Abstract
Background:
MicroRNAs, as small non-coding RNAs, are recently reported to be involved in plant defense system against pathogens including fungi.
Objective:
In this research, it was intended to investigate candidate susceptible rice (Oryza Sativa) Osa-miRNA expression alteration following the infection by Rhizoctonia solani.
Materials and Methods:
To this aim, literature review suggested eight conserved plant miRNAs that are involved in other plant-pathogen interactions. Then, sixty days old rice plants (Hashemi, susceptible cultivar) were inoculated with R. solani and candidate miRNA expression alterations were investigated 2 hpi (hours post inoculation), 2 dpi (days post inoculation) and 6 dpi.
Results:
RT-qPCR analysis suggested four subgroups of candidate miRNAs based on the time of their responses to the pathogenesis of R. solani. While Osa-miR-156 was early-responsive, Osa-miR159 was the last-responsive and Osa-miR167, Osa-miR171, Osa-miR408, and Osa-miR444 were late responsive to R. solani infection. Osa-miR166 and Osa-miR393 were non-responsive to this infection, compared to the mock-inoculated control group. Consistently, Os-SPL3 and Os-MADS known target genes were expressed in reverse correlation to Osa-miR156 and Osa-miR444, respectively.
Conclusions:
From these data, it is suggested that both early (Osa-miR-156) and late (Osa-miR167, Osa-miR171, Osa- miR408, Osa-miR444) responsive miRNAs might be involved in R. solani infection in rice plants.
Keywords: miRNA, Rhizoctonia solani, Rice plant
1. Background
Rice is an important crop which provides major food for more than 50% of people worldwide. Sheath blight disease caused by Rhizoctonia solani, is one of the most destructive rice diseases resulting in an estimated yield loss of up to 50% ( 1 ). Micro-RNAs (miRNAs) are small non-coding RNAs, 18-27 nucleotides in length ( 2 , 3 ), which control many biological and physiological processes in eukaryotes. Micro-RNAs play an important role in gene regulation at the post-transcriptional level. These small molecules have complementarity to their target genes and regulate them through mRNA degradation or translational repression ( 4 , 5 ). With some differences, plant miRNA biogenesis is similar to that in animals ( 6 ). Plant miRNAs are involved in various biological processes including signal transduction, organ formation, developmental phase change, protein degradation and response to biotic and abiotic stresses ( 2 , 7 , 8 ). The first report about miRNAs involvement in plant disease resistance was shown in Arabidopsis thaliana. Navarro et al. (2006) showed that perception of bacterial flagellin flg 22 peptide led to the increase of At-miR393, down-regulation of auxin signaling and the increase of plant resistance ( 8 , 9 ). The accumulation of the considerable number of miRNAs is expected to be affected through infection by a pathogen such as R. solani. The alterations in the accumulation of rice miRNAs during infection by R. solani have been recently reported. Many miRNAs are conserved among different species, which implies to their essential roles in many pivotal processes in plants. Conserved miRNAs have homologous target genes in different species which facilitates prediction of their targets. Here, we investigated the expression alteration of eight candidate conserved miRNAs and their target transcripts in rice plants which were challenged by R. solani fungus. At least five candidate miRNAs were responsive to the infection in susceptible rice plant.
2. Objective
In this research, it was intended to investigate candidate susceptible rice (Oryza Sativa) Osa-miRNA expression alteration following the infection by Rhizoctonia solani.
3. Materials and Methods
3.1. Plant Materials and Treatments
Seed of the rice (Oryza sativa) cultivar Hashemi which is susceptible to sheath blight disease, were let to germinate on moist filter papers and the resulted seedlings were transplanted into 13-cm pots containing clay loam soil. The pots were incubated in greenhouse (16 hrs light and 8 hrs dark cycle). A highly virulent pure culture of R. solani AG1-IA isolate G88 which has been isolated from Iran ( 10 ) was prepared by transferring of fungal sclerotia to 9-cm Petri dishes containing potato dextrose agar (PDA). Then, 60-day-old plants were inoculated with 5- mm agar discs of R. solani culture. The pots were transferred to greenhouse under 25-30 ℃ optimum temperature and 95% humidity conditions. As negative controls, some of the plants were inoculated using agar discs without pathogen. Samples of infected and mock- inoculated sheaths were prepared after 2 hpi (hours post inoculation), 2 dpi (days post inoculation) and 6dpi (Fig. 1).
Figure 1.

Pictures of rice plants inoculated by Rhizoctonia solani, the sheath blight causal agent. Disease symptoms (shown by arrows) were appeared 2 days after inoculation and are expanded to a maximum size at 6 dpi. Mock (M) shows rice sheaths treated with agar discs without pathogen.
3.2. RNA Extraction and cDNA Synthesis
Total RNA was extracted from infected and control plant samples using Trizol reagent (Ambion, USA) according to the manufacturer’s protocol. Extracted RNAs were treated by using DNase I (Fermentas, USA) for removing any genomic DNA contamination. RNAs were polyadenylated using poly A polymerase. First- strand cDNA was synthesized using PrimeScriptTM 1st strand cDNA synthesis kit (Takara, Japan) and a mix of anchored Oligo-dT, in a 25 µL total reaction volume.
3.3. Primer Designing for miRNAs and Detection of miRNA Target Genes
Based on the known sequence of plant conserved miRNAs, responsive to biotic and abiotic stresses, a total of eight miRNAs including Osa-miR156, Osa-miR159, Osa-miR166, Osa-miR167, Osa-miR171, Osa-miR393, Osa-miR408, and a monocot-specific miRNA, Osa- miR444 were selected from miRBase database (www. mirbase.org) and used for further analyses (Table 1). The sequences of these miRNAs were used as forward primers (with minor modifications at 3’ and 5’ ends) together with a universal reverse primer in qRT-PCR (Table 2). For selection of the miRNAs target genes miRBase (http://www.miRbase.org/) and TarBase (http://diana.cslab.ece.entua.gr/tarbase) online tools were employed
Table 1.
Candidate miRNAs responsive to rice sheath blight disease
| Osa-miRNAs | Location of the target site | Target gene |
|---|---|---|
| Osa-miR156 | CDS & 3' UTR | SBP domain containing protein |
| Osa-miR159 | CDS | MYB family transcription factors |
| Osa-miR166 | CDS | START domin containing protein |
| Osa-miR167 | CDS | Auxin response factor |
| Osa-miR171 | CDS | SCARECROW gene regulation |
| Osa-miR393 | CDS | Transport inhibitor response1 protein |
| Osa-miR408 | 3' UTR | Plastocyanin-like protein |
| Osa-miR444 | CDS | MADS-box transcription factor |
Table 2.
List of primers used in this study
| Primer | Sequence (5'-3' ) | Tm (℃) |
|---|---|---|
| osa-miR156 | TGACAGAAGAGAGTGAGCAC | 54 |
| Osa-miR159 | TTTGGATTGAAGGGAGCTC | 52.3 |
| Osa-miR166 | TCGGACCAGGCTTCATTCC | 57.2 |
| Osa-miR167 | TGAAGCTGCCAGCATGATCT | 56.9 |
| Osa-miR171 | TGATTGAGCCGCGCCAATA | 57.4 |
| Osa-miR393 | TCCAAAGGGATCGCATTGATC | 55.2 |
| Osa-miR408 | CTGCACTGCCTCTTCCCTG | 58.3 |
| Osa-miR44 | TTGCTGCCTCAAGCTTGC | 56.7 |
| Universal | AACTCAAGGTTCTTCCAGTCACG | 60 |
| tae-U6 (forward) | CGGGGACATCCGATAAAATTGG | 62.1 |
| tae-U6 (reverse) | TTGGACCATTTCTCGATTTGTG | 58.4 |
| SBP (forward) | AGCATGCTCTCTCTCTTCTGTCA | 62.9 |
| SBP (reverse) | CCAGGGTGAATCTGAGAACCT | 61.3 |
| MADS (forward) | CGGCCGCCTCTACGAGTAC | 63.8 |
| MADS (reverse) | TGCTGCTCATCCTTGGACTTG | 61.3 |
| Tae-actin (forward) | TGTTCCAGCCATCTCATGTTGG | 62.1 |
| Tae-actin (reverse) | TCATGCGATCAGCAATTCCAGG | 62.1 |
3.4.Quantitative Real-Time PCR Analysis
In order to study the expression profiles of selected miRNAs in response to rice sheath blight disease, RT- qPCR was performed using ABI (Applied Biosystems StepOne). Real-Time system was set up using CYBR Green I as follows: 94 °C for 15 min, 40 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 20 s and a final extension at 72 °C for 8 min. Quantitative RT-PCR data were analyzed using GraphPad Prism tool and each time point data of R. solani treated plants were compared to mock-inoculated plants data at the same time point using 2–ΔΔCT method, and were used in order to calculate the fold changes in the expression of the studied genes. Wheat U6 (tae-U6) gene which is well conserved in rice was used as reference gene. Polyacrylamide gel electrophoresis (PAGE) was performed to confirm qRT- PCR amplification products followed by cloning of the products in TA-pTG19 cloning vector and transformation in competent Escherichia coli (DH5α). The transformed colonies were selected and plasmid isolation was performed using plasmid extraction kit (GeneAll, Korea) followed by sequencing.
3.5. Designing Primers for Target Genes
SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1 factors which are known to be involved in plant development. SPL3 transcription factor gene as a target for Osa-miR156, and, Os-MADS gene as a target for miR444 were used for primer design. The primers were designed using the software primer3 web (version 4.1.10) freely available online (http://primer3.ut.ee/) and were further analyzed using Oligo-analyzer software (http:// euidtdna.com/calc/analyser).
3.6. Real-Time Analysis of Target Genes Expression Pattern
Real-time amplification of target genes was performed using an ABI (Applied Biosystems StepOne) system with CYBR Green master mix (BioFact, South Korea) as following thermal cycles: 94 °C for 15 min, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 20 s and final extension at 72 ℃ for 8 min. Wheat actin gene that is conserved in rice was used as endogenous control.
4. Results
4.1. Alteration of Candidate Osa-miRNAs Expression in Response to Sheath Blight Disease
In order to investigate the expression alteration of candidate rice miRNAs in response to sheath blight disease, rice plants were inoculated with R. solani (Fig. 1). Then, expression level alteration of some conserved rice miRNAs (Osa-miRNAs) was investigated 2 hpi, 2 dpi and 6 dpi in pathogen-infected or mock treated plants. RT-qPCR analysis suggested four subgroups of candidate miRNAs based on the time of their responses to the pathogenesis of R. solani.
4.2. Early-Responsive Osa-miR156
The expression of Osa-miR156 was significantly increased as early as 2 hpi in susceptible rice plants with R. solani and lasted for 2 days (Fig. 2). Because of the almost immediate response of Osa-miR156 to the infection, this miRNA was categorized as early- responsive to R. solani infection. On the other hand, the SPL3 gene has been reported as a target gene for Osa- miR156 ( 11 ). Therefore, SPL3 gene expression status was also investigated in the same samples and a negative correlation of expression was deduced between them (Fig. 2). At this time point, the preliminary symptoms of disease were detectible on the infected leaves (Fig. 1).
Figure 2.

Real-Time PCR expression alteration of early responsive Osa-miR156 and its target gene, SPL3, in response to rice sheath blight disease, compared to untreated plants. This miRNA is upregulated as early as 2 hpi and last for at least 2dpi. Then, its relative expression is significantly decreased at 6dpi. Data normalization was performed by using wheat U6 and actin genes for Osa-miR156 and SPL3 expression, respectively. Results are the mean of three independent replicates.
4.3. Late-Responsive miRNAs
RT-qPCR results indicated that Osa-miR159 expression level was increased at 2 dpi and lasted until 6 dpi (Fig. 3). Therefore, Osa-miR159 was categorized as a late responsive miRNA to R. solani infection. Compared to other time points and control group, the level of Osa-miR167, Osa-miR171, Osa-miR408, and Osa- miR444 expression was increased about 6 dpi (Fig. 4). These miRNAs were categorized as the miRNAs late- responsive to the infection by R. solani. Transcripts of OsMADS gene are known as targets for Osa-miR444, therefore OsMADS expression status was investigated in the same samples. While Osa-miR444 expression level was increased 6 dpi, Osa-MADS expression level was decreased following the disease development (Fig. 4). At this time point, the strongest symptoms of disease were detectable (Fig. 1).
Figure 3.

RT-qPCR expression alteration of mid-late responsive Osa-miR159, in response to the rice sheath blight disease, compared to untreated plants. This miRNA is upregulated as early as 2 dpi and last for at least 6dpi. Data normalization was performed by using wheat U6 for Osa-miR-156. Results are the mean of three independent replicates.
Figure 4.

RT-qPCR results show synchronized expression alterations of Osa-miR167, Osa-miR171, Osa-miR408, and Osa-miR444 in response to rice sheath blight disease, compared to untreated plants. The expression of an OsMADS encoding gene as a known target gene for Osa-miR444 has also been investigated in the same samples, showing a negative correlation with Osa-miR444 expression status. Wheat U6 gene was used for data normalization. Results are the mean of three independent replicates.
4.4. Non-Responsive miRNAs
RT-qPCR results indicated that Osa-miR166 and Osa-miR393 did not exhibit any significant expression alterations in the infected rice compared to the control plants (Fig. 5).
Figure 5.

Depicts non-significant expression alteration of Osa-miR393 and Osa-miR166, in response to the rice sheath blight disease using RT-qPCR, compared to untreated plants. Results are the mean of three independent replicates
5. Discussion
Some of the rice lines such as Jasmine 85 are reported to be partially resistant to sheath blight disease ( 12 , 13 ). However, no complete resistant rice variety has been reported yet ( 13 ). MicroRNAs as a group of small non- coding RNAs play important roles in the biological processes including plant-pathogen interactions. Conservation of plant miRNAs emphasize their function and here, it was intended to analyze the expression status of some conserved candidate plant miRNAs following the challenge of rice with sheath blight disease. Of course, we had in mind that being conserved and being involved in response to other disease resistances, do not guarantee that candidate miRNAs are associated with resistance to the sheath blight disease. Also, response to a stimulus is different than the expression alteration upon a stimulus. Never the less, miR156, miR159, miR166, miR167, miR171, miR393 and miR408 are conserved between wheat and rice ( 14 ). Also, some of these miRNAs are conserved in maize, Arabidopsis, and Sorghum. Therefore, expression status of these candidate miRNAs was investigated in response to the sheath blight disease in Hashemi rice variety, regarded as a susceptible cultivar.
5.1. Early-Responsive Osa-miR156
The expression of Osa-miR156 was significantly increased as early as 2 hpi in susceptible rice plants challenged with R. solani and lasted for 2 days (Fig. 2). Consistently, Tae-miR156 expression level has been reported to be increased following the viral infection of arabidopsis ( 15 ), rust infection ( 16 ) and heat stress ( 17 ) of wheat plants. However, its expression level has been down-regulated following the infection of at least two wheat genotypes by Blumeria graminis ( 17 ). At-MiR156 is involved in Arabidopsis development through regulation of 16 members of SPL (squam promoter binding protein-like) gene family. SPLs are known to be involved in plant developmental phase change ( 11 , 18 ) and also in plant response to stressors like copper and fungal toxins ( 19 ). There are 19 SPL genes in rice, 11 of them have miRNA Responsive Element (MRE) recognized by Osa-miR156 ( 5 , 20 ). Particularly, SPL3 gene has been reported as a target gene for Osa-miR156 ( 11 ). Here in the present article, the expression pattern of SPL3 gene and Osa-miR156 was compared in the infected rice samples and a negative correlation was found between them (Fig. 2). Such a negative correlation has been reported between this miRNA and its target genes in powdery mildew- infected wheat cultivars ( 7 , 17 ). Overall, our findings suggest that Osa-miR156 may affect rice response to sheath blight disease probably through the alteration of SPL3 gene expression level. This miRNA may be considered as an early marker for this infection in rice.
5.2. Mid-Late Responsive Osa-miR159
The expression level of Osa-miR159 was increased 2 dpi and lasted until 6 dpi (Fig. 3). These results are consistent with the earlier findings showing that the expression of Osa-miR159 was increased in wheat upon yellow rust disease infection ( 16 ) and drought stress in rice ( 3 ). The miR159 has an important role in plant development by targeting MYB transcription factors which affect plant responses to different stresses ( 21 , 22 ). MiR159 has other non-conserved targets including Cu/Zn SOD genes ( 4 ) encoding pathogenesis-related proteins peroxidase (POD) and cytokinin oxidase (CKX) ( 8 ). These target genes have important roles in Populus tricocarpa resistance to fungal diseases and in increased arabidopsis resistance to club-root disease caused by Plasmodiophora brassicae ( 8 ). Overall, Osa- miR159 may affect rice response to sheath blight.
5.3. Late Responsive Osa-miRNAs
Real-time analysis indicated that Osa-miR167, Osa- miR171, Osa-miR408, and Osa-miR444 expression levels have been increased about 6 dpi, compared to other time points and control plants (Fig. 4). Our finding is in consistency with the up-regulation of miR167 during disease progress and salt, drought and powdery mildew disease stress in Arabidopsis and wheat, respectively ( 17 , 23 ). However, Osa-miR167 expression level has been decreased following drought stress ( 24 ) and ABA treatment in rice and in arabidopsis plants infected by the nematode, Heterodera schachyii ( 7 ). MiR171 expression has been reported to be increased in rice and arabidopsis under cold and salinity stresses ( 7 ), whereas it has been reported to be decreased under drought and oxidative stresses ( 25 ). Both Osa-miR167 and Osa- miR171 are known to regulate auxin signaling through Auxin Response Factors (ARFs) targeting. Target genes of miR408 are known to be involved in programmed cell death, pathogen infection and defense responses ( 8 , 26 ). Consistently, miR408 expression has been increased in response to salinity, cold and oxidative stress in Arabidopsis. The expression of Osa-miR444 as a monocot-specific miRNA ( 14 ) was investigated along with its known target, OsMADS gene. While Osa-miR-444 expression level was increased 6 dpi, Osa-MADS expression level was decreased following the disease progression (Fig. 4). Consistently, Blumeria graminis infection in wheat susceptible cultivar (JD8), as well as cold stress in rice, have all led to the increased expression level of miR444 ( 7 ).
5.4. Expression Alterations of Osa-miR166 and Osa- miR393
Osa-miR166 and Osa-miR393 had no significant expression alterations in the infected rice compared to the control plants (Fig. 5). However, miR166 is reported to be down-regulated 8 h after drought stress in Triticum dicoccoides ( 2 ) and in rice ( 3 ). MiR393 is known to be involved in plant basal defense against pathogens. While, its overexpression in Arabidopsis thaliana increases susceptibility to Alternaria brassicicola, enhances resistance to Hyaloperonospora due to its effects on auxin receptors. Overall, it seems that unlike their common expression alteration in other plant pathosystems, Osa-miR166 and Osa-miR393 are not directly involved in rice R. solani interaction.
6. Conclusion
To get insight into the possible role of rice miRNAs in response to fungal sheath blight disease the expression level of eight conserved miRNAs and some of their target genes were studied in the present study. These miRNAs were classified into; early responsive, mid- late responsive, late responsive and no responsive miRNAs. From these data, it is suggested that early (Osa-miR-156) and late (Osa-miR167, Osa-miR171, Osa-miR408, Osa-miR444) responsive miRNAs may be involved in rice plant response to the infection by R. solani. It remains to be tested if the expression pattern of these miRNAs are different in rice plants with different degrees of resistance to disease and are dose dependent on the infection. Also, it remains to be tested if the expression alteration of these candidate miRNAs is active response initiated by plants or a passive consequence due to the stimulus.
Acknowledgement
This research was financially supported by the Iranian National Scientific Foundation (project no. 92043155).
Conflict of Interest: n
References
- 1.Liu W, Liu J, Triplett L, Leach JE, and Wang GL. Novel insights into rice innate immunity against bacterial and fungal pathogens. Annu Rev Phytopathol. 2004;52:213–241. doi: 10.1146/annurev-phyto-102313-045926. [DOI] [PubMed] [Google Scholar]
- 2.Kantar M, Lucas SJ, and Budak H. miRNA expression patterns of Triticum dicoccoides in response to shock drought stress. Planta. 2011;233:471–484. doi: 10.1007/s00425-010-1309-4. [DOI] [PubMed] [Google Scholar]
- 3.Zhou L, Liu Y, Liu Z, Kong D, Duan M, and Luo L. Genome-wide identification and analysis of drought-responsive microRNAs in Oryza sativa. J Exp Bot. 2014;61:4157–4168. doi: 10.1093/jxb/erq237. [DOI] [PubMed] [Google Scholar]
- 4.Sunkar R, Girke T, Jain PK, and Zhu JK. Cloning and characterization of microRNAs from rice. Plant Cell. 2005;17:1397–1411. doi: 10.1105/tpc. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Xie K, Wu C, and Xiong L. Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding- like transcription factors and microRNA156 in rice. Plant physiol. 2006;142:280–293. doi: 10.1104/pp.106.084475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Teotia PS, Mukherjee SK, and Mishra NS. Fine tuning of auxin signaling by miRNAs. Physiol Mol Biol Plants. 2008;14:81–90. doi: 10.1007/s12298-008-0007-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bej S, and Basak J. MicroRNAs: The Potential Biomarkers in Plant Stress Response. Am J Plant Sci. 2014;5:748–759. doi: 10.4236/ajps.2014.55089. [DOI] [Google Scholar]
- 8.Zhao JP, Jiang XL, Zhang BY, and Su XH. Involvement of microRNA-mediated gene expression regulation in the pathological development of stem canker disease in Populus trichocarpa. PLoS One. 2012;7:e44968. doi: 10.1371/journal.pone.0044968. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Campo S, Peris‐Peris C, Siré C, Moreno AB, Donaire L, Zytnicki M, et al. Identification of a novel microRNA (miRNA) from rice that targets an alternatively spliced transcript of the Nramp6 (Natural resistance‐associated macrophage protein 6) gene involved in pathogen resistance. New Phytol. 2013;199:212– 227. doi: 10.1111/nph.12292. [DOI] [PubMed] [Google Scholar]
- 10.Padasht‐Dehkaei F, Ceresini P, Zala M, Okhovvat S, Nikkhah M, and McDonald B. Population genetic evidence that basidiospores play an important role in the disease cycle of rice‐infecting populations of Rhizoctonia solani AG‐1 IA in Iran. Plant pathol. 2013;62:49–58. doi: 10.1111/j.1365-3059.2012.02613.x. [DOI] [Google Scholar]
- 11.Wu G, and Poethig RS. Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Development. 2006;133:3539–3547. doi: 10.1242/dev.02521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Prasad B, Gizenga C. Rice sheath blight disease resistance identified in Oryza spp. Accessions. Plant Dis . 2008;92(11) doi: 10.1111/j.1365-3059.2012.02613.x. [DOI] [PubMed] [Google Scholar]
- 13.Jia L, Yan W, Zhu C, Agrama HA, Jackson A, Yeater K, Li X, Huang B, Hu B, McClung A, Wu D. Allelic analysis of sheath blight resistance with association mapping in rice. Plos One. 2012;7(3):e32703. doi: 10.1371/journal.pone.0032703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.YaoY, Guo G, Ni Z, Sunkar R, Du J, Zhu JK. Cloning and characterization of microRNAs from wheat (Triticum aestivum L.) Genome Biol. 2007;8:R96. doi: 10.1186/gb-2007-8-6-r96. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, Krizan KA. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev Cell. 2003;4:205–217. doi: 10.1016/s1534-5807(03)00025-x. [DOI] [PubMed] [Google Scholar]
- 16.Feng H, Sun Y, Wang B, Wang X, and Kang Z. Microarray- based identification of conserved microRNA from wheat and their expression profiles response to Puccinia striiformis f.sp. tritici. Can J Plant Pathol. 2015;37:82–91. doi: 10.1016/j.gene.2011.08.009. [DOI] [Google Scholar]
- 17.Xin M, Wang Y, Yao Y, Xie C, Peng H, Ni Z. Diverse set of microRNAs are responsive to powdery mildew infection and heat stress in wheat (Triticum aestivum L.) BMC Plant Biol. 2010;10:123. doi: 10.1186/1471-2229-10-123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, and Weigel D. Specific effects of microRNAs on the plant transcriptome. Dev Cell. 2005;8:517–527. doi: 10.1016/j.devcel.2005.01.018. [DOI] [PubMed] [Google Scholar]
- 19.Wang B, Geng S, Wang D, Feng N, Zhang D, Wu L. Characterization of Squamosa Promoter Binding Protein-LIKE genes in wheat. J Plant Biol. 2005;58:220–229. doi: 10.1007/s12374-015-0105-x. [DOI] [Google Scholar]
- 20.Hou H, Li J, Gao M, Singer SD, Wang H, Mao L. Genomic organization, phylogenetic comparison and differential expression of the SBP-box family genes in grape. PloS One. 2013;8(3):e59358. doi: 10.1371/journal.pone.0059358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jung JH, Seo PJ, and Park CM. MicroRNA biogenesis and function in higher plants. Plant Biotech Rep. 2009;3:111–126. doi: 10.1007/s11816-009-0085-8. [DOI] [Google Scholar]
- 22.Li YF, Zheng Y, Addo‐Quaye C, Zhang L, Saini A, Jagadeeswaran G. Transcriptome‐wide identification of microRNA targets in rice. Plant J. 2010;62:742–759. doi: 10.1111/j.1365-313X.2010.04187.x. [DOI] [PubMed] [Google Scholar]
- 23.Liu HH, Tian X, Li YJ, Wu CA. and Zheng CC. Microarray- based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 2008;14:836–843. doi: 10.1261/rna.895308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Bakhshi B, Salekdeh GH, Bihamta MR, and Tohidfar M. Characterization of Three Key MicroRNAs in Rice Root Architecture under Drought Stress using in silico Analysis and Quantitative Real-time PCR. Biol Plant. 2015;59(1):37–46. doi: 10.13005/bbra/1306. [DOI] [Google Scholar]
- 25.Eldem, V, Okay S. and ÜNVER T. Plant microRNAs: new players in functional genomics. Turk J Agric For. 2013;37:1– 21. doi: 10.3906/tar-1206-50. [DOI] [Google Scholar]
- 26.Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ. Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.) BMC Plant Biol. 2010;10:1. doi: 10.1186/1471-2229-10-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
