Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2021 Jan 7;185(3):1182–1197. doi: 10.1093/plphys/kiaa089

Ethylene response factors 15 and 16 trigger jasmonate biosynthesis in tomato during herbivore resistance

Chaoyi Hu 1, Chunyu Wei 1, Qiaomei Ma 1, Han Dong 1,2, Kai Shi 1, Yanhong Zhou 1,3, Christine H Foyer 4, Jingquan Yu 1,3,✉,2
PMCID: PMC8133690  PMID: 33793934

Abstract

Jasmonates (JAs) are phytohormones with crucial roles in plant defense. Plants accumulate JAs in response to wounding or herbivore attack, but how JA biosynthesis is triggered remains poorly understood. Here we show that herbivory by cotton bollworm (Helicoverpa armigera) induced both ethylene (ET) and JA production in tomato (Solanum lycopersicum) leaves. Using RNA-seq, ET mutants, and inhibitors of ET signaling, we identified ET-induced ETHYLENE RESPONSE FACTOR 15 (ERF15) and ERF16 as critical regulators of JA biosynthesis in tomato plants. Transcripts of ERF15 and ERF16 were markedly upregulated and peaked at 60 and 15 min, respectively, after simulated herbivore attack. While mutation in ERF16 resulted in the attenuated expression of JA biosynthetic genes and decreased JA accumulation 15 min after the simulated herbivory treatment, these changes were not observed in erf15 mutants until 60 min after treatment. Electrophoretic mobility shift assays and dual-luciferase assays demonstrated that both ERFs15 and 16 are transcriptional activators of LIPOXYGENASE D, ALLENE OXIDE CYCLASE, and 12-OXO-PHYTODIENOIC ACID REDUCTASE 3, key genes in JA biosynthesis. Furthermore, JA-activated MYC2 and ERF16 also function as the transcriptional activators of ERF16, contributing to dramatic increases in ERF16 expression. Taken together, our results demonstrated that ET signaling is involved in the rapid induction of the JA burst. ET-induced ERF15 and ERF16 function as powerful transcriptional activators that trigger the JA burst in response to herbivore attack.

Ethylene-induced ETHYLENE RESPONSE FACTORs 15 and 16 trigger the jasmonate (JA) burst in the tomato plants in response to herbivore attack by directly activating key genes in JA biosynthesis.

Introduction

Insect feeding results in great damage to plant growth and development and has become a major threat to crop production. During the long coevolution between plants and insects, plants have evolved a complex and sophisticated defense system to cope with herbivorous insects. When plants are challenged with wounding or herbivore feeding, jasmonate (JA) and jasmonoyl-isoleucine (JA-Ile, an active form of JA) can accumulate at high levels within several minutes (Glauser et al., 2008; Mielke et al., 2011). JA-Ile is perceived by the CORONATINE INSENSITIVE1 (COI1) receptor and induces the degradation of JASMONATE ZIM-DOMAIN PROTEIN (JAZ) repressors to derepress downstream transcription factors, resulting in rapid activation of JA-responsive genes (Xie et al., 1998; Chini et al., 2007; Thines et al., 2007; Katsir et al., 2008; Yan et al., 2009; Sheard et al., 2010; Zhang et al., 2015). JA plays a central role in the plant defense against herbivorous insects and necrotrophic microorganisms, and resistance to these threats is compromised in mutants deficient in JA biosynthesis or signaling genes (Howe and Jander, 2008; Browse, 2009; Ballaré, 2011; Pieterse et al., 2012; Wasternack and Hause, 2013).

JAs are synthesized from phospholipids after a series of processes catalyzed by lipoxygenases (LOXs), allene oxide synthase (AOS), allene oxide cyclase (AOC), and 12-oxo-phytodienoic acid reductase (OPR) (Wasternack and Hause, 2013). Attacks from herbivorous insects and necrotrophic microorganisms induce the transcription of these genes (Kandoth et al., 2007; Vicedo et al., 2009; Mao et al., 2017). In addition to JAs, there is an increase in electrical signals, Ca2+ signals, the production of reactive oxygen species (ROS) and phytohormones such as ethylene (ET), and the activation of mitogen-activated protein kinases (MAPKs) that are differently involved in the regulation of JA biosynthesis (Kandoth, 2007; Mousavi et al., 2013; Wasternack and Hause, 2013; Toyota et al., 2018; Ma et al., 2020). Ca2+/calmodulin-dependent phosphorylation of JAV1 (Jasmonate-associated VQ domain protein 1) disintegrates the JAV1–JAZ8–WRKY51 (JJW) complex, thereby derepressing JA biosynthesis and giving rise to a rapid burst of JA in the plant response to insect herbivory (Yan et al., 2018). However, how plants initially activate JA biosynthesis for plant defense is unclear.

The ETHYLENE RESPONSE FACTOR (ERF) gene family is a large gene family of transcription factors with important functions in the transcriptional regulation of a variety of biological processes in growth and development as well as responses to various abiotic and biotic stresses (Lorenzo et al., 2003; Xu et al., 2011; Licausi et al., 2013; Dey and Corina Vlot, 2015; Chen et al., 2016). These genes are involved in several phytohormone biosynthesis and signaling processes. For example, octadecanoid-responsive AP2/ERF-domain transcription factor 47 (ORA47) regulates JA and abscisic acid (ABA) biosynthesis and signaling (Chen et al., 2016; Hickman et al., 2017). The tomato (Solanum lycopersicum) ERF Sl-ERF B3 integrates ET and auxin signaling via direct regulation of the expression of the auxin signaling component SlIAA27 (Liu et al., 2018). JA and ET biosynthesis and signaling-related genes are all critical for the positive regulation of resistance to the destructive disease caused by Magnaporthe oryzae in rice (Oryza sativa; Nasir et al., 2018). Most recently, the ET signaling pathway gene ETHYLENE INSENSITIVE 3-like1 (EIL1) was found to directly regulate OsLOX9 to participate in JA synthesis (Ma et al., 2020). However, the role of ERFs in herbivore resistance is unclear.

The studies reported here focus on the identification of key regulatory components involved in herbivory-induced JA biosynthesis and their role in resistance. We examined the role of ET and associated ERFs in the activation of JA biosynthesis. Data are presented showing that herbivory by Helicoverpa armigera induced rapid ET emission and JA accumulation with upregulation of the expression of ERF15, ERF16, LOXD, AOC, and OPR3, which are involved in the signaling and biosynthesis of ET and JA in tomato. By functioning as transcriptional activators of LOXD, AOC, and OPR3, ERF15 and ERF16 trigger the JA burst in response to herbivore attack. These findings not only broaden our understanding of the regulatory mechanism for the rapid burst of JAs in response to wounding and herbivory in plants, but also provide new insights concerning JA-based tradeoffs of defense and growth in plants.

Results

Herbivory by H. armigera induces both ET and JA production in tomato

We first determined the release of ET and accumulation of JA in the leaves in response to herbivory attacks from H. armigera. At 1 h after larval feeding of H. armigera, the release of ET and the accumulation of JA and JA-Ile increased by 35.5%, 138.8%, and 388.4%, respectively (Figure 1, A–C). Meanwhile, the expression of the ET biosynthesis genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthases1 (ACS1) and ACC oxidase1 (ACO1) and JA biosynthesis genes LOXD, AOS, AOC, and OPR3 increased by 80% to 661% after herbivory (Figure 1D).

Figure 1.

Figure 1

Open in a new tab

Herbivory by H. armigera induces ET production and JA accumulation. A, H. armigera feeding-induced ET production. B, Helicoverpa armigera feeding-induced JA accumulation. C, Helicoverpa armigera feeding-induced JA-Ile accumulation. D, Helicoverpa armigera feeding-induced ET and JA biosynthesis gene expression and the time course of W+H2O- and W+OS-induced transcription of ET and JA biosynthesis genes. E, Time course of simulated herbivory-induced ET production. F, Time course of simulated herbivory-induced JA accumulation. G, Time course of simulated herbivory-induced JA-Ile accumulation. For (A–C), samples were taken 1 h after larvae feeding. Three independent biological samples were used for the determination of ET production, JA and JA-Ile content, and RT-qPCR. ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes, and the relative expression of each gene at different time points was normalized to that at time point 0. Data represent the mean ± sd (n = 3). ND, none detected. Means denoted by the same letter did not significantly differ at P < 0.05 according to Student’s t test.

To investigate the time course of JA accumulation, herbivory was simulated by wounding and immediate application of oral secretions (OSs) (W+OS) from H. armigera or water (W+H2O) on the wounded sites. In the healthy leaves (mock), the release of ET increased gradually while the contents of JA and JA-Ile were almost unchanged over the time course. ET release and JA and JA-Ile accumulation immediately increased in the leaves from 15 min after W+OS treatment (Figure 1, E–G). Meanwhile, the transcripts of ET and JA biosynthesis-related genes were induced by both W+OS and W+H2O from 15 to 30 min and peaked at 60 min (ACS1, ACO1, LOXD, and OPR3) or 120 min (AOS and AOC) after the treatment. However, the expression of these genes in the W+H2O treatment was not different from that in the W+OS treatment (Figure 1D). Taken together, these results showed that plants produced increased amounts of ET and JA in response to herbivory.

ET signaling is essential for JA accumulation

To determine whether ET plays a role in JA biosynthesis in the herbivory response, we compared the accumulation of JA and JA-Ile, and the expression of JA biosynthetic genes in wild-type (WT) and Never ripe (Nr) plants, an ET receptor mutant (Tieman et al., 2000), in response to W+OS. In comparison with WT leaves, W+OS-induced JA and JA-Ile accumulation were reduced in Nr leaves (Figure 2A). Consistent with this, the expression of JA biosynthetic genes (LOXD, AOC, OPR3, and AOS) was significantly attenuated in Nr leaves (Supplemental Figure S1A). Moreover, pre-exposure to the ET signaling inhibitor 1-methylcyclopropene (1-MCP), which competes with ET for the receptor, thus inhibiting ET signaling (Sisler and Serek, 1997), significantly attenuated W+OS-induced accumulation of JA and JA-Ile and expression of LOXD, AOC, OPR3 in the WT leaves (Figure 2B;Supplemental Figure S1B). In contrast, exposure to 0.1 μL L−1 ET for 1 h resulted in a small but significant increase in the accumulation of JA and JA-Ile with enhanced resistance against H. armigera (Supplemental Figure S2, A and B). As observed in WT plants, ET treatment significantly induced JA and JA-Ile accumulation in the JA signaling mutant JA–insensitive1 (jai1), which disrupts the function of the homolog of COI1 in Arabidopsis (Arabidopsis thaliana; Li et al., 2004), suggesting that functional JA signaling is not required for ET to activate JA biosynthesis (Supplemental Figure S2C).

Figure 2.

Figure 2

Open in a new tab

ET regulates JA accumulation in tomato. A, Simulated herbivory-induced accumulation of JA and JA-Ile in the leaves of Nr mutant and WT plants. Samples were taken 0 or 60 min after W+OS treatment. B, Simulated herbivory-induced accumulation of JA and JA-Ile in the leaves of plants pretreated with or without 1-MCP. Samples were taken 0 or 15 min after W+OS treatment. 1-MCP was applied for 12 h before W+OS treatment. Three biological samples were used for the determination. Data represent the mean ± sd (n = 3). Two-way analysis of variance (ANOVA) showed that the effects of W+OS, genotype, 1-MCP treatment, W+OS × genotype interaction, and W+OS × 1-MCP interaction on JA and JA-Ile accumulation were all significant (P < 0.05). Means denoted by the same letter did not significantly differ at P < 0.05 according to Tukey’s test.

By performing RNA-seq analysis, we compared the transcriptome profiles in tomato plants with or without W+OS treatment together with or without 1-MCP treatment (treatment a, air_CK; b, air_W+OS; c, 1-MCP_CK; d, 1-MCP_W+OS) (Figure 3A). W+OS induced 4,504 differentially expressed genes (DEGs) (treatment b versus a; Supplemental Dataset 1), and this number decreased to 3,844 in the presence of 1-MCP (treatment d versus c). Moreover, 2,489 DEGs were identified in the pairwise comparison between treatments with or without 1-MCP after W+OS treatment (treatment d versus b; Supplemental Dataset 2) (Figure 3B). A total of 1,243 genes were affected by both the W+OS and 1-MCP treatments. Among the 1,243 DEGs, 646 genes were upregulated by W+OS, of which 563 were downregulated by 1-MCP. Moreover, 597 of the common DEGs were downregulated by W+OS, of which 581 genes were upregulated by 1-MCP (Figure 3C). Gene Ontology (GO) analysis of DEGs between treatments with or without 1-MCP after W+OS treatment showed that genes involved in JA biosynthesis (GO:0009695), JA metabolism (GO:0009694), JA signaling (GO:0009753), and many other biotic response processes were significantly enriched (Supplemental Figure S3A; Supplemental Dataset 3). The expression of JA synthesis genes (LOXD, AOC, AOS, and OPR3), signaling genes (JAZ1, JAZ2, JAZ3, JAZ4, JAZ6, and JAZ7) and defense genes (PI-I and TD) was suppressed by 1-MCP treatment (Figure 3D). Taken together, the results above strongly indicate that ET signaling could be involved in the regulation of herbivory-induced JA biosynthesis.

Figure 3.

Figure 3

Open in a new tab

DEGs and ERFs identified from RNA-seq data. A, Diagram of the RNA-seq experimental setup. Treatment a, air_CK; b, air_W+OS; c, 1-MCP_CK; d, 1-MCP_W+OS. B, The number of DEGs of each pairwise comparison (FDR (false discovery rate) adjusted P < 0.05). C, Distribution of genes upregulated or downregulated by W+OS or 1-MCP treatment among the 1,243 DEGs common to both treatments. D, Expression of representative JA-responsive genes in the RNA-seq experiments. The average TPM value of each gene is shown. E Venn diagrams of W+OS-regulated ERFs (differentially expressed between W+OS-treated and untreated WT plants; FDR adjusted P < 0.05) and 1-MCP-regulated ERFs (differentially expressed between W+OS-treated plants pretreated with 1-MCP or not, FDR-adjusted P <0.05). ERFs coregulated by W+OS and 1-MCP are shown in the overlapping region. F, Expression of W+OS and 1-MCP coregulated ERFs. The fold-change in the average expression (log2 scale) of each gene is shown. Samples were taken 0 or 15 min after W+OS treatment. Three independent biological samples were used.

ERF15 and ERF16 positively regulate H. armigera resistance through JA signaling

To determine how ET regulates JA accumulation, we screened the expression patterns of all ERF genes in our RNA-seq data. Among the 137 ERF genes in S. lycopersicum, 72 ERF genes were differentially expressed after W+OS treatment, and the transcripts of 25 ERF genes were altered by 1-MCP. Moreover, 21 ERF genes were coregulated by simulated herbivory and ET signaling (Figure 3E). Then, we analyzed the homology of these 21 ERF genes to the Arabidopsis ERF genes from PlantTFDB (Supplemental Figure S3B). Notably, two ERF genes, Solyc06g054630 and Solyc12g009240, named ERF15 and ERF16, respectively, according to Sharma et al. (2010), were significantly upregulated by simulated herbivory but downregulated by 1-MCP treatment (Figure 3F). RT-qPCR (Real-Time quantitative PCR) analysis showed that the expression of ERF15 and ERF16 was very low in undamaged healthy leaves, compared to the expression of JA biosynthetic genes (Supplemental Table S1). The expression of ERF15 and ERF16 was largely upregulated by herbivore larval feeding and W+H2O or W+OS treatment (Figure 4, A and B; Supplemental Figure S4A). Both the ERF15 and ERF16 genes were induced from 15 min after either W+H2O or W+OS treatment. However, the expression of ERF15 peaked at 60 min, while that of ERF16 peaked at 15 min after the treatment (Figure 4, A and B). Moreover, RT-qPCR analysis verified that the simulated herbivory-induced expression of ERF15 and ERF16 was suppressed in the plants pretreated with 1-MCP (Supplemental Figure S4B), suggesting that the expression of ERF15 and ERF16 was regulated by ET signaling. Subcellular localization analysis showed that both ERF15 and ERF16 are located in the nucleus, similar to most transcription factors (Supplemental Figure S5).

Figure 4.

Figure 4

Open in a new tab

Expression of ERF15 and ERF16 is rapidly induced after W+H2O and W+OS treatment. A, Time course of W+H2O- and W+OS-induced expression of ERF15. B, Time course of W+H2O- and W+OS-induced expression of ERF16. Gene transcripts were analyzed with RT-qPCR with three independent biological samples. ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes. The relative expression of each gene was normalized to that at time point 0 under mock conditions. Data represent the mean ± sd (n = 3).

Next, we generated erf15 and erf16 mutants by a clustered, regularly interspaced, short palindromic repeat (CRISPR)/CRISPR-associated 9 (Cas 9) technique for subsequent experiments. Two homozygous gene editing lines for ERF15 (15-1 and 15-3) and ERF16 (16-3 and 16-10) were isolated (Supplemental Figure S6). Herbivory feeding trials showed that all these erf15 and erf16 mutant plants showed reduced resistance against H. armigera, as indicated by an increased mass of larvae and more severe damage to the mutant plants than to the WT (Figure 5, A–C). However, there was no significant difference in the mass increase for H. armigera growing on erf15 and erf16 mutants (Figure 5A).

Figure 5.

Figure 5

Open in a new tab

ERF15 and ERF16 positively regulate H. armigera resistance and JA biosynthesis. A, Average weight increase of larvae after 3 days of feeding on erf15 and erf16 plants. Data represent the mean ± sd (n = 24). B, Images of larvae after 3 days of feeding on erf15 and erf16 plants. Representative examples of larval feeding on each genotype are shown. Bar = 1 cm. C, Images of representative plants after 3 days of larval feeding. Bar = 5 cm. D, Simulated herbivory-induced accumulation of JA in the leaves of erf15 or erf16 mutants. E, Simulated herbivory-induced accumulation of JA-Ile in the leaves of erf15 or erf16 mutants. F, Simulated herbivory-induced expression of the JA synthetic gene LOXD in the leaves of erf15 or erf16 mutants. G, Simulated herbivory-induced expression of the JA synthetic gene AOC in the leaves of erf15 or erf16 mutants. H, Simulated herbivory-induced expression of the JA synthetic gene OPR3 in the leaves of erf15 or erf16 mutants. For (D–H), three independent biological samples were used for the determination. ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes, and the relative expression of each gene was normalized to that in WT plants at 0 min. Data represent the mean ± sd (n = 3). Means denoted by the same letter did not significantly differ at P < 0.05 according to Tukey’s test.

To determine the contribution of ERF15 and ERF16 in JA biosynthesis, we examined the time course of the accumulation of JA and the expression of JA biosynthetic genes in WT, erf15, and erf16 in response to W+OS. The accumulation of JA and JA-Ile and the expression of LOXD, AOC, and OPR3 were induced from 15 min in all these plants. Importantly, erf16 decreased JA and JA-Ile accumulation and the expression of LOXD, AOC, and OPR3 from 15 min, while erf15 decreased JA and JA-Ile accumulation and the expression of LOXD, AOC, and OPR3 from 60 min after the W+OS treatment compared to those in WT plants (Figure 5, D–H). These results showed that both ERF15 and ERF16 are involved in the regulation of JA biosynthesis.

To test whether ERF15 and ERF16 play a role in JA-dependent resistance, we applied methyl JA (MeJA) at a concentration of 100 μM onto leaves 12 h before they were exposed to H. armigera attack. Foliar application of MeJA had modest effects on resistance in WT plants but considerably enhanced the resistance in erf15 and erf16 mutants. After MeJA treatment, the mass increase of the larvae feeding on erf15 and erf16 plants decreased by 34% and 31%, respectively, compared to that without MeJA treatment. Finally, the mass of H. armigera larvae growing on the erf15 and erf16 plants was comparable to that of those growing on MeJA-treated WT plants (Figure 6A). These results demonstrated that the application of MeJA can rescue the compromised resistance in erf15 and erf16 plants and substantiated the critical role of ERF15 and ERF16 in JA-dependent resistance in tomato plants. Furthermore, we generated erf15erf16 double mutants (erf15/16) and compared their resistance against H. armigera with erf15 and erf16 mutants. As shown in Figure 6B, there was a more significant increase for the mass of H. armigera growing on the erf15/16 double mutants than on either erf15 or erf16 mutants, suggesting that ERF15 and ERF16 jointly contribute to defense against herbivores.

Figure 6.

Figure 6

Open in a new tab

ERF15 and ERF16 regulate H. armigera resistance through JA signaling and jointly contribute to resistance. A, Average weight increase (left) and representative images (right) of larvae after 3 days of feeding on plants pretreated with or without 100 μM MeJA. Data represent the mean ± sd (n = 15). Two-way ANOVA showed that the effects of MeJA and genotype on resistance were significant, but the MeJA × genotype interaction was insignificant (P < 0.05). Asterisks indicate significant differences between MeJA and mock treatment at P < 0.05 according to Student’s t test. B, Average weight increase (left) and representative images (right) of larvae after 3 days of feeding on erf15, erf16 single mutants, and erf15/16 double mutants plants. Data represent the mean ± sd (n = 24). Means denoted by the same letter did not significantly differ at P < 0.05 according to Tukey’s test. Bar = 1 cm.

ERF15 and ERF16 activate the expression of LOXD, AOC, and OPR3 by directly binding to their promoters

Having established that ERF15 and ERF16 are involved in herbivory-induced JA biosynthesis and herbivore resistance, we then examined how ERF15 and ERF16 regulate JA biosynthesis at the transcriptional level. By searching the ERF-binding motif in the promoters of LOXD, AOC, AOS, and OPR3 in tomato, we found several ERF binding motifs, CCG(A/T)CC, in the promoters of LOXD, AOC, and OPR3 but not in the promoter of AOS (Supplemental Figure S7). We then performed electrophoretic mobility shift assays (EMSAs) to investigate whether the fusion protein His-ERF15/16 could directly bind to the promoters of LOXD, AOC, and OPR3. Both ERF15 and ERF16 are bound to the CCGTCC-containing DNA probes for LOXD, AOC, and OPR3. This binding was successfully outcompeted by unlabeled DNA probes, but not by unlabeled mutant probes in which the CCGTCC motif was replaced by TTGTTT. Moreover, ERF15 and ERF16 failed to bind to mutant probes (Figure 7, A and B), demonstrating that the binding of ERF15/16 to the promoter is specific. Furthermore, dual-luciferase (LUC) assays showed that ERF15/16 transactivated the promoters of LOXD, AOC, and OPR3 (Figure 7C). Taken together, these results demonstrate that ERF15 and ERF16 showed the same transcript activity and that LOXD, AOC, and OPR3 are direct targets of ERF15 and ERF16.

Figure 7.

Figure 7

Open in a new tab

ERF15 and ERF16 activate LOXD, AOC, and OPR3 expression by directly binding to their promoters. A, EMSA showing His-ERF15 directly binds to the promoters of LOXD, OPR3, and AOC. B, EMSA showing His-ERF16 directly binds to the promoters of LOXD, OPR3, and AOC. C, Regulatory effects of ERF15 and ERF16 on the promoters of LOXD, OPR3, and AOC as determined by dual-LUC assays. For (A) and (B), mut, mutated probe in which the CCGTCC motif was changed to TTGTTT. Competitors and mutant competitors were used at 1,000-fold. For (C), the ratio of firefly LUC and REN LUC of the empty vector (EV) plus promoter was set as 1. Data represent the mean ± sd (n = 5). Statistically significant differences from EV were determined using Student’s t test and are indicated using asterisks (*P < 0.05, **P < 0.01).

ERF15/16 transcription is regulated by JA signaling and multiple regulators

We then examined the role of JA signaling in the regulation of the expression of ERF15 and ERF16. MYC2 is the master regulator of JA signaling in plants. The expression of MYC2 was induced from 15 min and peaked at 30 min after W+H2O and W+OS treatment (Supplemental Figure S8A). However, such an induction was not observed in the JA signaling mutant jai1 (Supplemental Figure S8B). W+OS treatment was also effective in inducing the expression of ERF15 and ERF16 in jai1 mutants, although the effects were less than those in the WT plants (Figure 8, A and B). To determine whether the induction of the expression of ERF15 and ERF16 by JA signaling is MYC2 dependent, we generated CRISPR/Cas9 myc2 mutants (Supplemental Figure S8C) and treated WT and myc2 plants with MeJA. The expression of ERF16 was induced five-fold in WT leaves by MeJA treatment. However, this upregulation was totally abolished in myc2 leaves (Figure 8C). We also compared the transcript response of ERF16 to W+OS treatment and found that W+OS-induced expression of ERF16 was also attenuated in myc2 mutants (Figure 8D). Consistent with this, the expression of LOXD and OPR3 induced by W+OS was significantly attenuated in myc2 mutants (Figure 8E). In contrast, ERF15 expression was induced by MeJA in both WT and myc2 plants (Supplemental Figure S9A), suggesting that it is MYC2-independent. We then performed a dual-LUC assay to determine whether MYC2 transactivated the promoter of ERF16 and then induced the expression of ERF16. The results showed that LUC activity was significantly induced by MYC2 (Figure 8F), suggesting that MYC2 functions as a positive regulator of the expression of ERF16. In addition, a dual-LUC assay demonstrated that ERF16 could regulate its expression by transactivating its promoter (Figure 8G). Consistent with this, the expression of ERF16 was significantly reduced in erf16-3 and erf16-10 mutants in response to W+OS (Figure 8H). However, ERF15 mRNA expression could not be induced by ERF16, ERF15, or MYC2 (Supplemental Figure S9B). In conclusion, the herbivory-induced JA activated the expression of ERF15 and ERF16 in an MYC2-independent and MYC2-dependent manner, respectively. Meanwhile, the expression of ERF16 was also regulated by ERF16 itself.

Figure 8.

Figure 8

Open in a new tab

ERF15/16 transcription is regulated by JA signaling and multiple regulators. A, The expression of ERF15 in jai1 plants 60 min after W+OS. Two-way ANOVA showed that the effects of W+OS treatment, genotype, and W+OS × genotype interaction on the expression of ERF15 were all significant (P < 0.05). B, The expression of ERF16 in jai1 plants 15 min after W+OS. Two-way ANOVA showed that the effects of W+OS treatment, genotype, and W+OS × genotype interaction on the expression of ERF16 were all significant (P < 0.05). C, JA and MYC2 regulated the expression of ERF16. Samples were taken 15 min after 50 μM MeJA treatment. Two-way ANOVA showed that the effects of MeJA treatment, genotype, and MeJA × genotype interaction on the expression of ERF16 were all significant (P < 0.05). D, The expression of ERF16 in myc2 plants 15 min after W+OS. Two-way ANOVA showed that the effects of W+OS treatment, genotype, and W+OS × genotype interaction on the expression of ERF16 were all significant (P < 0.05). E, The expression of LOXD and OPR3 in myc2 plants 60 min after W+OS. Two-way ANOVA showed that the effects of W+OS treatment, genotype, and W+OS × genotype interaction on the expression of LOXD and OPR3 were all significant (P < 0.05). F, Regulatory effects of MYC2 on the promoter of ERF16 as determined by dual-LUC assays. G, Regulatory effects of ERF16 on the promoter of ERF16 as determined by dual-LUC assays. H, The expression of ERF16 in erf16 plants 15 min after W+OS. Two-way ANOVA showed that the effects of W+OS treatment, genotype, and W+OS × genotype interaction on the expression of ERF16 were all significant (P < 0.05). I, A model for ERF15- and ERF16-regulated JA activation. In tomato, ET is one of the signaling components in the response to herbivore attack that induces the expression of ERF15 and ERF16. ERF15 and ERF16 trigger JA biosynthesis with enhanced defense against herbivory by regulating expression of LOXD, AOC, and OPR3. In addition, the expression of ERF15 and ERF16 is regulated by JA signaling in an MYC2-independent and MYC2-dependent manner, respectively. The expression of ERF16 is also regulated by ERF16 itself. Meanwhile, MYC2 can directly regulate JA synthesis genes, that is, LOXD in tomato (Yan et al., 2013). For (A–E) and (H), gene transcripts were analyzed with RT-qPCR with three independent biological samples. ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes. The relative expression of each gene was normalized to that in WT plants at 0 min or under mock conditions. Data represent the mean ± sd (n = 3). For (F) and (G), the ratio of firefly LUC and REN LUC of the EV plus promoter was set as 1. Data represent the mean ± sd (n = 5). Means denoted by the same letter did not significantly differ at P < 0.05 according to Tukey’s test [for (A–E) and (H)) or Student’s t test (for (F) and (G)].

Discussion

Plants respond to herbivore attack by accumulating JAs in local and distant leaves, however, how plants initiate JA biosynthesis for herbivore defense is a long-standing question in plant–insect interaction research. In Arabidopsis, Ca2+/calmodulin signaling and the JJW complex participate in the injury-induced rapid burst of JA (Yan et al., 2018). The results presented here uncovered a rapid and sophisticated regulatory mechanism of the role of ET signaling in activating JA biosynthesis in the plant response to herbivore attack. ET is one of the signaling components in the plant response to herbivore attack by inducing the expression of ERF15 and ERF16 in tomato. By functioning as transcriptional regulators of LOXD, AOC and OPR3, ERF15, and ERF16 trigger JA biosynthesis with enhanced resistance against herbivore attack. In addition, the expression of ERF15 and ERF16 is regulated by JA signaling in an MYC2-independent and MYC2-dependent manner, respectively. The expression of ERF16 is also regulated by ERF16 itself (Figure 8I).

Although several studies have shown that herbivory induces the production of ET in several plant species (Winz and Baldwin, 2001; De Vos et al., 2005; Wünsche et al., 2011), its role in the regulation of JA biosynthesis is still unclear. ET emission occurred within a few minutes to several hours after Manduca sexta larvae herbivory, leaf application of OS on the wounded native tobacco (Nicotiana attenuate) leaves, and in rice infested with the leaf folder Cnaphalocrocis medinalis (Kahl et al., 2000; Wang et al., 2011). In this study, we provided convincing evidence for the role of ET in the regulation of JA biosynthesis. First, an increase in JAs and ET was concomitantly induced (Figure 1, E–G), and the ET signaling mutant Nr showed attenuated JA accumulation in response to W+OS treatment (Figure 2A). Second, inhibition of ET signaling by the application of 1-MCP prevented the elevation of JA accumulation and expression of JA biosynthetic genes, while application of ET significantly induced JA and JA-Ile accumulation and decreased the larval mass of H. armigera (Figure 2B; Supplemental Figures S1B and S2). Third, mutation of ERF15 and ERF16, which are subjected to positive regulation by ET signaling, attenuated the elevation of JAs, expression of JA biosynthetic genes, and resistance (Figure 5). These datasets present convincing evidence that ET signaling is involved in the induction of JA biosynthesis. However, this result is different from that observed in Arabidopsis. In Arabidopsis, ethylene insensitive2 mutants are more resistant to generalist Egyptian cotton worms (Spodoptera littoralis; Bodenhausen and Reymond, 2007). Meanwhile, the ET-stabilized transcription factor ETHYLENE-INSENSITIVE3 can interact with and repress MYC2 to inhibit JA-induced expression of wound-responsive genes and herbivory-inducible genes (Song et al., 2014). It seems likely that the role of ET in JA signaling and herbivore defense is plant species dependent. Given that an increase in ET emission is not limited to the plants in response to herbivory, but also to that after attacks from pathogens (Guan et al., 2015; Helliwell et al., 2016; Zhang et al., 2018), it is highly warranted to study whether such an ET-dependent activation of JA biosynthesis is a universal mechanism adopted by plants to challenge biotic stress.

JA biosynthesis is regulated at the transcriptional and post-transcriptional levels (Wasternack and Song, 2017; Yan et al., 2018; Ma et al., 2020). JAs are formed from α-linolenic acid in the chloroplast membranes after a series of processes catalyzed by LOXs, AOS, AOC, and OPR (Wasternack and Hause, 2013). To date, several ET-related transcription factors, such as EIL1 and AP2/ORA47 can directly activate the transcription of LOX9 in rice or bind to a cis-element present in a number of downstream genes involved in hormone biosynthesis and signaling, as well as other processes in Arabidopsis (Chen et al., 2016; Ma et al., 2020); however, we are still unable to explain how transcripts of genes other than LOXs in JA biosynthesis are rapidly activated in response to herbivory. Here, we found that ET-mediated JA biosynthesis is linked to the transcriptional activation of most genes in JA biosynthesis (LOXD, AOC, and OPR3) by ERF15 and ERF16 in tomato, the ortholog of which is ORA47 in Arabidopsis (Supplemental Figure S3B; Chen et al., 2016). Under nonstress conditions, plants accumulated low JA with low expression of ERF15 and ERF16 (Supplemental Table S1). However, wounding or simulated herbivory resulted in sharp increases in the accumulation of JA and the expression of ERF15 and ERF16 (Figures 1, F and G and 4). The expression of ERF15 and ERF16 was regulated by both ET and JA signaling and in an MYC2-independent and MYC2-dependent manner, respectively (Supplemental Figures S4B, S8A–D and F, and S9). Importantly, in vivo and in vitro assays all demonstrated that both ERF15 and ERF16 are transcriptional activators of LOXD, AOC, and OPR3 by binding to the CCGTCC motif in the promoter of the LOXD, AOC, and OPR3 genes (Figure 7). Consistently, both the erf15 and erf16 single mutants showed decreased accumulation of JAs and reduced resistance against H. armigera (Figure 5). Notably, the expression of ERF16 was highly induced and peaked at 15 min, while ERF15 expression peaked at 60 min after W+OS treatment (Figure 4). Meanwhile, mutation in ERF16 resulted in significant decreases in JA and JA-Ile accumulation at 15 min, while these decreases were not observed until 60 min after W+OS treatment in erf15 mutants compared to WT (Figure 5, D and E). Furthermore, erf15/erf16 double mutants exhibited reduced resistance against H. armigera compared to either erf15 or erf16 single mutants (Figure 6B). These datasets allow us to conclude that ERF15 and ERF16 function together in the regulation of herbivory defense and JA biosynthesis by activating the LOXD, AOC, and OPR3 genes and add new insights into the sophisticated expression and regulatory pattern of ERFs in plants.

Compared to changes in other hormones, such as ABA, auxin, gibberellins, and brassinosteroids, stress-induced increases in JA accumulation are much more significant. In our study, JA accumulation and the expression of ERF15 and ERF16 increased by c. 20-fold and several thousand times in response to wounding or simulated herbivory, respectively (Figures 1, F and G and 4). Therefore, how such large changes are induced is an important issue to be addressed. It has been suggested that JA biosynthesis is activated through two main sequential stages: JA biosynthesis is first activated to a moderate level independent of JA signaling and then feedback regulated by JA signaling to a sufficiently high level (Farmer, 2007; Browse, 2009). The results from our study demonstrated that such a sharp upregulation of ERF16 expression was attributed to its transcriptional activation by MYC2 and its self-activation by ERF16. As a master regulator of JA signaling, MYC2 participates in the regulation of many JA-dependent physiological processes (Dombrecht et al., 2007; Kazan and Manners, 2013; Du et al., 2017). In Arabidopsis, MYC2/3/4 function as transcriptional activators of several JA biosynthesis genes in controlling wounding-induced JA accumulation (Zhang et al., 2020). In tomato, MYC2 regulates TomLoxD expression through a direct association with its promoter (Yan et al., 2013). In this study, we demonstrated that MYC2 transactivated the promoter of ERF16, but not ERF15, by the dual-LUC assay (Figure 8F), inducing the expression of ERF16. In support of this, MeJA-induced expression of ERF16 and W+OS-induced expression of ERF16, LOXD, and OPR3 were significantly attenuated in myc2 mutants (Figure 8, C–E). In addition, we also found that ERF16 could be activated by itself (Figure 8, G and H). Apparently, such an integration of these different regulatory pathways contributes to the sharp induction of ERF16 in response to herbivory. Notably, the expression of ERF16 rapidly decreased from 15 min and reached levels close to those of the control at 60 min after W+OS treatment (Figure 4B). A recent study revealed that MYC2 and MYC2-TARGETED BHLH can form an autoregulatory negative feedback loop to negatively regulate MYC2-targeted genes and JA signaling (Liu et al., 2019). Further work on the time course of this loop will provide insight into the mechanism of dynamic changes in JA biosynthesis and how plants use this mechanism to balance defense and growth, as too much accumulation of JA will prevent plants from growing.

It is also worth noting that JA biosynthesis is likely regulated by multiple signaling pathways. We found that suppression of ET signaling or mutations in either ERF15 or ERF16 failed to completely abolish herbivory-induced expression of LOXD, AOC, and OPR3 and JA accumulation, suggesting that other signals, TFs, or regulators are also involved in the regulation of these genes. Herbivore attack induces rapid changes in electrical signals and Ca2+, which are essential for the activation of MAPKs (Mousavi et al., 2013; Toyota et al., 2018; Wang et al., 2019). The MAPK cascade participates in the regulation of JA biosynthesis by modifying JA biosynthetic proteins. Downregulation of MPK1 and MPK2, homologs of MPK6 and MPK3 in Arabidopsis, attenuate herbivore- and nematode-induced JA accumulation in tomato (Kandoth et al., 2007; Wang et al., 2019). Further work on the crosstalk of Ca2+/ROS and electrical signals with ET signals will shed additional light on the defense mechanisms of plants.

Materials and methods

Plant materials

Seeds of tomato (S. lycopersicum L. cv. “Ailsa Craig,” “Condine Red”), the ET signaling mutant Nr, and its WT line cv. Pearson and the JA signaling mutant jai1 and its WT line cv. Castlemart were obtained from the Tomato Genetics Resource Center (University of California, Davis, CA, USA), Prof. Y.L. Bai (Wageningen University, the Netherlands) and Prof. C.Y. Li (Chinese Academy of Sciences, Beijing, China). ERF15, ERF16, and MYC2 CRISPR/Cas9 vectors were constructed as described by Pan et al. (2016). The target sequences (TAACTTTCCTGATAGTCCGC), (AGGGGCTAATTTCAATTTCC), and (AGCATCCACAGTCGCAGCTG) for ERF15, ERF16, and MYC2, respectively, were designed using the web tool CRISPR-P (Lei et al., 2014). The synthesized sequences were annealed and inserted into the AtU6-sgRNA-AtUBQ-Cas9 vector at the BbsI site, and the reconstructed vectors were digested and ligated into the HindIII and KpnI sites of the pCAMBIA1301 binary vector. The resulting plasmids were transformed into Agrobacterium tumefaciens strain EHA105 and then introduced into tomato (Fillatti et al., 1987). CRISPR/Cas9-induced mutations were genotyped by PCR amplification and DNA sequencing. Homozygously mutated F2 generations of erf15, erf16, and myc2 were used for this study. The double mutant erf15/erf16 was generated by crossing the erf15-3 mutant and the erf16-10 mutant, and the homozygous F3 generation was used. Seedlings were grown in a growth room and received Hoagland’s nutrient solution (growth conditions were 400 µmol m−2s−1 photosynthetic photon flux density, 25°C/20°C day/night, 12 h photoperiod).

Plant treatments

Tomato plants at the eight-leaf stage were used for the experiments unless otherwise specified. Insect feeding was performed by allowing fourth-instar larvae of cotton bollworms (H. armigera) obtained from Jiyuan Baiyun Industry Co., Ltd. (Henan, China) to feed on tomato plants for 1 h, and bitten leaves were immediately sampled after that. Insect feeding was also simulated by crushing both sides of the leaflets with hemostatic forceps and immediately treating the wounded sites with 10 μL of one-fifth-diluted OSs (W+OS) from H. armigera. Plants treated with 1-MCP, produced by the Chinese Academy of Sciences Lanzhou Institute of Chemical Physics (Lanzhou, China), were sealed in a 20 L container with 10-µL L−1 1-MCP or air (mock) for 12 h before W+OS treatment. For JA treatment, plants were sprayed with 100 μM methyl JA (MeJA; Cas no. 39924-52-2; Sigma-Aldrich; diluted from 1,000-fold stock in ethanol) or 0.1% (v/v) ethanol (mock) 12 h before the resistance assay. ET is produced from ethephon (Cas no. 16672-87-0; Sangon Biotech) by reacting with NaOH aqueous solution. ET treatment was performed by sealing plants into transparent plastic containers with 0.1 µL L−1 ET or air (mock) for 1 h. For feeding trials, uniform H. armigera third-instar larvae (∼5 mg) reared on an artificial diet, obtained from Jiyuan Baiyun Industry Co., Ltd. (Henan, China), were starved for 1 day. After starvation, 3–4 larvae were placed on one tomato plant at the six-leaf stage, and each treatment contained at least five plants. After 3 days of feeding on plants, the larval masses were measured. Each experiment was repeated three times. For MeJA-induced gene expression, 14-day-old tomato seedlings were treated by dipping the leaves into a mock (containing 0.1% (v/v) ethanol) or 50 μM MeJA solution (diluted from 1,000-fold stock in ethanol).

RNA extraction and RT-qPCR analysis

Three biological samples were used. Each sample was taken from three leaves from three independent plants. An RNA prep pure Plant Kit (TIANGEN, Beijing, China) was used to extract total RNA following the instructions provided. Total RNA (0.5 μg) was reverse transcribed to cDNA using a HiScript II Q RT SuperMix for qPCR Kit (Vazyme Biotech Co., Ltd., Nanjing, China). RT-qPCR experiments were performed on a Light Cycler 480 II Real-Time PCR detection system (Roche, Basel, Germany) using AceQ qPCR SYBR Green Master Mix kits (Vazyme Biotech Co., Ltd., Nanjing, China). Each reaction consisted of 10 μL SYBR Green PCR Master Mix, 1-μL cDNA, and forward and reverse primers at 0.1 μM. PCR was performed with 3 min at 95°C, followed by 45–50 cycles of 30 s at 95°C, 30 s at 58°C, and 1 min at 72°C. The housekeeping genes ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes (Livak and Schmittgen, 2001). Sequences of primer pairs are listed in Supplemental Table S2.

Construction of RNA-seq libraries

RNA-seq analysis was conducted using three biological replicates. Leaf samples were collected from three leaves from three independent plants in each biological replicate for total RNA extraction using an RNA Prep Pure Plant Kit (TIANGEN, Beijing, China). RNA concentration and purity were measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and Labchip GX Touch HT Nucleic Acid Analyzer (PerkinElmer, Waltham, MA, USA). High-quality RNA was sent to WuHan Bioacme Biological Technologies Corporation (Wuhan, China) for cDNA library construction and sequencing. mRNA was then enriched by oligo (dT) beads. RNA sequencing libraries were generated using the KAPA Stranded RNA-Seq Kit (Illumina, San Diego, CA, USA) with multiplexing primers, according to the manufacturer’s protocol. Then, sequencing was performed on an Illumina Nova sequencer, and 150-bootstrap (bp) paired-end reads were generated.

Analysis of RNA-seq data

Approximately 4 Gb of high-quality paired-end reads were generated from each library. Clean data (clean reads) were obtained by removing reads containing adapters, reads containing poly-N and low-quality reads from raw data using Trimmomatic version 0.36 and were aligned to the tomato genome SL2.50 (https://solgenomics.net) using the Hisat2 mapping tool (Kim et al., 2015). The number of generated clean reads and successfully aligned tomato genome reads for each library are listed in Supplemental Dataset 4. FeatureCounts version 1.5.0 (Liao et al., 2014) was used to calculate the transcripts per kilobase of exon model per million mapped reads (TPM) values to evaluate the gene expression levels in all biological replicates. The R software DESeq2 package was used to identify DEGs between samples using raw counts (Love et al., 2014). Genes with a P < 0.05 and a log2-fold change absolute value ≥1 were considered differentially expressed. GO enrichment analysis of DEGs was implemented by the GOseq R package, in which gene length bias was corrected (Young et al., 2010). GO terms with corrected P˂ 0.05 were considered significantly enriched.

Measurement of JA, JA-Ile, and ET contents

Three biological samples were used for the measurement of JA and JA-Ile contents. Each sample of 100 mg was taken from three leaves from three independent plants. The JA and JA-Ile contents were measured as previously described (Wang et al., 2019). ET production was measured as described previously (Zhang et al., 2018) with minor modifications. Briefly, three leaves from three plants subjected to W+OS or unwounded (mock) were sealed in a 14-mL transparent polychloroprene container under the same growth conditions, and then 1-mL gas was removed at a specific time and injected into a gas chromatograph (Agilent 6890N; Agilent Technologies Inc., Santa Clara, CA, USA) fitted with a Proapack-Q column. The temperatures of the injector, detector, and oven were 140°C, 230°C, and 100°C, respectively.

Subcellular localization of ERF15/16

The ERF15 and ERF16 full-length coding sequences without the stop codon were amplified and then fused to the pCAMBIA2300 (CAMBIA, Portland, OR, USA) vectors with a GFP (green fluorescent protein) tag at the C-terminus. The primers used for vector construction are listed in Supplemental Table S3. The construct (35S-ERF15/16-GFP) was transformed into A. tumefaciens strain GV3101 and then expressed transiently in transgenic Nicotiana benthamiana (expressed with nucleus-located mCherry) leaves. At 48 h after infiltration, subcellular localization of ERF15/16 was determined with a Zeiss LSM 780 confocal microscope (Zeiss, Oberkochen, Germany). The excitation/emission wavelengths were 488 nm/500–530 nm for GFP and 561 nm/580–620 nm for mCherry.

Dual-LUC assays

The dual-LUC assay was conducted according to previous protocols (Min et al., 2012). Full-length sequences of ERF15/16 and the promoters of JA biosynthesis genes were inserted into the pFGC1008-HA and pGreen II 0800-LUC vectors, respectively. The primers used for vector construction are listed in Supplemental Table S3. Then, all the constructs were transformed into A. tumefaciens strain GV3101. The A. tumefaciens mixtures of TFs and promoters with a ratio of 10:1, which were both adjusted to an OD (optical density)600 of 0.75 with infiltration buffer (150-μM acetosyringone, 10-mM MES, and 10-mM MgCl2, pH 5.6), were then infiltrated into the leaves of N. benthamiana. At 3 days after infiltration, firefly LUC and Renilla (REN) LUC were assayed using the Dual-LUC Reporter Assay System (Promega, Madison, WI, USA). The regulatory effects of each TF-promoter interaction were confirmed by at least three independent experiments.

Recombinant proteins and EMSA

Full-length CDSs of ERF15 and ERF16 were PCR amplified and cloned into pET-32a. The primers used for vector construction are listed in Supplemental Table S3. The recombinant His-fusion proteins were expressed in Escherichia coli BL21 (DE3) cells and purified following the manufacturer’s instructions for the Novagen pET purification system. Oligonucleotide probes were end-labeled with biotin according to the manufacturer’s protocol for the Biotin 3′-End DNA Labeling Kit (Pierce, Appleton, WI, USA) and annealed to double-stranded DNA. EMSAs were performed using a LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (Chen et al., 2011; Du et al., 2014). Briefly, biotin-labeled probes with or without competitors or mutant competitors (1,000-fold) were incubated with His-ERF15/16 proteins at room temperature for 20 min, and free and bound probes were separated via a 6% non-denaturing polyacrylamide gel. The probes used for the EMSAs are listed in Supplemental Table S4.

Phylogenetic analysis

Full-length amino acid sequence alignment and phylogenetic tree construction were performed with Molecular Evolutionary Genetics Analysis (MEGA) version 5.05 and illustrated by Interactive Tree Of Life (iTOL) (itol.embl.de). A consensus neighbor-joining tree was obtained from 1,000-bp replicates of aligned sequences.

Statistical analysis

Data were statistically analyzed by analysis of variance using SAS software version 8 (SAS Institute, Cary, NC, USA). The significance of treatment differences was analyzed using Student’s t test or Tukey’s test (P < 0.05), which is indicated in the figure legends. All of the statistical parameters of the experiments can be found in figure legends, figures, and tables.

Accession numbers

Sequence data from this article can be found in the Sol Genomics Network (http://solgenomics.net/) database under the following accession numbers: ERF15, Solyc06g054630; ERF16, Solyc12g009240; AOC, Solyc02g085730; AOS, Solyc11g069800; LOXD, Solyc03g122340; OPR3, Solyc07g007870; ACS1A, Solyc08g081550; ACS1B, Solyc08g081540; ACO1, Solyc07g049530; MYC2, Solyc08g076930; ACTIN2, Solyc11g005330; UBI3, Solyc01g056940.

The raw sequence data have been deposited in the National Center for Biotechnology Information under accession numbers SAMN13668487- SAMN13668510 and are accessible at https://www.ncbi.nlm.nih.gov/.

Supplemental data

The following materials are available in the online version of this article.

Supplemental Figure S1 ET regulates the JA biosynthetic genes.

Supplemental Figure S2 ET enhanced resistance against H. armigera and the accumulation of JA and JA-Ile.

Supplemental Figure S3 GO analysis of DEGs between treatments with or without 1-MCP after W+OS treatment and phylogenetic analysis of ERFs coregulated by W+OS and 1-MCP with ERFs from Arabidopsis.

Supplemental Figure S4 Herbivory induction and ET regulated the expression of ERF15 and ERF16.

Supplemental Figure S5 Subcellular locations of ERF15 and ERF16.

Supplemental Figure S6 Schematic illustration of the isolation of erf15 and erf16 mutants.

Supplemental Figure S7 ERF binding motif in the promoters of LOXD, AOS, AOC, and OPR3 in tomato.

Supplemental Figure S8 Expression of MYC2 in WT and jai1 mutants and schematic illustration of the isolation of myc2 mutants.

Supplemental Figure S9 ERF15 expression is regulated by JA but not MYC2, ERF16, or ERF15 itself.

Supplemental Table S1 Relative expression of JA biosynthetic genes and ERF15/16 under control conditions

Supplemental Table S2 Primers used for RT-qPCR

Supplemental Table S3 Primers used for DNA constructs

Supplemental Table S4 Primers used for EMSA

Supplemental Dataset 1. List of DEGs between W+OS and mock.

Supplemental Dataset 2. List of DEGs between treatments with or without 1-MCP after W+OS treatment.

Supplemental Dataset 3. List genes of different GO categories analysis of DEGs between treatments with or without 1-MCP after W+OS treatment.

Supplemental Dataset 4. Number of generated clean reads and successful alignment to the tomato genome reads for each library.

Supplementary Material

kiaa089_Supplementary_Data
Click here for additional data file. (2MB, zip)

Acknowledgments

We are grateful to the Tomato Genetics Resource Center at the University of California-Davis, Prof. Y.L.B. (Wageningen University, the Netherlands), and Prof. C.Y.L. (Chinese Academy of Sciences, Beijing, China) for supplying materials. We thank Prof. H.M.X. (Zhejiang University, Hangzhou, China) for the help of statistical analysis.

Funding

This work was supported by the National Key Research and Development of China (2018YFD1000800) and the Modern Agro-industry Technology Research System of China (CARS-25-02A).

Conflict of interest statement. The authors declare that there is no conflict of interest.

 

J.Y. designed this project and wrote the manuscript. C.H. performed most of the experiments and wrote the manuscript. C.W. and H.D. performed RT-qPCR. C.H. and Q.M. generated the plant materials. C.H., K.S., Y.Z., C.F., and J.Y. analyzed the data and discussed the article.

The authors responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instruction for Authors (https://academic.oup.com/plphys) are: Jingquan Yu (jqyu@zju.edu.cn).

References

  1. Ballaré CL (2011) Jasmonate-induced defenses: a tale fof intelligence, collaborators and rascals. Trends Plant Sci 16:249–257 [DOI] [PubMed] [Google Scholar]
  2. Bodenhausen N, Reymond P (2007) Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Mol Plant Microb Interact 20:1406–1420 [DOI] [PubMed] [Google Scholar]
  3. Browse J (2009) Jasmonate passes muster: a receptor and targets for the defense hormone. Annu Rev Plant Biol 60:183–205 [DOI] [PubMed] [Google Scholar]
  4. Chen HY, Hsieh EJ, Cheng MC, Chen CY, Hwang SY, Lin TP (2016) ORA47 (octadecanoid-responsive AP2/ERF-domain transcription factor 47) regulates jasmonic acid and abscisic acid biosynthesis and signaling through binding to a novel cis-element. New Phytol 211:599–613 [DOI] [PubMed] [Google Scholar]
  5. Chen Q, Sun J, Zhai Q, Zhou W, Qi L, Xu L, Wang B, Chen R, Jiang H, Qi J, et al. (2011) The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis. Plant Cell 23:3335–3352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chini A, Fonseca S, Fernández G, Adie B, Chico JM, Lorenzo O, García-Casado G, López-Vidriero I, Lozano FM, Ponce MR,. et al. (2007) The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448:666–671 [DOI] [PubMed] [Google Scholar]
  7. De Vos M, Van Oosten VR, Van Poecke RM, Van Pelt JA, Pozo MJ, Mueller MJ, Buchala AJ, Métraux JP, Van Loon LC, Dicke M, et al. (2005) Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol Plant Microbe Interact 18:923–937 [DOI] [PubMed] [Google Scholar]
  8. Dey S, Corina Vlot A (2015) Ethylene responsive factors in the orchestration of stress responses in monocotyledonous plants. Front Plant Sci 6:640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dombrecht B, Xue GP, Sprague SJ, Kirkegaard JA, Ross JJ, Reid JB, Fitt GP, Sewelam N, Schenk PM, Manners JM, et al. (2007) MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. Plant Cell 19:2225–2245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Du M, Zhai Q, Deng L, Li S, Li H, Yan L, Huang Z, Wang B, Jiang H, Huang T, et al. (2014) Closely related NAC transcription factors of tomato differentially regulate stomatal closure and reopening during pathogen attack. Plant Cell 26:3167–3184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Du M, Zhao J, Tzeng DTW, Liu Y, Deng L, Yang T, Zhai Q, Wu F, Huang Z, Zhou M, et al. (2017) MYC2 orchestrates a hierarchical transcriptional cascade that regulates jasmonate-mediated plant immunity in tomato. Plant Cell 29:1883–1906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Farmer EE (2007) Plant biology: jasmonate perception machines. Nature 448:659–660 [DOI] [PubMed] [Google Scholar]
  13. Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium-tumefaciens vector. Bio Technol 5:726–730 [Google Scholar]
  14. Glauser G, Grata E, Dubugnon L, Rudaz S, Farmer EE, Wolfender JL (2008) Spatial and temporal dynamics of jasmonate synthesis and accumulation in Arabidopsis in response to wounding. J Biol Chem 283:16400–16407 [DOI] [PubMed] [Google Scholar]
  15. Guan R, Su J, Meng X, Li S, Liu Y, Xu J, Zhang S (2015) Multilayered regulation of ethylene induction plays a positive role in Arabidopsis resistance against Pseudomonas syringae. Plant Physiol 169:299–312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Helliwell EE, Wang Q, Yang Y (2016) Ethylene biosynthesis and signaling is required for eice immune response and basal resistance against Magnaporthe oryzae infection. Mol Plant Microbe Interact 29:831–843 [DOI] [PubMed] [Google Scholar]
  17. Hickman R, Van Verk MC, Van Dijken AJH, Mendes MP, Vroegop-Vos IA, Caarls L, Steenbergen M, Van der Nagel I, Wesselink GJ, Jironkin A, et al. (2017) Architecture and dynamics of the jasmonic acid gene regulatory network. Plant Cell 29:2086–2105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Howe GA, Jander G (2008) Plant immunity to insect herbivores. Annu Rev Plant Biol 59:41–66 [DOI] [PubMed] [Google Scholar]
  19. Kahl J, Siemens DH, Aerts RJ, Gäbler R, Kühnemann F, Preston CA, Baldwin IT (2000) Herbivore-induced ethylene suppresses a direct defense but not a putative indirect defense against an adapted herbivore. Planta 210:336–342 [DOI] [PubMed] [Google Scholar]
  20. Kandoth PK, Ranf S, Pancholi SS, Jayanty S, Walla MD, Miller W, Howe GA, Lincoln DE, Stratmann JW (2007) Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the systemin-mediated defense response against herbivorous insects. Proc Natl Acad Sci USA 104:12205–12210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Katsir L, Schilmiller AL, Staswick PE, He SY, Howe GA (2008) COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc Natl Acad Sci USA 105:7100–7105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kazan K, Manners JM (2013) MYC2: the master in action. Mol Plant 6:686–703 [DOI] [PubMed] [Google Scholar]
  23. Kim D, Langmead B, Salzberg SL (2015) HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12:357–360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lei Y, Lu L,, Liu HY, Li S, Xing F, Chen LL (2014) CRISPR-P: a web tool for synthetic single-guide RNA design of CRISPR-system in plants. Mol Plant 7:1494–1496 [DOI] [PubMed] [Google Scholar]
  25. Li L, Zhao YF, McCaig BC, Wingerd BA, Wang JH, Whalon ME, Pichersky E, Howe GA (2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the maternal control of seed maturation, jasmonate-signaled defense responses, and glandular trichome development. Plant Cell 16: 126–143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liao Y, Smyth GK, Shi W (2014) featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30:923–930 [DOI] [PubMed] [Google Scholar]
  27. Licausi F, Ohme-Takagi M, Perata P (2013) APETALA2/Ethylene Responsive Factor (AP2/ERF) transcription factors: mediators of stress responses and developmental programs. New Phytol 199:639–649 [DOI] [PubMed] [Google Scholar]
  28. Liu M, Chen Y, Chen Y, Shin JH, Mila I, Audran C, Zouine M, Pirrello J, Bouzayen M (2018) The tomato Ethylene Response Factor Sl-ERF.B3 integrates ethylene and auxin signaling via direct regulation of Sl-Aux/IAA27. New Phytol 219:631–640 [DOI] [PubMed] [Google Scholar]
  29. Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, Zhai Q (2019) MYC2 regulates the termination of jasmonate signaling via an autoregulatory negative feedback loop. Plant Cell 31:106–127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408 [DOI] [PubMed] [Google Scholar]
  31. Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15:165–178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ma F, Yang X, Shi Z, Miao X (2020) Novel crosstalk between ethylene- and jasmonic acid-pathway responses to a piercing-sucking insect in rice. New Phytol 225:474–487 [DOI] [PubMed] [Google Scholar]
  34. Mao YB, Liu YQ, Chen DY, Chen FY, Fang X, Hong GJ, Wang LJ, Wang JW, Chen XY (2017) Jasmonate response decay and defense metabolite accumulation contributes to age-regulated dynamics of plant insect resistance. Nat Commun 8:13925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mielke K, Forner S, Kramell R, Conrad U, Hause B (2011) Cell-specific visualization of jasmonates in wounded tomato and Arabidopsis leaves using jasmonate-specific antibodies. New Phytol 190:1069–1080 [DOI] [PubMed] [Google Scholar]
  36. Min T, Yin XR, Shi YN, Luo ZR, Yao YC, Grierson D, Ferguson IB, Chen KS (2012) Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency. J Exp Bot 63:6393–6405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mousavi SA, Chauvin A, Pascaud F, Kellenberger S, Farmer EE (2013) GLUTAMATE RECEPTOR-LIKE genes mediate leaf-to-leaf wound signalling. Nature 500:422–426 [DOI] [PubMed] [Google Scholar]
  38. Nasir F, Tian L, Chang C, Li X, Gao Y, Tran LP, Tian C (2018) Current understanding of pattern-triggered immunity and hormone-mediated defense in rice (Oryza sativa) in response to Magnaporthe oryzae infection. Semin Cell Dev Biol 83:95–105 [DOI] [PubMed] [Google Scholar]
  39. Pan C, Ye L, Qin L, Liu X, He Y, Wang J, Chen L, Lu G (2016) CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations. Sci Rep 6:24765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. Annu Rev Cell Dev Biol 28:489–521 [DOI] [PubMed] [Google Scholar]
  41. Sharma MK, Kumar R, Solanke AU, Sharma R, Tyagi AK, Sharma AK (2010) Identification, phylogeny, and transcript profiling of ERF family genes during development and abiotic stress treatments in tomato. Mol Genet Genomics 284:455–475 [DOI] [PubMed] [Google Scholar]
  42. Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, Kobayashi Y, Hsu FF, Sharon M, Browse J, et al. (2010) Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 468:400–405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptor level: recent developments. Physiol Plant 100:577–582 [Google Scholar]
  44. Song SS,, Huang H, Gao H, Wang JJ, Wu DW, Liu XL, Yang SH, Zhai QZ, Li CY, Qi TC, et al. (2014) Interaction between MYC2 and ETHYLENE INSENSITIVE3 modulates antagonism between jasmonate and ethylene signaling in Arabidopsis. Plant Cell 26:263–279 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J (2007) JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 448:661–665 [DOI] [PubMed] [Google Scholar]
  46. Tieman DM, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proc Natl Acad Sci USA 97:5663–5668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Toyota M, Spencer D, Sawai-Toyota S, Jiaqi W, Zhang T, Koo AJ, Howe GA, Gilroy S (2018) Glutamate triggers long-distance, calcium-based plant defense signaling. Science 361:1112–1115 [DOI] [PubMed] [Google Scholar]
  48. Vicedo B, Flors V, de la OLM, Finiti I, Kravchuk Z, Real MD, García-Agustín P, González-Bosch C (2009) Hexanoic acid-induced resistance against Botrytis cinerea in tomato plants. Mol Plant Microbe Interact 22:1455–1465 [DOI] [PubMed] [Google Scholar]
  49. Wang G, Hu C, Zhou J, Liu Y, Cai J, Pan C, Wang Y, Wu X, Shi K, Xia X, et al. (2019) Systemic Root-Shoot Signaling Drives Jasmonate-Based Root Defense against Nematodes. Curr Biol 29:3430–3438.e3434 [DOI] [PubMed] [Google Scholar]
  50. Wang X, Hu L, Zhou G, Cheng J, Lou Y (2011) Salicylic acid and ethylene signaling pathways are involved in production of rice trypsin proteinase inhibitors induced by the leaf folder Cnaphalocrocis medinalis (Guen,e). Chin Sci Bull 56:2351–2358 [Google Scholar]
  51. Wasternack C, Hause B (2013) Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in annals of botany. Ann Bot 111:1021–1058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wasternack C, Song S (2017) Jasmonates: biosynthesis, metabolism, and signaling by proteins activating and repressing transcription. J Exp Bot 68:1303–1321 [DOI] [PubMed] [Google Scholar]
  53. Winz RA, Baldwin IT (2001) Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. IV. Insect-Induced ethylene reduces jasmonate-induced nicotine accumulation by regulating putrescine N-methyltransferase transcripts. Plant Physiol 125:2189–2202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wünsche H, Baldwin IT, Wu J (2011) S-Nitrosoglutathione reductase (GSNOR) mediates the biosynthesis of jasmonic acid and ethylene induced by feeding of the insect herbivore Manduca sexta and is important for jasmonate-elicited responses in Nicotiana attenuata. J Exp Bot 62:4605–4616 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280:1091–1094 [DOI] [PubMed] [Google Scholar]
  56. Xu ZS, Chen M, Li LC, Ma YZ (2011) Functions and application of the AP2/ERF transcription factor family in crop improvement. J Integr Plant Biol 53:570–585 [DOI] [PubMed] [Google Scholar]
  57. Yan C, Fan M, Yang M, Zhao J, Zhang W, Su Y, Xiao L, Deng H, Xie D (2018) Injury activates Ca(2+)/calmodulin-dependent phosphorylation of JAV1-JAZ8-WRKY51 complex for jasmonate biosynthesis. Mol Cell 70:136–149.e137 [DOI] [PubMed] [Google Scholar]
  58. Yan LH, Zhai QZ, Wei JN, Li SY, Wang B, Huang TT, Du MM, Sun JQ, Kang L, Li CB. et al. (2013) Role of Tomato Lipoxygenase D in Wound-Induced Jasmonate Biosynthesis and Plant Immunity to Insect Herbivores. Plos Genetics 9:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yan J, Zhang C, Gu M, Bai Z, Zhang W, Qi T, Cheng Z, Peng W, Luo H, Nan F, et al. (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 21:2220–2236 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 11:R14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhang CP, Lei YT, Lu CK, Wang L, Wu JQ (2020) MYC2, MYC3, and MYC4 function additively in wounding-induced jasmonic acid biosynthesis and catabolism. J Integr Plant Biol 62:1159–1175 [DOI] [PubMed] [Google Scholar]
  62. Zhang F, Yao J, Ke J, Zhang L, Lam VQ, Xin XF, Zhou XE, Chen J, Brunzelle J, Griffin PR, et al. (2015) Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling. Nature 525:269–273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zhang H, Hu Z, Lei C, Zheng C, Wang J, Shao S, Li X, Xia X, Cai X, Zhou J, et al. (2018) A plant phytosulfokine peptide initiates auxin-dependent immunity through cytosolic Ca(2+) signaling in tomato. Plant Cell 30:652–667 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

kiaa089_Supplementary_Data
Click here for additional data file. (2MB, zip)

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES