018). In barley (Hordeum vulgare) grains, alpha amylase 4 has been shown to be active in nucellus cells during cell elimination, thus indicating that starch in the nucellus is hydrolyzed to facilitate its mobilization to the endosperm (Radchuk et al., 2009). Similarly, microarray data suggest that the starch degradation pathway is active in the Arabidopsis chalazal area (Hedhly et al., 2016). In line with this hypothesis, when imaged by transmission electron microscopy, starch granules in nucellus cells at an advanced stage of cell elimination appeared less contrasted than those in cells starting the process of elimination (Figure 1F). Therefore, the starch present in the Arabidopsis transient nucellus might be recycled in favor of the endosperm. The advantage, if any, of this process in a relatively small nucellus is not clear. Alternatively, it might be an evolutionary relic. The nucellus, and not the endosperm, acts indeed as the major sugar sink in perispermic seeds (Lopez-Fernandez and Maldonado, 2013), which might be the ancestral seed condition (Lu and Magnani, 2018; Magnani, 2018), a character that might have been retained by the Arabidopsis nucellus despite undergoing cell elimination. tt16 seeds partially resemble perispermic seeds as they carry a large nucellus that accumulates starch, thus indicating a possible molecular scenario for the evolution of such different seed architectures.

Coordination of tissue and nutrient partitioning

Tissue and nutrient partitioning are thought to be two inextricably linked processes. In early Arabidopsis seed development, the nucellus is eliminated to allow endosperm growth and nutrient accumulation. Later in seed development, most of the endosperm is eliminated to allow embryo growth, the ultimate nutrient sink. It is still debated if nutrient partitioning follows or precedes tissue partitioning (Ingram, 2017). It has been speculated that preventing nutrient transport to a tissue might indeed lead to its elimination. Our finding of starch accumulation in the transient nucellus, alongside sugar export towards the endosperm in the persistent nucellus, argues against this hypothesis. Furthermore, TT16 allows endosperm growth by eliminating the transient nucellus (Xu et al., 2016) but does not promote nutrient export to the endosperm by activating SWEET4 expression in the persistent nucellus.

Nonetheless, the tt16 mutation affects sugar, oil, and protein content in seeds. TT16 might regulate, directly or indirectly, the expression of other nutrient transporters in the seed coat or in the chalaza. Indeed, the pleiotropic nature of the tt16 seed phenotype, which shows defects in nucellus, seed coat, and chalaza development (Nesi et al., 2002; Ehlers et al., 2016; Xu et al., 2016; Coen et al., 2017, 2019a, 2019b; Fiume et al., 2017,a, 2017,b), does not allow us to conclusively interpret such data. Further experiments are necessary to understand the regulatory mechanisms underlying such physiological changes.

Materials and methods

Plant material

All Arabidopsis thaliana plants are in the Columbia accession. The tt16-1 allele was isolated in the Wassilewskija accession from the INRA Versailles collection (Bechtold and Pelletier, 1998) and then backcrossed to Columbia (Nesi et al., 2002; Coen et al., 2017). The sweet4-1 (SALK_072225; Chong et al., 2014) allele is from the Salk collection (Alonso et al., 2003), whereas the sweet4-2 (GK_858G02; Chong et al., 2014) allele is from the GABI-KAT collection (Kleinboelting et al., 2012). SWEET4 expression in sweet4-1 and sweet4-2 seeds, compared to the wild-type, was tested by RT-qPCR, as described below, by using a set of primers (5′CCTCAATGGTGTCGTTTGGG3′ and 5′TAGCTTGTCCACTGTTGCCA3′) downstream of both T-DNA insertions (Supplemental Figure 6).

Cloning and construction

PCR amplifications were performed using the gene-specific primers described below carrying the attB1 (5′GGGGACAAGTTTGTACAAAAAAGCAGGCT3′) and attB2 (5′GGGGACCACTTTGTACAAGAAAGCTGGGTC3′) Gateway recombination sites at the 5′-ends of the forward and reverse primers, respectively. All PCR products were amplified with the high-fidelity Phusion DNA polymerase (Thermo Fisher Scientific), recombined into the pDONR207 or pDONR201 vector (BP Gateway reaction) according to the manufacturer’s instructions (Thermo Fisher Scientific), and then sequenced. The PCR products cloned into the pDONR vectors were then recombined into the appropriate destination vector (LR Gateway reaction) according to the manufacturer’s instructions (Thermo Fisher Scientific). The SWEET4 3.2-kb promoter region was amplified using the attB1-(5′TGGTTCGCATTTTGGATTCTTTGTTTAC3′) forward and attB2-(5′ TTCACTTCAAAAGAAAAATCCGAAC3′) reverse primers. SWEET4 genomic sequence without the stop codon was PCR amplified using the attB1-(5′CGCTCGCTCTCTTCTTTGTT3′) forward and attB2-(5′AGCTGAAACTCGTTTAGCTTGTC3′) reverse primers. The APL3 1.8-kb promoter region was amplified using the attB1-(5′GTCGACGATGTTTGGTTTCTTTATCC3′) forward and attB2-(5′CCATGGCTTTTTTTAGCTGGAATGA3′) reverse primers.

The ProSWEET4 sequence was recombined into the pBGWFS7.0 binary vector (Karimi et al., 2002), whereas the SWEET4 genomic sequence was recombined into the pMDC83 binary vector (Curtis and Grossniklaus, 2003).

Constructs carrying GFP or GFP-sporamin under the control of the SUCROSE-PROTON SYMPORTER 2 (SUC2) promoter region were previously described (Stadler et al., 2005).

Transgenic plants

The Agrobacterium tumefaciens strain C58C1 was used to stably transform Arabidopsis plants using the floral dip method (Clough and Bent, 1998). Transformants were selected with the appropriate resistance and subsequently transferred to soil for further characterization. More than 10 independent transgenic lines were tested for each construct transformed. One transgenic line for each construct is presented as a representative of the majority of lines showing consistent results.

Expression analysis

At least three independent biological samples were used for each analysis. Each replicate comprised the content in seeds of 10 siliques. Total RNA was extracted using the RNeasy Mini kit (Qiagen), including RNase-Free DNase Set (Qiagen) treatment during washing, according to the manufacturer’s instructions. The Superscript Reverse Transcriptase II kit (Invitrogen) was used to generate cDNA from 1 μg of total RNA. qPCR was performed with the SYBR Green kit (Bio-Rad) on a Bio-Rad CFX real-time PCR machine. SWEET4 was PCR amplified using the (5′CCTCAATGGTGTCGTTTGGG3′) forward and (5′TAGCTTGTCCACTGTTGCCA3′) reverse primers. SWEET4 expression levels were normalized to the expression levels of three reference genes, specifically AT4G12590, AT4G02080, and AT3G25800 (Dekkers et al., 2012).

Lugol staining

Harvested seeds and ovules were incubated in a 1% SDS (Weight/Volume), 0.2 N NaOH solution at 37°C for 15 min to clear the tissue. Samples were rinsed in water and incubated in a 12.5% bleach solution (1.25% active Cl–; Volume/Volume) for 10 min. Samples were then rinsed in water and transferred to a 33% Lugol solution (Weight/Volume) and incubated for 30 s. Finally, samples were analyzed by differential interference contrast microscopy with an Axioplan 2 microscope (Zeiss). More than 30 seeds were analyzed for each genotype and time point.

Esculin staining

Harvested siliques were dipped in a 1 mg·mL-1 esculin water solution for 1 h. Siliques were then dissected and seeds imaged at the confocal microscope.

Confocal microscopy

mPS-PI analyses were conducted as previously described (Xu et al., 2016). Starch-mPS-PI staining analyses were conducted following the mPS-PI protocol but omitting the α-amylase step. In starch-mPS-PI-treated samples, propidium iodide stains both cell walls and starch.

GFP-expressing lines were analyzed one hour after mounting in a 100 µg·mL-1 propidium iodide, 7% sucrose solution (Weight/Volume), as previously described (Figueiredo et al., 2016).

A 5 µM FM4-64 solution was added to the seeds 30 min before mounting. Samples were then analyzed as previously described (Jaillais et al., 2006).

Samples treated with esculin were mounted in a 100 µg·mL-1 propidium iodide, 7% sucrose solution (Weight/Volume), and analyzed as previously described (Knoblauch et al., 2015).

Samples were imaged by confocal laser scanning microscopy (Leica SP8). Three-dimensional, Z-stack confocal laser scanning microscope images were analyzed through the Volume Viewer plug-in of the ImageJ software (Schneider et al., 2012). More than 30 seeds were analyzed for each genotype and time point.

Transmission electron microscopy

Transmission electron microscopy analyses were conducted as previously described (Coen et al., 2019b).

Enzymatic analyses

Sugars were extracted as previously described (Baud et al., 2002) and quantified by using the Enzytech D-Glucose/Fructose/Sucrose kit (R-biopharm, https://r-biopharm.com/fr/). At least four biological replicates were performed for each genotype. Fifty seeds were used for each replicate.

Seed oil and protein content by near-infrared spectroscopy

Seed samples were analyzed as previously described (Jasinski et al., 2016). Four biological replicates were performed for each genotype. A total of 300 µL of seeds were used for each replicate.

Accession numbers

Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: TT16 (AT5G23260), SWEET4 (AT3G28007), APL3 (AT4G39210).

Supplemental data

The following materials are available in the online version of this article.

Supplemental Figure S1. Identifying the nucellus.

Supplemental Figure S2. Lugol staining of seeds at globular embryo stage.

Supplemental Figure S3. The starch-modified pseudo-Schiff propidium iodide imaging technique.

Supplemental Figure S4. SWEET4 expression in seeds.

Supplemental Figure S5. SWEET4 localizes to the plasma membrane and vacuole.

Supplemental Figure S6. SWEET4 expression in sweet4 mutant seeds.

Supplemental Figure S7. SWEET4 expression in tt16 mutant seeds.

Supplementary Material

kiaa045_Supplementary_Data
Click here for additional data file. (3.6MB, zip)

Acknowledgements

We thank Ruth Stadler and Norbert Sauer for ProSUC2:GFP and ProSUC2:GFP-sporamin lines and the Observatoire du Végétal for plant culture, access to imaging facilities, and assistance.

Funding

The project was supported by the Labex Saclay Plant Sciences-SPS (ANR-10-LABX-0040-SPS) grant.

Conflict of interest statement. We have no conflict of interest to declare.

 

J.L. performed the research, analyzed the data, and helped to write the article. D.G. performed the embryo analysis and part of the expression analysis, O.C. performed part of the expression analysis, R.LH performed sugar quantifications, S.J. performed oil and protein quantifications, C.P. performed transmission electron microscopy analyses. E.M. designed the research, analyzed the data, and wrote the article.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (https://academic.oup.com/plphys) is: Enrico Magnani (enrico.magnani@inrae.fr).

References

  1. Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 [DOI] [PubMed] [Google Scholar]
  2. Angeles-Nunez JG, Tiessen A (2010) Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds. Planta 232: 701–718 [DOI] [PubMed] [Google Scholar]
  3. Barratt DH, Derbyshire P, Findlay K, Pike M, Wellner N, Lunn J, Feil R, Simpson C, Maule AJ, Smith AM (2009) Normal growth of Arabidopsis requires cytosolic invertase but not sucrose synthase. Proc Natl Acad Sci USA 106: 13124–13129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baud S, Boutin J-P, Miquel M, Lepiniec L,, Rochat C (2002) An integrated overview of seed development in Arabidopsis thaliana ecotype WS. Plant Physiol Biochem 40: 151–160 [Google Scholar]
  5. Baud S, Wuilleme S, Lemoine R, Kronenberger J, Caboche M, Lepiniec L,, Rochat C (2005) The AtSUC5 sucrose transporter specifically expressed in the endosperm is involved in early seed development in Arabidopsis. Plant J 43: 824–836 [DOI] [PubMed] [Google Scholar]
  6. Bechtold N,, Pelletier G (1998) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82: 259–266 [DOI] [PubMed] [Google Scholar]
  7. Belmonte MF, Kirkbride RC, Stone SL, Pelletier JM, Bui AQ, Yeung EC, Hashimoto M, Fei J, Harada CM, Munoz MD, et al. (2013) Comprehensive developmental profiles of gene activity in regions and subregions of the Arabidopsis seed. Proc Natl Acad Sci USA 110: E435–444 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen LQ, Lin IW, Qu XQ, Sosso D, McFarlane HE, Londono A, Samuels AL,, Frommer WB (2015) A cascade of sequentially expressed sucrose transporters in the seed coat and endosperm provides nutrition for the Arabidopsis embryo. Plant Cell 27: 607–619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen LQ, Hou BH, Lalonde S, Takanaga H, Hartung ML, Qu XQ, Guo WJ, Kim JG, Underwood W, Chaudhuri B, et al. (2010) Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468: 527–532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chong J, Piron MC, Meyer S, Merdinoglu D, Bertsch C,, Mestre P (2014) The SWEET family of sugar transporters in grapevine: VvSWEET4 is involved in the interaction with Botrytis cinerea. J Exp Bot 65: 6589–6601 [DOI] [PubMed] [Google Scholar]
  11. Clough SJ,, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 [DOI] [PubMed] [Google Scholar]
  12. Coen O, Fiume E, Xu W, De Vos D, Lu J, Pechoux C, Lepiniec L,, Magnani E (2017) Developmental patterning of the sub-epidermal integument cell layer in Arabidopsis seeds. Development 144: 1490–1497 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Coen O, Lu J, Xu W, Pateyron S, Grain D, Pechoux C, Lepiniec L,, Magnani E (2019a) A TRANSPARENT TESTA transcriptional module regulates endothelium polarity. Front Plant Sci 10: 1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Coen O, Lu J, Xu W, De Vos D, Pechoux C, Domergue F, Grain D, Lepiniec L,, Magnani E (2019b) Deposition of a cutin apoplastic barrier separating seed maternal and zygotic tissues. BMC Plant Biol 19: 304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Crevillen P, Ventriglia T, Pinto F, Orea A, Merida A,, Romero JM (2005) Differential pattern of expression and sugar regulation of Arabidopsis thaliana ADP-glucose pyrophosphorylase-encoding genes. J Biol Chem 280: 8143–8149 [DOI] [PubMed] [Google Scholar]
  16. Curtis MD,, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dekkers BJ, Willems L, Bassel GW, van Bolderen-Veldkamp RP, Ligterink W, Hilhorst HW,, Bentsink L (2012) Identification of reference genes for RT-qPCR expression analysis in Arabidopsis and tomato seeds. Plant Cell Physiol 53: 28–37 [DOI] [PubMed] [Google Scholar]
  18. Ehlers K, Bhide AS, Tekleyohans DG, Wittkop B, Snowdon RJ,, Becker A (2016) The MADS box genes ABS, SHP1, and SHP2 are essential for the coordination of cell divisions in ovule and seed coat development and for endosperm formation in Arabidopsis thaliana. PloS One 11: e0165075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fallahi H, Scofield GN, Badger MR, Chow WS, Furbank RT,, Ruan YL (2008) Localization of sucrose synthase in developing seed and siliques of Arabidopsis thaliana reveals diverse roles for SUS during development. J Exp Bot 59: 3283–3295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Figueiredo DD, Batista RA, Roszak PJ, Hennig L,, Kohler C (2016) Auxin production in the endosperm drives seed coat development in Arabidopsis. eLife 5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fiume E, Coen O, Xu W, Lepiniec L,, Magnani E (2017a) Growth of the Arabidopsis sub-epidermal integument cell layers might require an endosperm signal. Plant Signal Behav 12: e1339000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fiume E, Coen O, Xu W, Lepiniec L,, Magnani E (2017b) Developmental patterning of sub-epidermal cells in the outer integument of Arabidopsis seeds. PloS One 12: e0188148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hedhly A, Vogler H, Schmid MW, Pazmino D, Gagliardini V, Santelia D,, Grossniklaus U (2016) Starch turnover and metabolism during flower and early embryo development. Plant Physiol 172: 2388–2402 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ingram GC (2017) Dying to live: cell elimination as a developmental strategy in angiosperm seeds. J Exp Bot 68: 785–796 [DOI] [PubMed] [Google Scholar]
  25. Jaillais Y, Fobis-Loisy I, Miege C, Rollin C,, Gaude T (2006) AtSNX1 defines an endosome for auxin-carrier trafficking in Arabidopsis. Nature 443: 106–109 [DOI] [PubMed] [Google Scholar]
  26. Jasinski S, Lecureuil A, Durandet M, Bernard-Moulin P,, Guerche P (2016) Arabidopsis seed content QTL mapping using high-throughput phenotyping: the assets of near infrared spectroscopy. Front Plant Sci 7: 1682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Karimi M, Inze D,, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193–195 [DOI] [PubMed] [Google Scholar]
  28. Kleinboelting N, Huep G, Kloetgen A, Viehoever P,, Weisshaar B (2012) GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res 40: D1211–1215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Knoblauch M, Vendrell M, de Leau E, Paterlini A, Knox K, Ross-Elliot T, Reinders A, Brockman SA, Ward J,, Oparka K (2015) Multispectral phloem-mobile probes: properties and applications. Plant Physiol 167: 1211–1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Krishnan S, Dayanandan P (2003) Structural and histochemical studies on grain-filling in the caryopsis of rice (Oryza sativa L.). J Biosci 28: 455–469 [DOI] [PubMed] [Google Scholar]
  31. Liu X, Zhang Y, Yang C, Tian Z,, Li J (2016) AtSWEET4, a hexose facilitator, mediates sugar transport to axial sinks and affects plant development. Sci Rep 6: 24563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lopez-Fernandez MP,, Maldonado S (2013) Programmed cell death during quinoa perisperm development. J Exp Bot 64: 3313–3325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lu J,, Magnani E (2018) Seed tissue and nutrient partitioning, a case for the nucellus. Plant Reprod 31: 309–317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Magnani E (2018) Seed evolution, a ‘simpler’ story. Trends Plant Sci 23: 654–656 [DOI] [PubMed] [Google Scholar]
  35. Meng LS, Xu MK, Li D, Zhou MM,, Jiang JH (2017) Soluble sugar accumulation can influence seed size via AN3-YDA gene cascade. J Agric Food Chem 65: 4121–4132 [DOI] [PubMed] [Google Scholar]
  36. Nayar S, Sharma R, Tyagi AK,, Kapoor S (2013) Functional delineation of rice MADS29 reveals its role in embryo and endosperm development by affecting hormone homeostasis. J Exp Bot 64: 4239–4253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nesi N, Debeaujon I, Jond C, Stewart AJ, Jenkins GI, Caboche M,, Lepiniec L (2002) The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADS domain protein and is required for proper development and pigmentation of the seed coat. Plant Cell 14: 2463–2479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Radchuk VV, Borisjuk L, Sreenivasulu N, Merx K, Mock HP, Rolletschek H, Wobus U,, Weschke W (2009) Spatiotemporal profiling of starch biosynthesis and degradation in the developing barley grain. Plant physiology 150: 190–204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rottmann TM, Fritz C, Lauter A, Schneider S, Fischer C, Danzberger N, Dietrich P, Sauer N,, Stadler R (2018) Protoplast-esculin assay as a new method to assay plant sucrose transporters: characterization of AtSUC6 and AtSUC7 sucrose uptake activity in Arabidopsis Col-0 ecotype. Front Plant Sci 9: 430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schneider CA, Rasband WS,, Eliceiri KW (2012) NIH image to ImageJ: 25 years of image analysis. Nat Methods 9: 671–675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schneitz K, Hulskamp M,, Pruitt RE (1995) Wild-type ovule development in Arabidopsis thaliana: a light microscope study of cleared whole-mount tissue. Plant J 7: 731–749 [Google Scholar]
  42. Sosso D, Luo D, Li QB, Sasse J, Yang J, Gendrot G, Suzuki M, Koch KE, McCarty DR, Chourey PS, et al. (2015) Seed filling in domesticated maize and rice depends on SWEET-mediated hexose transport. Nat Genet 47: 1489–1493 [DOI] [PubMed] [Google Scholar]
  43. Stadler R, Lauterbach C,, Sauer N (2005) Cell-to-cell movement of green fluorescent protein reveals post-phloem transport in the outer integument and identifies symplastic domains in Arabidopsis seeds and embryos. Plant Physiol 139: 701–712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Truernit E, Bauby H, Dubreucq B, Grandjean O, Runions J, Barthelemy J,, Palauqui JC (2008) High-resolution whole-mount imaging of three-dimensional tissue organization and gene expression enables the study of Phloem development and structure in Arabidopsis. Plant Cell 20: 1494–1503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang E, Wang J, Zhu X, Hao W, Wang L, Li Q, Zhang L, He W, Lu B, Lin H, et al. (2008) Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat Genet 40: 1370–1374 [DOI] [PubMed] [Google Scholar]
  46. Wu X, Liu J, Li D,, Liu CM (2016) Rice caryopsis development I: dynamic changes in different cell layers. J Integr Plant Biol 58: 772–785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xu W, Fiume E, Coen O, Pechoux C, Lepiniec L,, Magnani E (2016) Endosperm and nucellus develop antagonistically in Arabidopsis seeds. Plant Cell 28: 1343–1360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang J, Luo D, Yang B, Frommer WB,, Eom JS (2018) SWEET11 and 15 as key players in seed filling in rice. New Phytol 218: 604–615 [DOI] [PubMed] [Google Scholar]
  49. Yang X, Wu F, Lin X, Du X, Chong K, Gramzow L, Schilling S, Becker A, Theissen G,, Meng Z (2012) Live and let die - the B(sister) MADS-box gene OsMADS29 controls the degeneration of cells in maternal tissues during seed development of rice (Oryza sativa). PloS One 7: e51435. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

kiaa045_Supplementary_Data
Click here for additional data file. (3.6MB, zip)

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES