Skip to main content
Plant Signaling & Behavior logoLink to Plant Signaling & Behavior
. 2021 May 7;16(6):1907043. doi: 10.1080/15592324.2021.1907043

Exogenously-supplied trehalose inhibits the growth of wheat seedlings under high temperature by affecting plant hormone levels and cell cycle processes

Yin Luo a,, Xueying Liu a, Weiqiang Li b,c
PMCID: PMC8143245  PMID: 33960273

ABSTRACT

High temperature reduces the yield of crops, and exogenous trehalose can improve the stress resistance of plants. However, the mechanism by which trehalose causes phenotypic changes in plants is still unknown. Here we investigated the effects of exogenously supplied trehalose (1.5 mM) during high-temperature stress and subsequent recovery on plant hormones and cell cycle in wheat seedlings. Our results showed that after high-temperature stress, exogenously supplied trehalose reduced the root length, vertical height, leaf area, and leaf length of wheat seedlings, thereby reducing their growth. However, the content of hormones, such as abscisic acid, auxin (IAA), gibberellin (GA3), and cytokinin in seedlings pretreated with trehalose and high-temperature stress was lower than that under high-temperature stress alone. Our further experiments showed that the levels of these hormones were affected by genes involved in hormone biosynthesis and decomposition pathways in trehalose-pretreated seedlings. Compared with control plants, the activity of IAA oxidase is also higher. In addition, exogenous trehalose decreased the transcriptional levels of CycD2 and CDC2 (two genes regulating cell cycle progression) under heat stress, and reduced the activity of vacuolar invertase after recovery from heat stress, thereby shortening the cell length. These results indicate that trehalose inhibits wheat growth at high temperature by affecting plant hormone levels and the cell cycle process.

Abbreviations

ABA, abscisic acid; CDK, cyclin-dependent kinase; CycD, D-type cyclins; GA3, gibberellin; IAA, auxin; KRP, KIP-related protein; T6P, trehalsoe-6-phosphate; VIN, vacuolar invertase

KEYWORDS: Wheat, trehalose, high-temperature stress, plant hormones, cell cycle

1. Introduction

With the global climate warming, heat stress has become a worldwide threat that limits plant growth, cell membrane stability, metabolism, and productivity.1 Wheat (Triticum aestivum L.) is an important food crop. Its optimal growth temperature is 17–23°C. Any temperature higher than this temperature will inhibit the growth of wheat and ultimately limit the yield of wheat. Since the 1980s, with the temperature rising caused by greenhouse effects, the global wheat production has fallen by 2.5%.2

Trehalose, a non-reducing disaccharide, was first found in the ergot alkaloids. Recently, trehalose has detected in plants, such as rice (Oryza sativa), wheat, and Arabidopsis. The characters such as high resistance to heat, acid and alkali, and strong reversible absorption capacity of trehalose, cause it to protect proteins and membrane from adverse environmental damages. Trehalose can protect cells against oxygen-free radical damage, 3 but also has a protective effect on DNA molecules.4 Because of this, the trehalose content in plants has been enhanced in many researches by exogenously supplied5,6 or transgenic approaches7 to improve the stress tolerance. The trehalose-induced resistance to environmental stresses is probably due to trehalose or its metabolites acting as signal molecules, thus starting a series of responses of plants to adverse environment. Although increased trehalose can improve stress tolerance of plants, its negative effects on plant growth has been detected, such as stunted growth, the formation of lancet-shaped leaves and root growth retardation.8–10 And the mechanisms leading to these adverse changes are unclear so far.

The plant organ growth is regulated tightly by cell proliferation and subsequent cell expansion, wherein the cell proliferation is regulated by the cell cycle. Endogenous plant hormones, synthesized in the plant and involved in the regulation of its physiological and biochemical processes play an important role in the growth and development of plants. By changing the level of endogenous hormones, plants can adjust their physiological states, so that they can survive in the stressful environments. Some research results showed that in adverse environmental conditions, the endogenous hormone contents in plants have changed.11–13 Under drought stress, cytokinin levels in winter wheat and alfalfa decreased, while abscisic acid (ABA) content increased.11,12 Under cold or drought conditions, the rice had more ABA content but less cytokinin.13 We speculate here that trehalose-induced changes in plant phenotypes and growth may be caused by its effects on the level of plant hormones and cell cycle. As far as we know the effects of exogenous trehalose on hormone contents in wheat under high-temperature stress has yet not been reported.

In plants, G1 is a major part of the cell cycle in response to alterations in growth conditions, such as temperature in which there is an important regulatory point.14–16 In the operation of G1-to-S-phase control, the plant homologs of D-type cyclins (CycD) are thus good candidates for influencing plant cell division in response to external conditions.17 Plants respond to drought stress through a rapid initial growth reduction followed by growth adaptation, providing leaves with fewer and smaller cells.18–20 The inhibitor ICK/KIP-related protein (KRP) and/or the SIAMESE family could inhibit the cell cycle. In the upstream of the cell cycle machinery, ABA has been demonstrated to affect the expression of ICK/KRP and/or SIAMESE.21,22 The study on rice cell cycle has showed that exogenous ABA can inhibit the cell cycle from G1/S transition by inducing the expression of OsKRP4, OsKRP5, and OsKRP6 genes.23 However, Riou-Khamlichi showed that cytokinins promote G1/S phase transition.24 Our previous studies have shown that exogenous trehalose can protect the thylakoid membrane of wheat seedlings and improve the heat tolerance of wheat.25,26 Meanwhile, exogenous trehalose also caused phenotypic changes in wheat seedlings (unpublished). In this study, we detected the effects of exogenously supplied trehalose on wheat growth and endogenous plant hormone levels under high-temperature stress. The purpose of the present study was to decipher the mechanism by which exogenous trehalose caused this phenotypic changes of wheat seedlings under heat stress.

2. Materials and methods

2.1. Plant growth and stress treatment

According to our previous method, 26 wheat seedlings (Triticum aestivum L.) were grown in Hoagland solution in an incubator with a light cycle of 13 h/d (300 µmol m−2 s−1) and 11 h/night. When the second leaves were fully expanded, wheat seedlings were treated with Hoagland solution containing 1.5 mM trehalose (according to our previous studies, 25,26 1.5 mM trehalose can improve heat tolerance of wheat seedlings, so this concentration of trehalose was selected) for 3d (Tre), with Hoagland solution without trehalose as control (CK). After that, the seedlings were subjected to heat stress (40°C for 24 h), and then were kept at room temperature (22°C) for another 24 h, which were taken as R. During the whole process of seedling cultivation, Hoagland nutrient solution was changed every day and an air compressor was used for regular aeration.

2.2. Determination of wheat growth

The phenotypic parameters were determined by noninvasive imaging. The image-data was an RGB image obtained by visible-light lens of desktop plant imaging system (Scanalyzer PL, LemnaTec, Germany). The phenotypic parameters, such as vertical height, blade length, and so on can be obtained by the RGB image.

2.3. Measurement of wheat cell growth

Growth was analyzed on the third true leaves harvested at different time points. After clearing with 70% ethanol, leaves were mounted in 100% lactic acid on microscopy slides. For each experiment, 8 to 12 leaves were photographed with a DIC microscope (Olympus, Japan).

2.4. Plant hormone quantification

The identification and quantification of plant hormones were accomplished by HPLC (Aglient 1100,America). Leaves with 1.0 g fresh weight was grounded to powder in liquid nitrogen, and then 15 mL 80% methanol (4°C precooled) was added, extracting for 12 hours at 4°C. The homogenate was centrifuged at 6000 × g for 15 min and the supernatant decanted and flushed with nitrogen gas until the methanol gone. The filtrate was extracted by petroleum ether and the aqueous phase was retained. Then, the aqueous phase was extracted by ethyl acetate and the ester phase was retained. The ester phase was flushed with nitrogen gas until dry. The residue was dissolved in a 1 mL HPLC mobile phase. The sample was then filtered through a 0.45 µm membrane filter before injection. The measurements were done with HPLC (Agilent) with a 250 mm × 4.6 mm reverse phase C-18 column (Shodex C18-120-5 4E) and a UV detector. The mobile phase was a mixture of methanol-0.07% glacial acetic acid (1:1) with the flow rate of 0.5 mL/min.

2.5. RNA extraction, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)

Endogenous transcript levels of a set of plant hormone regulatory genes and cell cycle regulatory genes were analyzed by qRT-PCR. RNA from leaves of wheat seedlings was extracted with TriZol (Takara) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg samples of RNA using a First Strand cDNA Synthesis Super Mix (Hieff). qRT-PCR experiments were performed using SYBR Green RealMasterMix (Hieef) and CFX96 Real-Time System (Bio-Rad, Hercules, CA) according to the manufacturer’s protocols. 18srRNA expression was used as an internal standard. Three biological replications were analyzed for each point. The primer sequences and corresponding universal probes are listed in Table 1.

Table 1.

DNA sequences of PCR primers used in qRT-PCR determination of key gene copy number involved in metabolism of plant hormones in wheat seedlings

Gene Primer sequence Product, bp
18SrRNA TTAGTTGGTGGAGCGATTT 145
AACCAGCGACCTACAACG
CKX AACAGCTCAGCCATCCATCT 190
ATCATCTCCCGCATCCTCTG
NCED GCAGAGGACGAGCAGAAATG 102
CGCGCTAACTGTATCCATGC
GA2ox GCGATGACACAGAGGATTGC 152
CGATGCTACCTGTGGAACTG
GA3ox ACCATCCGTCTCCACCATTG 106
CGTACGATCGGTCAAGCAAG
CYP AAGCCCAACACGTTCATGCCGTTC
CCGCTCTCGGACTTGGAGGTGGAC
109
YUC TTGTTGTGGCAAGTGGTGAG 193
TTGGCACCATGAGAAGCAAG
CycD2 CAGGAGGGACGCCATAGATTG 149
CCAAGAGCTGTGTCACCCAAG
CDC2 ATCCTTCTTGGAGCAAGGCAG 196
ACTTGTAGTCAGGCAAGGAACTC

2.6. Measurement of IAA oxidase activities

0.5 g fresh leaves were ground in a chilled mortar containing 5 mL ice-cold 0.02 M Sodium-phosphate buffer (pH 6.0). Then, the homogenate was centrifuged at 4000 r/min for 20 min at 4°C with IAA oxidase in the supernatant. In order to determine IAA oxidase activity, the reaction mixture (1 mL 1 mM MnCl2, 1 mL 1 mM 2, 4-Dichlorophenol, 2 mL 1 mM IAA, 5 mL Sodium-phosphate buffer and 1 mL enzyme sample) was incubated at 30°C for 30 min and absorbance was measured at 530 nm.

2.7. Measurement of invertase activities

Leaves with 1.0 g fresh weight were ground in a chilled mortar using 5 ml ice-cold buffer (50 mM HEPES-NaOH, pH 8.3; 2 mM EDTA; 2 mM EGTA; 1 mM MgC12, 1 mM MnC12; 6 mM dithiothreitol). The homogenate was centrifuged at 14000 × g for 15 min at 4°C. The supernatant contained soluble invertase.

The invertase activity was carried out according to the following method. Reaction mixture (1 mL) contained 200 mM Na-acetate buffer (pH 4.5), 100 mM sucrose and 0.2 mL extract. Reaction mixture was incubated for 30 min at 37°C. After that, the reaction was stopped by adding 1 mL 3, 5-dinitrosalicylic acid (DNSA) reagent and the mixture was heated in a boiling water bath for 5 min. It was then cooled to room temperature and the amount of reducing sugar was measured at 540 nm.

2.8. Statistical analysis

The experiment was repeated at least three times and gave similar trends. The IBM SPSS Statistics 21 (America) was used for statistical analyses. The least significant difference (LSD) of analysis of variance (ANONA) was used in this study (P < .05).

3. Results

3.1. Effects of exogenously supplied trehalose on wheat growth under high-temperature stress

Figure 1 shows that after recovery from heat stress, the phenotypic parameters including vertical height (Figure 1(a)), area (Figure 1(b)), blade length of the newly leaf (Figure 1(c)) and leaf area of the newly leaf (Figure 1(d)) in trehalose-pretreated wheat seedlings were significantly reduced when compared with control seedlings suffered from heat stress alone.

Figure 1.

Figure 1.

The effects of exogenously supplied trehalose on phenotypic parameters including vertical height (a), area (b), blade length of the new leaf (c) and leaf area of the new leaf (d) of wheat seedlings. Under normal growth conditions (HO), after wheat seedlings were pretreated with 1.5 mM trehalose for 3 d (TRE), with the absence of trehalose as control (CK), then they were subjected to 40 °C for 1 d (h), and finally grew at room temperature to recover for another day (r). CK: Control (no trehalose and no heat); TRE: Trehalose pretreatment; H0: Normal growth conditions; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are means of three replicates with standard errors shown by vertical bars. Different letters show significant difference (P < .05)

3.2. Effects of exogenously supplied trehalose on the wheat cell growth under high-temperature stress

To verify whether this effect of trehalose on the wheat growth was associated with the cell expansion, a most important process of plant growth, we measured the length of the cells in the split zone of wheat leaves. Elevated temperature significantly decreased the cell length of control wheat seedlings, while under this stress conditions, no significant difference was observed between the trehalose-pretreated group and control. Before and after high-temperature stress, less cell length in trehalose pretreatment than that in control was obtained (Figure 2). Therefore, the reduction effect of trehalose on cell length occurred before high-temperature stress, and the influence still existed during the recovery phase.

Figure 2.

Figure 2.

The effect of exogenously supplied trehalose on wheat leaf cell length. The symbols are as those in Figure 1. CK: Control; TRE: Trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data correspond to means ± standard errors of three independent experiments. Different letters show significant difference (P < .05)

3.3. Effects of exogenously supplied trehalose on contents of hormones in wheat seedlings

High-temperature stress significantly decreased the contents of IAA, GA3, and ZT (Figure 3(a–c)). When compared with control plants, the contents of IAA and ZT in trehalose pretreatments were reduced obviously (Figure 3(a,b)), while no significant differences were observed in the contents of GA3 and ABA under high-temperature stress (Figure 3(b,Figure 3d)). After recovery from this stress, ABA content in trehalose-pretreated seedlings was higher than that without trehalose treatment, while ZT content still remained lower in the trehalose-pretreated group (Figure 3(c,Figure 3d)).

Figure 3.

Figure 3.

Effects of exogenously supplied trehalose on the contents of IAA (a), GA3 (b), ZT (c) and ABA (d) in wheat leaves. The symbols have the same denotations as in Figure 1. CK: Control; TRE: Exogenously supplied trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are expressed as means ± standard errors of three independent experiments. Different letters show significant difference (P < .05)

3.4. Transcription of genes participating in plant hormone regulation

The synthesis and decomposition pathways of plant hormones are controlled by many enzymes and genes. In order to study how exogenously supplied trehalose influences the hormone levels under high-temperature stress, we measured the transcriptional level of related genes encoding key enzymes to control the metabolic pathway of hormone. Except YUC (regulating the key step of IAA synthesis pathway) and GA3ox genes (regulating auxin biosynthesis and activating GA, respectively), the transcription of CKX (regulating cytokinin decomposition), GA2ox (encoding gibberellin-2-oxidase in inactivation of GA), NCED, and CYP (encoding key enzymes involved in ABA biosynthesis and decomposition pathways, respectively) decreased obviously in trehalose-pretreated wheat seedlings under a heat stress condition when compared with control plants.

CKX encodes the cytokinin oxidase, a key enzyme in the regulation of cytokinin decomposition. Under normal growth conditions, trehalose pretreatment did not significantly alter the expression of CKX genes. Under high-temperature stress, the transcriptional level of CKX in trehalose pretreatment group was significantly lower than that of the control group (Figure 4(a)). YUC gene regulates the rate-limiting step in auxin biosynthesis in numerous plants. At room temperature, exogenously supplied trehalose treatment reduced the expression of the YUC gene; under high-temperature stress, the relative expression of YUC in the trehalose-pretreated group was approximately the same as that in the control group; During the normal temperature recovery, the transcriptional level of YUC in the control group was significantly higher than that at the high temperature, while that in exogenously supplied trehalose treatment group did not change significantly, whose expression of YUC was significantly lower than that of the control group (Figure 4(b)). GA3ox encodes gibberellin-3-oxidase, a key enzyme in the GA from an inactive form into an active form. High temperature significantly reduced the expression of GA3ox, but its expression increased during recovery. When compared trehalose pretreatments with control plants, no significance was obtained (Figure 4(c)). Meanwhile, under the normal growth conditions, the expression level of GA2ox which encodes gibberellin-2-oxidase in activation of GA in trehalose-pretreated wheat was increased, while during high temperature and normal temperature recovery stage, the expression of GA2ox in exogenously supplied trehalose treatment group was about half of that in the group without trehalose-pretreated seedlings (Figure 4(d)). These results indicate that, under normal temperature conditions, the decrease in GA3 level in trehalose-pretreated group is mainly due to the elevation in GA2ox expression level. NCED and CYP encode key enzymes involved in ABA biosynthesis and decomposition pathways, respectively. Figure 4(e,f) showed that their transcription levels were both lower in trehalose-pretreated seedlings than those in control plants under high temperature and recovery conditions.

Figure 4.

Figure 4.

Effects of exogenously supplied trehalose on the expression of genes related to CKX (a), YUC (b), GA3ox (c), GA2ox (d), NCED (e) and CYP (f) in wheat leaves. The symbols are as those in Figure 1. CK: Control; TRE: Exogenously supplied trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are expressed as means ± standard errors of three independent experiments. Different letters show significant difference (P < .05)

3.5. Effects of trehalose on IAA oxidase activity under high-temperature stress

IAA oxidase, a key enzyme of IAA decarboxyl degradation, is the most important regulator of IAA levels, and its activity can affect the level of IAA. At room temperature and high-temperature conditions, IAA oxidase activity in exogenously supplied trehalose-pretreated wheat seedlings was significantly higher than in the control group. At the recovery stage, compared with the control group, exogenously supplied trehalose had no effect on IAA oxidase enzyme activity (Figure 5).

Figure 5.

Figure 5.

Effects of exogenously supplied trehalose on the activity of IAA oxidase enzyme. The symbols are as those in Figure 1. TRE: Exogenously supplied trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are expressed as means ± standard errors of five independent experiments. Different letters show significant difference (P < .05)

3.6. Transcription of genes participating in cell cycle

CycD2 regulates cell cycle progression from G1 to S phase transition and CDC2 encodes cyclin-dependent kinases, a key enzyme that promotes the cell cycle G1- to-S and S-to-G2 transitions. Under high-temperature stress conditions, the expression level of both genes in trehalose-pretreated wheat seedlings was higher than that in control plants (Figure 6(a,b)).

Figure 6.

Figure 6.

Effects of exogenously supplied trehalose on the expression of genes of CycD2 (a) and CDC2 (b) related to cell cycle in wheat leaves. The symbols are as those in Figure 1. CK: Control; TRE: Exogenously supplied trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are expressed as means ± standard errors of three independent experiments. Different letters show significant difference (P < .05)

3.7. Effects of trehalose and high temperature on vacuolar invertase (VIN)

VIN is one type of invertase isoenzymes, and its function is mainly associated with the regulation of cell elongation through the generation of osmotically active solutes.27 High temperature induced a decrease in the activity of VIN, which was slightly increased in the recovery phase. At room temperature conditions, VIN activity in trehalose-pretreated group was lower than that in untreated group (Figure 7).

Figure 7.

Figure 7.

Effects of exogenously supplied trehalose on the activity of VIN under heat stress. The symbols are as those in Figure 1. CK: Control; TRE: Exogenously supplied trehalose pretreatment; H0: Without high temperature; H: High-temperature treatment for 24 h; R: Recovery from high temperature. Data are expressed as means ± standard errors of five independent experiments. Different letters show significant difference (P < .05)

4. Discussion

4.1. Under high-temperature stress, exogenously supplied trehalose regulates the hormone levels by regulating the expression of related genes

The hormone content is regulated by its synthesis and degradation. Under the normal growth conditions, higher expression level of GA2ox in trehalose-pretreated group than that without trehalose treatment and no difference in the expression of GA3ox between them (Figure 4(c,d)) might suggest that the content of GA3 in trehalose-pretreated group is lower than that of the untreated group may be induced by the greater degradation rate of GA3 than its synthesis rate. While no difference in the expression of GA3ox between with and without trehalose-pretreated wheat seedlings under high-temperature stress may induce no obvious evidence in the content of GA3 between them under high-temperature stress.

Under high-temperature condition, higher IAA oxidase activity in trehalose-pretreated seedlings than that in controls (Figure 5) while no significant difference in YUC (regulating the key step of IAA synthesis pathway) expression level between them (Figure 4(b)) might indicate that the lower IAA content in trehalose-pretreated group than the control plants (Figure 3(a)) was because the IAA degradation pathway was affected much more by trehalose. No obvious distinction in ABA content in trehalose-pretreated wheat seedlings and the control plants under high temperature (Figure 3(d)) might be contributed to the reason that the trend of expression level both genes of NCED and CYP, respectively, regulating the key steps of ABA synthesis and decomposition pathways in each treatment group substantially coincides (Figure 4(e,f)).

Sugar and hormones act as signal molecules that interact in signal transduction. Sugar can affect hormone response pathways by affecting the expression or activity of related components in these pathways. In maize grain, the auxin synthesis gene ZmYUCCA is regulated by sugar, which shows that sugar has a direct relationship with the auxin signal.28 In this study, if only hormones are concerned, exogenously supplied trehalose treatment decreased the contents of hormones (such as IAA and cytokinin) (Figure 3(a,c)) that promote plant growth by changing their expression levels of hormone metabolism-related genes (Figure 4(a,b)), then slowed down the growth of wheat (Figure 1). When subjected to environmental stress, plants shorten the vegetative stage to preserve and redistribute energy, so that plants can improve their chances of survival when the stress becomes serious.20 Therefore, we believe that under stress conditions, the slower growth of wheat caused by trehalose pretreatment makes wheat seedlings have more energy to participate in stress resistance.

4.2. Under high-temperature stress, trehalose regulates cell cycle and cell expansion

In plants, organ growth is driven by two closely controlled dynamic processes of cell proliferation and subsequent cell expansion.29 Cell proliferation is regulated by the cell cycle, and CycD2 and CDC2 are the key regulatory genes that promote the transition from G1 to S. Cell elongation needs to increase the accumulation of soluble substances, thereby promoting water absorption and cell expansion. Sucrose, trehalsoe-6-phosphate (T6P), trehalose, glucose, and fructose have been known as signals to regulate development.30 Under optimal conditions, Suc is degraded into hexose which can be phosphorylated into glucose-6-phosphate and fructose-6- phosphate for the synthesis of T6P. T6P can be converted to trehalose by T6P phosphatase. However, under stress conditions, cytoplasmic sucrose may be absorbed into vacuoles and be hydrolyzed into glucose and fructose by VIN, thereby doubling the osmotic effect of sucrose to play a major role in cell expansion through osmosis.31 Under drought stress, the slow growth of Brachypodium leaves is mainly due to cell size rather than cell number.32 Under high-temperature stress, wheat seedlings pretreated with trehalose showed lower expression levels of CycD2 and CDC2 than control plants (Figure 6), and there was no significant difference in VIN activity between them (Figure 7), indicating that trehalose inhibited the wheat growth including leaves length (Figure 1(c)) may be by affecting cell proliferation. However, after recovering from heat stress, trehalose inhibited the growth of wheat mainly by controlling cell swelling (Figure 1(a–d)). This can be shown by the fact that the VIN activity in wheat plants pretreated with trehalose was lower (Figure 7), while there is no difference in the expression levels of CycD2 and CDC2 between them (Figure 6). In addition, under stress conditions metabolism is usually regulated for survival, 33,34 trehalose-induced growth inhibition might be an adaptive response to heat stress through the SnRK1 signaling pathway involving T6P, SnRK1, and bZIP.35,36

Plant hormones regulate the cell cycle, thereby regulating the growth and development of plants. Riou showed that cytokinin promotes the transition from G1 to S.24 Studies on Arabidopsis cell cycle genes have shown that exogenous auxin, cytokinin, and sucrose can all increase the expression of CycD2 and CDC2 in Arabidopsis.17 Our results show that the exogenously provided trehalose simultaneously reduces the content of auxin and cytokinin (Figure 3) and the expression of CycD2 and CDC2 (Figure 6). The expression of CycD2 and CDC2 and the content of hormones that promote plant growth are positively correlated. We speculate that the reason for this difference may be due to the decrease in the content of growth-promoting hormones of auxin and cytokinin in wheat plants caused by exogenous trehalose treatment, since a research by Hartig and Beck has shown that endogenous auxin and cytokinin can promote the cell cycle.37 In this study, the exogenous trehalose pretreatment affected the expression of genes in the metabolic pathways of IAA, CTK, GA3, and ABA, and changed the levels of endogenous plant hormones in wheat under normal and high-temperature stress. At the same time, trehalose pretreatment also decreased the expression of cell cycle-related genes CycD2 and CDC2, and decreased the activity of VIN, which resulted in lower plant height, root length, and dry weight of wheat seedlings in the trehalose treatment group than in the control group, and slowed down the growth of wheat.

Funding Statement

This work was supported by grants from the National Key R&D Program of China [2018YFE0194000].

Disclosure statement

The authors declare that they have no conflicts of interest.

References

  • 1.Sharma B, Singh VK, Sheoran RK, Thakral NK, Naruka A.. Heat stress in plant. Ann Biol. 2018;34:1–9. [Google Scholar]
  • 2.Lobell DB, Schlenker W, Costa-Roberts J.. Climate trends and global crop production since 1980. Science. 2011;333(6042):616–620. doi: 10.1126/science.1204531. [DOI] [PubMed] [Google Scholar]
  • 3.Benaroudj N, Lee DH, Goldberg AL.. Trehalose accumulation during cellular stress protects cells and cellular proteins from damage by oxygen radicals. J Biol Chem. 2001;276(26):24261–24267. doi: 10.1074/jbc.M101487200. [DOI] [PubMed] [Google Scholar]
  • 4.Yoshinaga K, Yoshioka H, Kurosaki H, Hirasawa M, Uritani M, Hasegawa K. Protection by trehalose of DNA from radiation damage. Biosci Biotechnol Biochem. 1997;61(1):160–161. doi: 10.1271/bbb.61.160. [DOI] [PubMed] [Google Scholar]
  • 5.Ali Q, Ashraf M. Induction of drought tolerance in maize (Zea mays L.) due to exogenous application of trehalose: growth, photosynthesis, water relations and oxidative defence mechanism. J Agron Crop Sci. 2011;197(4):258–271. doi: 10.1111/j.1439-037X.2010.00463.x. [DOI] [Google Scholar]
  • 6.Govind SR, Jogaiah S, Abdelrahman M, Shetty HS, Tran LS. Exogenous trehalose treatment enhances the activities of defense-related enzymes and triggers resistance against downy mildew disease of pearl millet. Front Plant Sci. 2016;7:1593. doi: 10.3389/fpls.2016.01593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Stiller I, Dulai S, Kondrák M, Tarnai R, Szab L, Toldi O, Bánfalvi Z. Effects of drought on water content and photosynthetic parameters in potato plants expressing the trehalose-6-phosphate synthase gene of Saccharomyces cerevisiae. Planta. 2008;227(2):299–308. doi: 10.1007/s00425-007-0617-9. [DOI] [PubMed] [Google Scholar]
  • 8.Goddijn OJM, Verwoerd TC, Voogd E, Krutwagen RWHH, De Graaf PTHM, Poels J, Van Dun K, Ponstein AS, Damm B, Pen J. Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol. 1997;113(1):181–190. doi: 10.1104/pp.113.1.181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Schluepmann H, Van Dijken A, Aghdasi M, Wobbes B, Paul M, Smeekens S. Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant Physiol. 2004;135(2):879–890. doi: 10.1104/pp.104.039503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Delorge I, Janiak M, Carpentier S, Van Dijck P. Fine tuning of trehalose biosynthesis and hydrolysis as novel tools for the generation of abiotic stress tolerant plants. Front Plant Sci. 2014;5:1–9. doi: 10.3389/fpls.2014.00147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cao M. Variation of the concent ration of two types of endogenous hormone in winter wheat seedling under osmotic stress. Chin Bull Bot. 1990;7:012. [Google Scholar]
  • 12.Han RH, Zhang YG, Tian H, Lu XS. Study on changes of endogenous hormones in the leaves of alfalfa under drought stress. Acta Agric Boreali-Sinica. 2008;23:81–84. [Google Scholar]
  • 13.Maruyama K, Urano K, Yoshiwara K, Morishita Y, Sakurai N, Suzuki H, Kojima M, Sakakibara H, Shibata D, Saito K, et al. Integrated analysis of the effects of cold and dehydration on rice metabolites, phytohormones, and gene transcripts. Plant Physiol. 2014;164(4):1759–1771. doi: 10.1104/pp.113.231720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Francis D, Barlow PW. Temperature and the cell cycle. Symp Soc J Exp Bot. 1988;42:181–201. [PubMed] [Google Scholar]
  • 15.Fowler MR, Eyre S, Scott NW, Slater A, Elliott MC. The plant cell cycle in context. Mol Biotechnol. 1998;10:123–153. [DOI] [PubMed] [Google Scholar]
  • 16.Huntley R, Healy S, Freeman D, Lavender P, De Jager S, Greenwood J, Makker J, Walker E, Jackman M, Xie Q, et al. The maize retinoblastoma protein homologue ZmRb-1 is regulating during leaf development and displays conserved interactions with G1/S regulators and plant cyclin D (CycD) proteins. Plant Mol Biol. 1998;37(1):155–169. doi: 10.1023/A:1005902226256. [DOI] [PubMed] [Google Scholar]
  • 17.Richard C, Lescot M, Inzé D. Effect of auxin, cytokinin, and sucrose on cell cycle gene expression in Arabidopsis thaliana cell suspension cultures. Plant Cell Tissue Organ Cult. 2002;69(2):167–176. doi: 10.1023/A:1015241709145. [DOI] [Google Scholar]
  • 18.Granier C, Tardieu F. Water deficit and spatial pattern of leaf development. Variability in responses can be simulated using a simple model of leaf development. Plant Physiol. 1999;119(2):609–620. doi: 10.1104/pp.119.2.609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Aguirrezabal L, Bouchier-Combaud S, Radziejwoski A, Dauzat M, Cookson SJ, Granier C. Plasticity to soil water deficit in Arabidopsis thaliana: dissection of leaf development into underlying growth dynamic and cellular variables reveals invisible phenotypes. Plant Cell Environ. 2006;29(12):2216–2227. doi: 10.1111/j.1365-3040.2006.01595.x. [DOI] [PubMed] [Google Scholar]
  • 20.Skirycz A, Inzé D. More from less: plant growth under limited water. Curr Opin Biotech. 2010;21(2):197–203. doi: 10.1016/j.copbio.2010.03.002. [DOI] [PubMed] [Google Scholar]
  • 21.Wang H, Qi Q, Schorr P, Cutler AJ, Crosby WL, Fowke LC. ICK1, a cyclin-dependent protein kinase inhibitor from Arabidopsis thaliana interacts with both Cdc2a and CycD3, and its expression is induced by abscisic acid. Plant J. 1998;15(4):501–510. doi: 10.1046/j.1365-313X.1998.00231.x. [DOI] [PubMed] [Google Scholar]
  • 22.Pettko´-Szandtner A, Me´sza´ros T, Horva´th GV, Bako´ L, Csorda´s-to´ Th E´, Blastya´k A, Zhiponova M, Miskolczi P, Dudits D. Activation of an alfalfa cyclin-dependent kinase inhibitor by calmodulin-like domain protein kinase. Plant J. 2006;46(1):111–123. doi: 10.1111/j.1365-313X.2006.02677.x. [DOI] [PubMed] [Google Scholar]
  • 23.Meguro A, Sato Y. Salicylic acid antagonizes abscisic acid inhibition of shoot growth and cell cycle progression in rice. Sci Rep. 2014;4:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JAH. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science. 1999;283(5407):1541–1544. doi: 10.1126/science.283.5407.1541. [DOI] [PubMed] [Google Scholar]
  • 25.Luo Y, Li F, Wang GP, Yang XH, Wang W. Exogenously-supplied trehalose protects thylakoid membranes of winter wheat from heat-induced damage. Biol Plant. 2010;54(3):495–501. doi: 10.1007/s10535-010-0087-y. [DOI] [Google Scholar]
  • 26.Luo Y, Liu HY, Fan YZ, Wang W, Zhao YY. Comparative chloroplast proteome analysis of exogenously supplied trehalose to wheat seedlings under heat stress. Photosynthetica. 2018;56(4):1123–1133. doi: 10.1007/s11099-018-0808-6. [DOI] [Google Scholar]
  • 27.Königshofer H, Löppert HG. Regulation of invertase activity in different root zones of wheat (Triticum aestivum L.) seedlings in the course of osmotic adjustment under water deficit conditions. J Plant Physiol. 2015;183:130–137. doi: 10.1016/j.jplph.2015.06.005. [DOI] [PubMed] [Google Scholar]
  • 28.LeClere S, Schmelz EA, Chourey PS. Sugar levels regulate tryptophan - dependent auxin biosynthesis in developing maize kernels. Plant Physiol. 2010;153(1):306–318. doi: 10.1104/pp.110.155226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Skirycz A, Claeys H, De Bodt S, Oikawa A, Shinoda S, Andriankaja M, Maleux K, Eloy NB, Coppens F, Yoo S-D, et al. Pause-and-Stop: the effects of osmotic stress on cell proliferation during early leaf development in arabidopsis and a role for ethylene signaling in cell cycle arrest. Plant Cell. 2011;23(5):1876–1888. doi: 10.1105/tpc.111.084160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ruan YL. Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu Rev Plant Biol. 2014;65(1):33–67. doi: 10.1146/annurev-arplant-050213-040251. [DOI] [PubMed] [Google Scholar]
  • 31.Ruan YL, Jin Y, Yang YJ, Li GJ, Boyer JS. Sugar input, metabolism, and signaling mediated by invertase: roles in development, yield potential, and response to drought and heat. Mol Plant. 2010;3(6):942–955. doi: 10.1093/mp/ssq044. [DOI] [PubMed] [Google Scholar]
  • 32.Verelst W, Bertolini E, De Bodt S, Vandepoele K, Demeulenaere M, Pè ME, Inzé D. Molecular and physiological analysis of growth-limiting drought stress in Brachypodium distachyon leaves. Mol Plant. 2013;6(2):311–322. doi: 10.1093/mp/sss098. [DOI] [PubMed] [Google Scholar]
  • 33.Nuccio ML, Wu J, Mowers R, Zhou HP, Meghji M, Primavesi LF. Expression of trehalose 6-phosphate phosphatase in maize ears improves yield in well-watered and drought conditions. Nat Biotechnol. 2015;33(8):862–874. doi: 10.1038/nbt.3277. [DOI] [PubMed] [Google Scholar]
  • 34.Lin YC, Zhang J, Gao WC, Chen Y, Li HX, Lawlor DW, Paul MJ. Exogenous trehalose improves growth under limiting nitrogen through upregulation of nitrogen metabolism. BMC Plant Biol. 2017;17(1):247–260. doi: 10.1186/s12870-017-1207-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Delatte TL, Sedijani P, Kondou Y, Matsui M, De Jong GJ, Somsen GW, Wiese-Klinkenberg A, Primavesi LF, Paul MJ, Schluepmann H. Growth arrest by trehalose-6-phosphate: an astonishing case of primary metabolite control over growth by way of the SnRK1 signaling pathway. Plant Physiol. 2011;157(1):160–174. doi: 10.1104/pp.111.180422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.O’Hara LE, Paul MJ, Wingler A. How do sugars regulate plant growth and development? New insight into the role of trehalose-6-phosphate. Mol Plant. 2013;6(2):261–274. doi: 10.1093/mp/sss120. [DOI] [PubMed] [Google Scholar]
  • 37.Hartig K, Beck E. Endogenous cytokinin oscillations control cell cycle progression of tobacco BY-2 cells [J]. Plant Biol. 2005;7(1):33–41. doi: 10.1055/s-2004-830474. [DOI] [PubMed] [Google Scholar]

Articles from Plant Signaling & Behavior are provided here courtesy of Taylor & Francis

RESOURCES